ID: 1168877417

View in Genome Browser
Species Human (GRCh38)
Location 20:1181146-1181168
Sequence TCCCGCGCTGTCACTGTGTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 238}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168877414_1168877417 13 Left 1168877414 20:1181110-1181132 CCTAGGCGGGCGTAGTACATCTC 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1168877417 20:1181146-1181168 TCCCGCGCTGTCACTGTGTCCGG 0: 1
1: 0
2: 0
3: 8
4: 238
1168877410_1168877417 29 Left 1168877410 20:1181094-1181116 CCTGTCCAGGTGGGAGCCTAGGC 0: 1
1: 0
2: 5
3: 12
4: 151
Right 1168877417 20:1181146-1181168 TCCCGCGCTGTCACTGTGTCCGG 0: 1
1: 0
2: 0
3: 8
4: 238
1168877415_1168877417 -9 Left 1168877415 20:1181132-1181154 CCAGTCGTTCCATCTCCCGCGCT 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1168877417 20:1181146-1181168 TCCCGCGCTGTCACTGTGTCCGG 0: 1
1: 0
2: 0
3: 8
4: 238
1168877413_1168877417 24 Left 1168877413 20:1181099-1181121 CCAGGTGGGAGCCTAGGCGGGCG 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1168877417 20:1181146-1181168 TCCCGCGCTGTCACTGTGTCCGG 0: 1
1: 0
2: 0
3: 8
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168877417 Original CRISPR TCCCGCGCTGTCACTGTGTC CGG Exonic
900005075 1:39874-39896 TCTCGCTCTGTCACTGAGGCTGG - Intergenic
900598670 1:3493844-3493866 ACCAGCGCTGTGACTGTGACGGG - Exonic
901578571 1:10221125-10221147 TCTCGCTCTGTCACTGAGGCTGG + Intronic
901730205 1:11273471-11273493 TCCCGGGCGGTCACTGTGCGTGG + Exonic
901827045 1:11868991-11869013 TCCCCAGCTCTCTCTGTGTCAGG + Intergenic
904707448 1:32402071-32402093 TCTCGTGCTGTCACTGGGGCTGG + Intergenic
908452164 1:64266530-64266552 TCCCGCGCTTCCACTGTGCCAGG - Intronic
911605973 1:99905603-99905625 TCCCACTCTGTCACTGAGACTGG + Intronic
911719996 1:101180502-101180524 TCTCGCTCTGTCACTGAGGCTGG - Intergenic
912448531 1:109755789-109755811 TCTCGCTCTGTCACTCAGTCTGG - Intronic
912557966 1:110529932-110529954 TCCCTGGCTGTCTCTGTCTCTGG + Intergenic
912603411 1:110963396-110963418 TCCCGCGGAGCCGCTGTGTCAGG + Intronic
913000402 1:114574897-114574919 TCTCGCTCTGTCACTGTGGCTGG + Intronic
913005465 1:114626538-114626560 TCTCGCTCTGTCACTAAGTCTGG + Intronic
916749037 1:167707694-167707716 TCTCGCGCTGTCACTCAGGCTGG + Intergenic
918371560 1:183866758-183866780 ACCCGCTCTGGCTCTGTGTCCGG + Intronic
920170328 1:204068067-204068089 TCTCGCTCTGTCACTCTGGCTGG - Intergenic
920522732 1:206640578-206640600 TCTCGCTCTGTCACTGAGGCTGG + Intronic
921483574 1:215690917-215690939 TCTCGCTCTGTCACTGAGGCTGG + Intronic
923950980 1:238953384-238953406 TCTCGCTCTGTCACCGTGGCTGG - Intergenic
924811228 1:247404227-247404249 TCTCGCTCTGTCACTGAGGCTGG + Intergenic
1062883935 10:1001951-1001973 TCTCGCTCTGTCACTGAGGCTGG + Intronic
1063412212 10:5845313-5845335 TCTCGCTCTGTCACCGAGTCTGG + Intergenic
1064386067 10:14892842-14892864 TCTCGCGCTGTCACTCAGACTGG + Intronic
1064735850 10:18381113-18381135 TCCCCAGCTGGCCCTGTGTCTGG - Intronic
1065366602 10:24943578-24943600 TCCCGCACTGTCACCCAGTCTGG + Intronic
1066419896 10:35255348-35255370 TCCCGCTCTGTCACCCAGTCTGG + Intronic
1069677922 10:70261809-70261831 TCTCGCTCTGTCACTGAGGCTGG + Intronic
1072467083 10:95674789-95674811 TCTCGCTCTGTCACTCTGGCTGG - Intronic
1072579204 10:96725239-96725261 TCCCGCTCTGTCACTCAGGCTGG - Intergenic
1073657262 10:105430171-105430193 TCTCGCTCTGTCACTGAGGCTGG + Intergenic
1074183648 10:111083511-111083533 TGCCACACTGTCACTGTGTGTGG - Intergenic
1076561198 10:131365733-131365755 TGCCACGCTGTCACAGGGTCTGG - Intergenic
1076606623 10:131693720-131693742 TCCCACGCAGTCCCTGTGGCGGG + Intergenic
1078350169 11:10586445-10586467 TCCCGCTCTGTCACTCAGGCTGG + Intronic
1079953440 11:26833055-26833077 TCTCGCACTGTCACTGGGGCTGG - Intergenic
1081596617 11:44463812-44463834 CCCCGCTGTGTCACTATGTCTGG + Intergenic
1082973939 11:59053901-59053923 TCCCGCTCTGTCACTCAGGCTGG + Intergenic
1082978348 11:59097694-59097716 TCCTGCTCTGTCACTCAGTCTGG + Intergenic
1084059621 11:66661998-66662020 TCTCGCTCTGTCACTGAGGCTGG - Intronic
1084131558 11:67139737-67139759 TCTCGCTCTGTCACTCAGTCTGG + Intronic
1084598820 11:70132918-70132940 TCCAGCGCTGTCTCTGTGCCTGG - Intronic
1084687738 11:70706949-70706971 TCCTGCGCTCTGACTGTTTCTGG + Intronic
1085082068 11:73643460-73643482 TCTCACTCTGTCACTGAGTCTGG + Intergenic
1087457532 11:98405919-98405941 TCTCGCTCTGTCACTGAGGCTGG + Intergenic
1089110359 11:116050977-116050999 TCCTGCTCTGTCACTTGGTCTGG - Intergenic
1089510335 11:118992611-118992633 TCCCGCTCTGTCACTCAGGCCGG + Intergenic
1090710862 11:129383901-129383923 TCTCGCTCTGTCACTGAGGCTGG + Intronic
1090910939 11:131118717-131118739 TCTCGCTCTGTCACTGAGGCTGG + Intergenic
1091464925 12:675514-675536 TCTTGCTCTGTCACTGTGGCTGG - Intergenic
1094172497 12:27508481-27508503 TCTCACTCTGTCACTGAGTCTGG - Intergenic
1094428512 12:30341170-30341192 TCTCGCTCTGTCACTCAGTCTGG + Intergenic
1097678991 12:62631937-62631959 TCCCGCTCCGGCACTGTGGCAGG - Intergenic
1098117748 12:67198503-67198525 TCTCGCTCTGTCACTGAGGCTGG + Intergenic
1099086147 12:78247996-78248018 TCTCGCTCTGTCACTCAGTCTGG - Intergenic
1099402400 12:82216092-82216114 TCCCGCACTGTGACTGAATCTGG - Intergenic
1101874007 12:108587188-108587210 TCTCGCTCTGTCACTGAGGCTGG + Intergenic
1105382080 13:19896729-19896751 TCTTGCTCTGTCACTCTGTCAGG - Intergenic
1105844321 13:24281461-24281483 TCCCTGGCTGTCGCGGTGTCCGG + Intronic
1109341107 13:61060309-61060331 TCTCACGCTGTCACTGTGGCTGG + Intergenic
1110131341 13:72015525-72015547 TCCCGCTCTGTCACTCAGGCTGG + Intergenic
1110739222 13:78975266-78975288 TCTCGCTCTGTCACTCAGTCTGG - Intergenic
1111739060 13:92178939-92178961 TCCCGCTCTGTCACCCAGTCTGG - Intronic
1112361665 13:98724472-98724494 TCTCGCTCTGTCACTCAGTCTGG - Intronic
1112847552 13:103662836-103662858 TCCTGTGCTGTCTCTGTGGCTGG + Intergenic
1114226147 14:20740697-20740719 TCTCGCTCTGTCACTGAGGCTGG + Intronic
1118198139 14:63647439-63647461 TCACGCCCAGTCACTGTATCAGG + Intergenic
1119699114 14:76740177-76740199 TCTCGCTCTGTCACTGAGGCTGG + Intergenic
1120983069 14:90308337-90308359 TCCCGCAGTGACACTGTGTATGG - Intronic
1122329177 14:100901508-100901530 CCCAGCCCTGTCACTGTGTGAGG + Intergenic
1125618953 15:41041862-41041884 TCTCGCTCTGTCACTGAGGCTGG + Intronic
1127234193 15:57030266-57030288 TCTTGCGCTGTCACTGAGGCAGG + Intronic
1127421053 15:58806385-58806407 TCTCACTCTGTCACTTTGTCTGG + Intronic
1131025681 15:89139474-89139496 ACCAGGGCGGTCACTGTGTCCGG + Intronic
1131193710 15:90337961-90337983 TCTCGCTCTGTCACTGAGCCTGG + Intergenic
1132448438 15:101951070-101951092 TCTCGCTCTGTCACTGAGGCTGG + Intergenic
1134194993 16:12152918-12152940 TCCAGCCCTGCCACTGTGTGCGG - Intronic
1134490389 16:14691668-14691690 TCCCCTGTTGTCACTGTGTAAGG - Intronic
1134495770 16:14730785-14730807 TCCCCTGTTGTCACTGTGTAAGG - Intronic
1134748331 16:16605307-16605329 TCTCGCTCTGTCACTGAGGCTGG + Intergenic
1135051232 16:19194623-19194645 TCTCACGCTGTCACTGAGGCTGG + Intronic
1135744656 16:25006418-25006440 TCCCTCTCTGTCACTCAGTCTGG - Intronic
1137749628 16:50849997-50850019 TCTCGCTCTGTCACTGAGGCTGG + Intergenic
1138185116 16:54970943-54970965 TCCTGCCCTCTCTCTGTGTCGGG - Intergenic
1140854863 16:78969129-78969151 TCCCTGGCTGTTTCTGTGTCTGG + Intronic
1142052427 16:87967483-87967505 TCTCGCTCTGTCACTGAGGCTGG + Intronic
1142267929 16:89073087-89073109 TCCCTGGCTGTCAAGGTGTCAGG + Intergenic
1142357494 16:89609073-89609095 TCTCGCTCTGTCACTGAGGCTGG + Intergenic
1142986144 17:3696290-3696312 TGCAGGGGTGTCACTGTGTCAGG - Exonic
1143059549 17:4188228-4188250 GGCCGCGCTGTCACTCTGGCTGG + Intronic
1143609238 17:8008049-8008071 TCCCCCACTGTCTCTCTGTCTGG - Intronic
1143666877 17:8367631-8367653 TCTCGCTCTGTCACTGAGGCTGG - Intergenic
1146759193 17:35461279-35461301 TCTCGCTCTGTCACTGAGGCTGG + Intergenic
1147138630 17:38449347-38449369 CCCCGCACTGGCACTATGTCTGG - Intronic
1147609288 17:41792220-41792242 TCCCAAGTTCTCACTGTGTCAGG - Intergenic
1147775374 17:42897228-42897250 TCTCGCTCTGTCACTGAGGCTGG + Intergenic
1147802830 17:43106087-43106109 TCCTGCTCTGTCACTGAGGCTGG - Intronic
1148520488 17:48270371-48270393 TCTCGCTCTGTCACTGAGGCTGG + Intronic
1148923398 17:51060471-51060493 TCCCGCTCTGTCACCGAGGCTGG - Intronic
1150121729 17:62609109-62609131 TCTCACTCTGTCACCGTGTCTGG + Intronic
1150606031 17:66691741-66691763 TCACGAGCAGTCACTGGGTCAGG + Intronic
1152179679 17:78811099-78811121 TCTCGCTCTGTCACTGAGGCTGG - Intronic
1159680993 18:71351829-71351851 TCTCGCTCTGTCACCGTGGCTGG - Intergenic
1160350432 18:78173983-78174005 TCCCGCGCTCCCACAGTGTGTGG - Intergenic
1160586642 18:79916936-79916958 TCTGGCGCTGTCTCTGGGTCAGG + Intronic
1160636828 19:81483-81505 TCTCGCTCTGTCACTGAGGCTGG - Intergenic
1161820814 19:6530134-6530156 TCTCTCTCTGTCTCTGTGTCTGG - Intergenic
1162510519 19:11115316-11115338 TGTCGCTCTGTCACTGAGTCTGG + Intronic
1162751734 19:12833781-12833803 CCCGGCGCCGTCACTGCGTCTGG - Intronic
1162962839 19:14137851-14137873 TCTCGCGCTGTCACTCAGGCTGG + Intergenic
1162969689 19:14172987-14173009 TCCCGCTCTGTCACCGAGGCTGG + Intronic
1163247153 19:16103627-16103649 TCCCGCTCTGTCACCGGGGCTGG - Intergenic
1163353887 19:16797148-16797170 TCTCGCTCTGTCACTGAGGCTGG - Intronic
1165903009 19:39177575-39177597 TCCAGCGCTGTCTCTGCCTCTGG - Intronic
1166687424 19:44803856-44803878 TTCCGTGGTGTCACTGTGGCTGG - Intergenic
1166841366 19:45699061-45699083 TCTCGCTCTGTCACTGAGACTGG + Intronic
1167964846 19:53135400-53135422 TCCCGCTCTGTCACTGAGACTGG + Intronic
1168287493 19:55341943-55341965 TCTCGTGCTGTCACTCTGTCGGG - Exonic
926271157 2:11367065-11367087 TCTCGCTCTGTCACTGAGGCTGG - Intergenic
926890074 2:17631914-17631936 TCTCGCTCTGTCACTGAGGCTGG + Intronic
928507976 2:31973422-31973444 TCTTGCTCTGTCACTGAGTCTGG - Intronic
929090416 2:38211037-38211059 TTCCCTGATGTCACTGTGTCAGG - Intergenic
930519569 2:52448077-52448099 TCTCGCTCTGTCACTCAGTCGGG - Intergenic
931687380 2:64806044-64806066 TCTCGCTCTGTCACTGGGGCTGG - Intergenic
932656184 2:73613033-73613055 TCTCGCTCTGTCACCCTGTCTGG + Intergenic
934489985 2:94755903-94755925 TCTCTCCCTGTCACTGTGTTTGG - Intergenic
936109348 2:109652250-109652272 TCTCGCTCTGTCACTCAGTCTGG + Intergenic
937066148 2:119019462-119019484 TCTTGCCCTGTCACTCTGTCTGG - Intergenic
939251407 2:139685494-139685516 TCCAGCTCTGCCAGTGTGTCTGG - Intergenic
941106500 2:161360383-161360405 ACCCGCTCTGTCACTGAGGCTGG + Intronic
944426842 2:199592344-199592366 TCTCGCTCTGTCACTGAGCCTGG - Intergenic
945619353 2:212113542-212113564 TCTCGCTCTGTCACTGAGGCTGG - Intronic
946554662 2:220842178-220842200 TCTCGCTCTGTCACTGAGGCTGG - Intergenic
947678858 2:232011244-232011266 GCCCGTGCTTTCAATGTGTCAGG + Intronic
1168877417 20:1181146-1181168 TCCCGCGCTGTCACTGTGTCCGG + Exonic
1169116623 20:3070546-3070568 TCTCGCTCTGTCACTCTGGCTGG + Intergenic
1171902102 20:30867659-30867681 TCTCACGCTGTCACTCAGTCTGG - Intergenic
1173920020 20:46737283-46737305 TCTCGCTCTGTCACTCTGGCTGG - Intergenic
1178544142 21:33479541-33479563 TGCCGCGCTGTCACGCCGTCAGG - Intronic
1179933288 21:44586197-44586219 TCATGTGCTGTCCCTGTGTCAGG + Intronic
1180687750 22:17683101-17683123 TCTCGCACTGTCACTGGGGCTGG - Intronic
1183914833 22:41109481-41109503 TCCAGCACTTTCAATGTGTCAGG - Intronic
1184780196 22:46644760-46644782 TCTCGCTCTGTCACTGAGGCCGG + Intronic
1185165205 22:49257691-49257713 ACCCCCTATGTCACTGTGTCTGG + Intergenic
949662739 3:6298999-6299021 TCCCTCTCTGTCAGTCTGTCAGG - Intergenic
950004797 3:9684803-9684825 GCCTGCGTTGTCACTGGGTCTGG + Intronic
950779299 3:15377533-15377555 TCTCGCTCTGTCACTCTGGCTGG + Intergenic
952450547 3:33428150-33428172 TCTCGCTCTGTCACTGAGGCTGG - Intronic
952617123 3:35287962-35287984 TCTCGCTCTGTCACTGAGGCTGG + Intergenic
953344598 3:42164861-42164883 TCCCGCCCTGTCTCAGTGCCTGG + Intronic
954399027 3:50310292-50310314 TCCCGCTCTGTCACTCAGGCTGG + Intronic
955368226 3:58329714-58329736 TCTCGCTCTGTCACTGAGGCTGG + Intergenic
963806771 3:149730663-149730685 TCCAGATCTGTCACTGTGTCTGG - Intronic
968874772 4:3260557-3260579 TCCCGCTCTGTCACTCAGGCTGG + Intronic
972451948 4:39209680-39209702 TCTCGCTCTGTCACTGAGGCTGG - Intronic
972764815 4:42142601-42142623 TCTCACTCTGTCACTGAGTCTGG - Intronic
973913105 4:55604093-55604115 TCTCGCGCTGTCACTCAGGCTGG + Intronic
973980326 4:56303314-56303336 TCTCGCTCTGTCACCGAGTCTGG - Intronic
974634642 4:64545515-64545537 TCCCGCTCTGTCACTCAGGCTGG + Intergenic
977683035 4:99816153-99816175 TCTCGCTCTGTCACTCAGTCTGG - Intergenic
977921823 4:102653121-102653143 TCATGGGCTCTCACTGTGTCAGG + Intronic
980115389 4:128673943-128673965 TCTCGCTCTGTCACTCAGTCTGG - Intergenic
984417081 4:179475364-179475386 TCTCGCTCTGTCACTCTGGCTGG - Intergenic
984457368 4:179987357-179987379 TCTCGCTCTGTCACTGAGGCTGG + Intergenic
986152515 5:5140373-5140395 TCCCGCGCTCTGCCTGGGTCGGG + Exonic
987312208 5:16691667-16691689 TCTCGCTCTGTCACTGAGGCTGG - Intronic
989262884 5:39438161-39438183 TCTCGCTCTGTCACTCAGTCTGG - Intronic
995694416 5:114864262-114864284 TCTCGCTCTGTCACTGAGGCTGG + Intergenic
996084140 5:119286738-119286760 TCCCGCACTAACACTGTGACTGG - Intronic
997663865 5:135611465-135611487 TCTCGCTCTGTCACCGAGTCTGG - Intergenic
998203021 5:140140402-140140424 TCCCAGGATATCACTGTGTCTGG - Intergenic
998233275 5:140375464-140375486 TCTCGCTCTGTTCCTGTGTCTGG - Intergenic
998448954 5:142219737-142219759 TCTCGCTCTGTCACTGAGGCTGG - Intergenic
1001707201 5:173750166-173750188 TCTCGCTCTGTCACTCAGTCTGG + Intergenic
1002470778 5:179434609-179434631 TCTCGCTCTGTCACTGAGGCGGG + Intergenic
1002536033 5:179876041-179876063 TCCCCGGCTGTCTCTGTGCCCGG - Intronic
1005362484 6:25043862-25043884 TCCCCTTCTGTCACTATGTCTGG + Intergenic
1006138572 6:31912808-31912830 TCCCGCTCTGTCACTCAGGCTGG - Intronic
1007272577 6:40649690-40649712 CCCAGCTCTGTCACTGCGTCAGG - Intergenic
1010237669 6:73588876-73588898 TCTCGCTCTGTCACTCAGTCTGG + Intergenic
1010989206 6:82460618-82460640 TCTCGCTCTGTCACTGAGACTGG + Intergenic
1013195497 6:107841422-107841444 CCCCGTGCTGGCACAGTGTCTGG - Intergenic
1013212251 6:107997615-107997637 TCTCGCTCTGTCACTGAGGCTGG + Intergenic
1014808487 6:125858594-125858616 TCTCGCTCTGTCACTCAGTCTGG - Intronic
1015336895 6:132049351-132049373 TCTCGCTCTGTCACTGAGGCTGG + Intergenic
1015556296 6:134464764-134464786 TCCCGCTGTGTCACAGTGTGAGG - Intergenic
1016935918 6:149449412-149449434 TCTCACTCTGTCACTCTGTCTGG - Intronic
1018241475 6:161779472-161779494 TCTCGCTCTGTCACTCAGTCTGG + Intronic
1018640579 6:165900440-165900462 TCTCGCTCTGTCACTGAGGCTGG - Intronic
1020084869 7:5304844-5304866 TCTCGCTCTGTCACTGAGGCTGG + Exonic
1020687203 7:11310562-11310584 TCTCGCTCTGTCACTGAGGCTGG + Intergenic
1022679483 7:32530924-32530946 TCCTGCTCTGTCACTGAGGCTGG - Intronic
1023352158 7:39331535-39331557 TCTCGCTCTGTCACTCTGGCTGG + Intronic
1023546104 7:41319035-41319057 TCTCGCTCTGTCACTGAGGCTGG - Intergenic
1024755502 7:52525307-52525329 TCTCGCTCTGTCACTGAGGCTGG - Intergenic
1025860165 7:65319419-65319441 TCTCGCTCTGTCACTCTGGCTGG + Intergenic
1026132825 7:67634586-67634608 TCTCGCTCTGTCACTGAGGCTGG + Intergenic
1026853823 7:73740209-73740231 TCTCGCTCTGTCACTGAGGCTGG - Intergenic
1028322986 7:89485549-89485571 TCTCGCTCTGTCACTCTGGCTGG - Intergenic
1029608676 7:101615059-101615081 TCCCTTGCTGTCACTGGGTGGGG + Intronic
1030910514 7:115243471-115243493 TCCTGCTCTGTCACTCAGTCTGG + Intergenic
1032132993 7:129246525-129246547 TCTCGCTCTGTCACTCTGGCTGG + Intronic
1034602317 7:152271642-152271664 TCTCGCACTGTCACTCTGGCTGG - Intronic
1034656354 7:152732700-152732722 TCTCGCTCTGTCACTCAGTCTGG + Intergenic
1035101436 7:156400755-156400777 TCTCGCTCTGTCACTCTGGCTGG + Intergenic
1035575507 8:702045-702067 TCCCGCTCTGTCACCGAGGCTGG - Intronic
1036130331 8:6103864-6103886 TACTGGGCTGTGACTGTGTCAGG + Intergenic
1036182013 8:6593920-6593942 ACCCCCGCTGGCACTCTGTCAGG + Intronic
1036813073 8:11880865-11880887 TCTCGCTCTGTCACTGAGGCTGG - Intergenic
1037745342 8:21639331-21639353 TCTCGCTCTGTCACTCAGTCTGG - Intergenic
1038489559 8:27960204-27960226 TCTCGCTCTGTCACTGAGGCTGG + Intronic
1041148044 8:54899456-54899478 AGCCTCGCTGTCCCTGTGTCTGG - Intergenic
1042884478 8:73532596-73532618 TCTCGCTCTGTCACTGAGGCTGG - Intronic
1043299960 8:78716008-78716030 TCTCGCTCTGTCACTGAGGCTGG - Intronic
1044501678 8:92965668-92965690 TCCCGCCCTGCCAGCGTGTCTGG - Intronic
1045327367 8:101126949-101126971 TCCTGCGCTGGCTCTGTCTCGGG + Intergenic
1046031028 8:108784461-108784483 TCCCGGGCTGCCACAGTGTTGGG + Exonic
1046929849 8:119831075-119831097 TCTCGCTCTGTCACTGAGGCTGG - Intronic
1047381289 8:124366190-124366212 TCTCGTGCTGTCACTCAGTCTGG - Intronic
1049812296 8:144580906-144580928 TCCTGCGCTTTCTCAGTGTCGGG + Exonic
1049887770 9:39656-39678 TCTCGCTCTGTCACTGAGGCTGG - Intergenic
1049928343 9:431536-431558 TCTCGCTCTGTCACCGTGGCTGG + Intronic
1050371408 9:4924867-4924889 TCCCGAGCAGCCACTGTGCCCGG - Intergenic
1051447947 9:17162142-17162164 TCTCGCTCTGTCACTGAGGCTGG + Intronic
1053074241 9:35119242-35119264 TCTCGCTCTGTCACTGAGGCTGG + Intergenic
1053494585 9:38541134-38541156 TCTCTCCCTGTCACTGTGTTTGG - Exonic
1053917608 9:42954909-42954931 TCTCTCCCTGTCACTGTGTTTGG + Intergenic
1056656686 9:88515384-88515406 TCTCGCCCTGTCACTGAGGCTGG + Intergenic
1058772932 9:108256249-108256271 TCCCACTCTGTCACTGAGGCTGG + Intergenic
1060298155 9:122356920-122356942 TCCCTCTCTGTCTCTGTTTCTGG - Intergenic
1060342836 9:122792009-122792031 TCTCGCTCTGTCACTCTGGCTGG - Intergenic
1060514205 9:124255807-124255829 TCTCGCTCTGTCACTGAGGCTGG + Intergenic
1061041494 9:128143582-128143604 TCTCGCTCTGTCACTGAGGCTGG + Intergenic
1185636290 X:1554394-1554416 TCTCGCTCTGTCACTGAGGCTGG - Intergenic
1185836525 X:3349515-3349537 TCTTGCTCTGTCACTGTGGCTGG - Intergenic
1187000772 X:15175020-15175042 TCCAGCCCTGTCATTGTGTCAGG + Intergenic
1192729367 X:73786903-73786925 TCTCGCTCTGTCACTGAGGCTGG - Intergenic
1195044541 X:101044210-101044232 TCTCGCTCTGTCACTCAGTCTGG - Intronic
1195171970 X:102278300-102278322 TCTCCAGCTGTTACTGTGTCAGG + Intergenic
1195186890 X:102408793-102408815 TCTCCAGCTGTTACTGTGTCAGG - Intronic
1195392952 X:104382206-104382228 TCCCGCTCTGTCACTCAGGCTGG + Intergenic
1195560513 X:106277332-106277354 TCTCGCTCTGTCACTGAGGCTGG + Intergenic
1195561449 X:106289007-106289029 TCTCGCTCTGTCACTGAGGCTGG - Intergenic
1195659152 X:107361376-107361398 GCCAGAGCTGTCACTCTGTCAGG - Intergenic
1196787375 X:119432756-119432778 TCTCGCTCTGTCACTGAGGCTGG - Intronic
1196842863 X:119874584-119874606 TCTCACGCTGTCACTCAGTCTGG + Intronic
1197945507 X:131834735-131834757 TCCCGCTCTGTCACCCTGGCTGG - Intergenic