ID: 1168878010

View in Genome Browser
Species Human (GRCh38)
Location 20:1184729-1184751
Sequence CGCACTGACACCCGGAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168877992_1168878010 23 Left 1168877992 20:1184683-1184705 CCAGATCCACCAAGACCCGCAGG No data
Right 1168878010 20:1184729-1184751 CGCACTGACACCCGGAGAGAGGG No data
1168878001_1168878010 -3 Left 1168878001 20:1184709-1184731 CCAATACCCCACCCGCCGCGCGC No data
Right 1168878010 20:1184729-1184751 CGCACTGACACCCGGAGAGAGGG No data
1168878003_1168878010 -10 Left 1168878003 20:1184716-1184738 CCCACCCGCCGCGCGCACTGACA No data
Right 1168878010 20:1184729-1184751 CGCACTGACACCCGGAGAGAGGG No data
1168877996_1168878010 17 Left 1168877996 20:1184689-1184711 CCACCAAGACCCGCAGGGGCCCA No data
Right 1168878010 20:1184729-1184751 CGCACTGACACCCGGAGAGAGGG No data
1168878000_1168878010 -2 Left 1168878000 20:1184708-1184730 CCCAATACCCCACCCGCCGCGCG No data
Right 1168878010 20:1184729-1184751 CGCACTGACACCCGGAGAGAGGG No data
1168877998_1168878010 8 Left 1168877998 20:1184698-1184720 CCCGCAGGGGCCCAATACCCCAC No data
Right 1168878010 20:1184729-1184751 CGCACTGACACCCGGAGAGAGGG No data
1168877991_1168878010 28 Left 1168877991 20:1184678-1184700 CCAAGCCAGATCCACCAAGACCC No data
Right 1168878010 20:1184729-1184751 CGCACTGACACCCGGAGAGAGGG No data
1168877990_1168878010 29 Left 1168877990 20:1184677-1184699 CCCAAGCCAGATCCACCAAGACC No data
Right 1168878010 20:1184729-1184751 CGCACTGACACCCGGAGAGAGGG No data
1168877999_1168878010 7 Left 1168877999 20:1184699-1184721 CCGCAGGGGCCCAATACCCCACC No data
Right 1168878010 20:1184729-1184751 CGCACTGACACCCGGAGAGAGGG No data
1168878002_1168878010 -9 Left 1168878002 20:1184715-1184737 CCCCACCCGCCGCGCGCACTGAC No data
Right 1168878010 20:1184729-1184751 CGCACTGACACCCGGAGAGAGGG No data
1168877997_1168878010 14 Left 1168877997 20:1184692-1184714 CCAAGACCCGCAGGGGCCCAATA No data
Right 1168878010 20:1184729-1184751 CGCACTGACACCCGGAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168878010 Original CRISPR CGCACTGACACCCGGAGAGA GGG Intronic