ID: 1168877414 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:1181110-1181132 |
Sequence | GAGATGTACTACGCCCGCCT AGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 27 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 2, 4: 24} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1168877414_1168877417 | 13 | Left | 1168877414 | 20:1181110-1181132 | CCTAGGCGGGCGTAGTACATCTC | 0: 1 1: 0 2: 0 3: 2 4: 24 |
||
Right | 1168877417 | 20:1181146-1181168 | TCCCGCGCTGTCACTGTGTCCGG | 0: 1 1: 0 2: 0 3: 8 4: 238 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1168877414 | Original CRISPR | GAGATGTACTACGCCCGCCT AGG (reversed) | Exonic | ||