ID: 1168877414

View in Genome Browser
Species Human (GRCh38)
Location 20:1181110-1181132
Sequence GAGATGTACTACGCCCGCCT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 24}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168877414_1168877417 13 Left 1168877414 20:1181110-1181132 CCTAGGCGGGCGTAGTACATCTC 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1168877417 20:1181146-1181168 TCCCGCGCTGTCACTGTGTCCGG 0: 1
1: 0
2: 0
3: 8
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168877414 Original CRISPR GAGATGTACTACGCCCGCCT AGG (reversed) Exonic
904685665 1:32258425-32258447 GTGCTGTACTACTCCAGCCTGGG + Intronic
916687779 1:167162764-167162786 GAAAAGTACTACACGCGCCTGGG - Intergenic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
1089213661 11:116822688-116822710 GAGATGTTCCACGGCCTCCTTGG + Exonic
1095919672 12:47516768-47516790 GAGATGGGCTACGACAGCCTTGG + Intergenic
1113280017 13:108778836-108778858 GAGAGGTTCTATGCCAGCCTTGG - Intronic
1117205718 14:53441246-53441268 GAGATGTACCATTCCTGCCTAGG - Intergenic
1121037507 14:90718539-90718561 GAGATACACTACGACCACCTAGG - Intronic
1123084130 14:105709637-105709659 GAGCTGTACTAAGCTGGCCTGGG - Intergenic
1130283871 15:82540062-82540084 GAAAAGTACTACACGCGCCTGGG - Exonic
1133122462 16:3618494-3618516 CAGAGGTAATCCGCCCGCCTTGG - Intronic
1136769131 16:32818999-32819021 GCCTTGTAATACGCCCGCCTTGG + Intergenic
1203071549 16_KI270728v1_random:1081106-1081128 GCCTTGTAATACGCCCGCCTTGG + Intergenic
1168877414 20:1181110-1181132 GAGATGTACTACGCCCGCCTAGG - Exonic
1174270835 20:49367224-49367246 GAGATGTCCTCCGCCCACCCAGG + Exonic
1182675888 22:32039540-32039562 GAAAAGTACTACACACGCCTGGG + Intergenic
963827265 3:149970108-149970130 GAGATGTACGCCGACCGCGTAGG - Intronic
1006441134 6:34054395-34054417 CAGATGAACTCCGCCCGCCTCGG + Intronic
1017966899 6:159274914-159274936 GTGAGCTACTACGCCCGGCTAGG - Intergenic
1038281748 8:26171435-26171457 GAGATGCAGTGCGCCAGCCTGGG + Intergenic
1039003475 8:33007755-33007777 CAGATGTTCTAGGCCAGCCTGGG + Intergenic
1051364553 9:16312217-16312239 GAGATGTAGTACGGCCACCTCGG - Intergenic
1053698166 9:40658476-40658498 GCCTTGTAATACGCCCGCCTTGG + Intergenic
1054309457 9:63457884-63457906 GCCTTGTAATACGCCCGCCTTGG + Intergenic
1054441398 9:65265833-65265855 GCCTTGTAATACGCCCGCCTTGG + Intergenic
1054488879 9:65755656-65755678 GCCTTGTAATACGCCCGCCTTGG - Intergenic
1202780529 9_KI270717v1_random:31667-31689 GCCTTGTAATACGCCCGCCTTGG + Intergenic