ID: 1168877990

View in Genome Browser
Species Human (GRCh38)
Location 20:1184677-1184699
Sequence GGTCTTGGTGGATCTGGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168877990_1168878009 28 Left 1168877990 20:1184677-1184699 CCCAAGCCAGATCCACCAAGACC No data
Right 1168878009 20:1184728-1184750 GCGCACTGACACCCGGAGAGAGG No data
1168877990_1168878010 29 Left 1168877990 20:1184677-1184699 CCCAAGCCAGATCCACCAAGACC No data
Right 1168878010 20:1184729-1184751 CGCACTGACACCCGGAGAGAGGG No data
1168877990_1168878007 21 Left 1168877990 20:1184677-1184699 CCCAAGCCAGATCCACCAAGACC No data
Right 1168878007 20:1184721-1184743 CCGCCGCGCGCACTGACACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168877990 Original CRISPR GGTCTTGGTGGATCTGGCTT GGG (reversed) Intronic