ID: 1168877414

View in Genome Browser
Species Human (GRCh38)
Location 20:1181110-1181132
Sequence GAGATGTACTACGCCCGCCT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 24}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168877414_1168877417 13 Left 1168877414 20:1181110-1181132 CCTAGGCGGGCGTAGTACATCTC 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1168877417 20:1181146-1181168 TCCCGCGCTGTCACTGTGTCCGG 0: 1
1: 0
2: 0
3: 8
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168877414 Original CRISPR GAGATGTACTACGCCCGCCT AGG (reversed) Exonic