ID: 1168878007

View in Genome Browser
Species Human (GRCh38)
Location 20:1184721-1184743
Sequence CCGCCGCGCGCACTGACACC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168877999_1168878007 -1 Left 1168877999 20:1184699-1184721 CCGCAGGGGCCCAATACCCCACC No data
Right 1168878007 20:1184721-1184743 CCGCCGCGCGCACTGACACCCGG No data
1168877997_1168878007 6 Left 1168877997 20:1184692-1184714 CCAAGACCCGCAGGGGCCCAATA No data
Right 1168878007 20:1184721-1184743 CCGCCGCGCGCACTGACACCCGG No data
1168877998_1168878007 0 Left 1168877998 20:1184698-1184720 CCCGCAGGGGCCCAATACCCCAC No data
Right 1168878007 20:1184721-1184743 CCGCCGCGCGCACTGACACCCGG No data
1168877990_1168878007 21 Left 1168877990 20:1184677-1184699 CCCAAGCCAGATCCACCAAGACC No data
Right 1168878007 20:1184721-1184743 CCGCCGCGCGCACTGACACCCGG No data
1168877991_1168878007 20 Left 1168877991 20:1184678-1184700 CCAAGCCAGATCCACCAAGACCC No data
Right 1168878007 20:1184721-1184743 CCGCCGCGCGCACTGACACCCGG No data
1168877992_1168878007 15 Left 1168877992 20:1184683-1184705 CCAGATCCACCAAGACCCGCAGG No data
Right 1168878007 20:1184721-1184743 CCGCCGCGCGCACTGACACCCGG No data
1168878000_1168878007 -10 Left 1168878000 20:1184708-1184730 CCCAATACCCCACCCGCCGCGCG No data
Right 1168878007 20:1184721-1184743 CCGCCGCGCGCACTGACACCCGG No data
1168877996_1168878007 9 Left 1168877996 20:1184689-1184711 CCACCAAGACCCGCAGGGGCCCA No data
Right 1168878007 20:1184721-1184743 CCGCCGCGCGCACTGACACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168878007 Original CRISPR CCGCCGCGCGCACTGACACC CGG Intronic