ID: 1168877417

View in Genome Browser
Species Human (GRCh38)
Location 20:1181146-1181168
Sequence TCCCGCGCTGTCACTGTGTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 238}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168877415_1168877417 -9 Left 1168877415 20:1181132-1181154 CCAGTCGTTCCATCTCCCGCGCT 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1168877417 20:1181146-1181168 TCCCGCGCTGTCACTGTGTCCGG 0: 1
1: 0
2: 0
3: 8
4: 238
1168877413_1168877417 24 Left 1168877413 20:1181099-1181121 CCAGGTGGGAGCCTAGGCGGGCG 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1168877417 20:1181146-1181168 TCCCGCGCTGTCACTGTGTCCGG 0: 1
1: 0
2: 0
3: 8
4: 238
1168877414_1168877417 13 Left 1168877414 20:1181110-1181132 CCTAGGCGGGCGTAGTACATCTC 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1168877417 20:1181146-1181168 TCCCGCGCTGTCACTGTGTCCGG 0: 1
1: 0
2: 0
3: 8
4: 238
1168877410_1168877417 29 Left 1168877410 20:1181094-1181116 CCTGTCCAGGTGGGAGCCTAGGC 0: 1
1: 0
2: 5
3: 12
4: 151
Right 1168877417 20:1181146-1181168 TCCCGCGCTGTCACTGTGTCCGG 0: 1
1: 0
2: 0
3: 8
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168877417 Original CRISPR TCCCGCGCTGTCACTGTGTC CGG Exonic