ID: 1168878059

View in Genome Browser
Species Human (GRCh38)
Location 20:1184973-1184995
Sequence CCGGAAGGCCGAACCGGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 38}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168878054_1168878059 -8 Left 1168878054 20:1184958-1184980 CCACAGACGCGGGACCCGGAAGG 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1168878059 20:1184973-1184995 CCGGAAGGCCGAACCGGACCAGG 0: 1
1: 0
2: 0
3: 2
4: 38
1168878042_1168878059 17 Left 1168878042 20:1184933-1184955 CCACACCCCCTGCTCCTGCCCTT 0: 1
1: 1
2: 11
3: 192
4: 1726
Right 1168878059 20:1184973-1184995 CCGGAAGGCCGAACCGGACCAGG 0: 1
1: 0
2: 0
3: 2
4: 38
1168878044_1168878059 11 Left 1168878044 20:1184939-1184961 CCCCTGCTCCTGCCCTTGCCCAC 0: 1
1: 0
2: 14
3: 180
4: 1531
Right 1168878059 20:1184973-1184995 CCGGAAGGCCGAACCGGACCAGG 0: 1
1: 0
2: 0
3: 2
4: 38
1168878041_1168878059 22 Left 1168878041 20:1184928-1184950 CCAGTCCACACCCCCTGCTCCTG 0: 1
1: 0
2: 3
3: 81
4: 644
Right 1168878059 20:1184973-1184995 CCGGAAGGCCGAACCGGACCAGG 0: 1
1: 0
2: 0
3: 2
4: 38
1168878045_1168878059 10 Left 1168878045 20:1184940-1184962 CCCTGCTCCTGCCCTTGCCCACA 0: 1
1: 0
2: 8
3: 89
4: 889
Right 1168878059 20:1184973-1184995 CCGGAAGGCCGAACCGGACCAGG 0: 1
1: 0
2: 0
3: 2
4: 38
1168878053_1168878059 -7 Left 1168878053 20:1184957-1184979 CCCACAGACGCGGGACCCGGAAG 0: 1
1: 0
2: 0
3: 4
4: 35
Right 1168878059 20:1184973-1184995 CCGGAAGGCCGAACCGGACCAGG 0: 1
1: 0
2: 0
3: 2
4: 38
1168878046_1168878059 9 Left 1168878046 20:1184941-1184963 CCTGCTCCTGCCCTTGCCCACAG 0: 1
1: 0
2: 3
3: 92
4: 808
Right 1168878059 20:1184973-1184995 CCGGAAGGCCGAACCGGACCAGG 0: 1
1: 0
2: 0
3: 2
4: 38
1168878050_1168878059 -1 Left 1168878050 20:1184951-1184973 CCCTTGCCCACAGACGCGGGACC 0: 1
1: 0
2: 0
3: 5
4: 60
Right 1168878059 20:1184973-1184995 CCGGAAGGCCGAACCGGACCAGG 0: 1
1: 0
2: 0
3: 2
4: 38
1168878051_1168878059 -2 Left 1168878051 20:1184952-1184974 CCTTGCCCACAGACGCGGGACCC No data
Right 1168878059 20:1184973-1184995 CCGGAAGGCCGAACCGGACCAGG 0: 1
1: 0
2: 0
3: 2
4: 38
1168878040_1168878059 23 Left 1168878040 20:1184927-1184949 CCCAGTCCACACCCCCTGCTCCT 0: 1
1: 0
2: 4
3: 61
4: 535
Right 1168878059 20:1184973-1184995 CCGGAAGGCCGAACCGGACCAGG 0: 1
1: 0
2: 0
3: 2
4: 38
1168878038_1168878059 30 Left 1168878038 20:1184920-1184942 CCGCCGGCCCAGTCCACACCCCC 0: 1
1: 0
2: 1
3: 56
4: 597
Right 1168878059 20:1184973-1184995 CCGGAAGGCCGAACCGGACCAGG 0: 1
1: 0
2: 0
3: 2
4: 38
1168878047_1168878059 3 Left 1168878047 20:1184947-1184969 CCTGCCCTTGCCCACAGACGCGG 0: 1
1: 0
2: 1
3: 8
4: 116
Right 1168878059 20:1184973-1184995 CCGGAAGGCCGAACCGGACCAGG 0: 1
1: 0
2: 0
3: 2
4: 38
1168878043_1168878059 12 Left 1168878043 20:1184938-1184960 CCCCCTGCTCCTGCCCTTGCCCA 0: 1
1: 1
2: 12
3: 175
4: 1451
Right 1168878059 20:1184973-1184995 CCGGAAGGCCGAACCGGACCAGG 0: 1
1: 0
2: 0
3: 2
4: 38
1168878039_1168878059 27 Left 1168878039 20:1184923-1184945 CCGGCCCAGTCCACACCCCCTGC 0: 1
1: 1
2: 0
3: 83
4: 764
Right 1168878059 20:1184973-1184995 CCGGAAGGCCGAACCGGACCAGG 0: 1
1: 0
2: 0
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168878059 Original CRISPR CCGGAAGGCCGAACCGGACC AGG Intronic
903389366 1:22953423-22953445 CCGGGAGGCCGAGCCCGGCCCGG - Exonic
904094594 1:27967050-27967072 CTGGAAGCCCGACCCTGACCAGG + Exonic
921475443 1:215601525-215601547 CTGGAAGGCCGAGTCTGACCAGG - Intronic
1075090100 10:119439365-119439387 CCTGAAGGCAGAACAGGGCCTGG - Intronic
1076905082 10:133357519-133357541 CCAGGGGGCCGACCCGGACCCGG + Intronic
1077867405 11:6234553-6234575 ACGGAACGCCGAACCTGGCCGGG + Exonic
1090338563 11:125993743-125993765 CCTGAAGGCCCCACCTGACCTGG - Intronic
1090374118 11:126277067-126277089 CCAGCAGGAAGAACCGGACCCGG + Exonic
1098105999 12:67069400-67069422 CCGGGAGGCCGGGCCGGGCCGGG + Intergenic
1133232879 16:4374650-4374672 CAGGGAGGCAGAACAGGACCTGG - Intronic
1139470419 16:67175176-67175198 CCGGAGGGTCGGACGGGACCTGG + Exonic
1150069298 17:62138382-62138404 CCGCAAGGCCGAGCTGCACCGGG - Intergenic
1152721961 17:81927670-81927692 TGGGAAGGCCGGGCCGGACCAGG + Exonic
1157805977 18:50657877-50657899 CCTGATGGCCGAACCAGACCTGG + Intronic
1162109095 19:8390586-8390608 CGGGAAGGCCGGAGCCGACCGGG + Intronic
1163297444 19:16421398-16421420 CCTGAAGACCGACCTGGACCTGG - Exonic
1164157346 19:22604667-22604689 CCGGAAGGCTGGAACAGACCTGG + Intergenic
1165866867 19:38945049-38945071 CCAGAAGGCGGACCCGGAGCTGG + Exonic
926416785 2:12657228-12657250 CCAGAAGGCCCAACAGGAACTGG + Intergenic
927714175 2:25341779-25341801 CCGGAAGGCCGGCCCGGAGGCGG - Intronic
948492212 2:238320810-238320832 CCGGAATCCCGACCCGCACCTGG - Intronic
1168878059 20:1184973-1184995 CCGGAAGGCCGAACCGGACCAGG + Intronic
1172357905 20:34292478-34292500 CTGGAAGGGCGAAACGGACGAGG - Exonic
1173196021 20:40913455-40913477 GCGGAAGGAAGAACTGGACCGGG - Intergenic
1178544204 21:33479728-33479750 CCAGAAGGCCGGGCCGGACAGGG + Intronic
1185377190 22:50488026-50488048 CCGGAAGGCCCACCCAGACAAGG + Exonic
950979645 3:17288898-17288920 CAGCAAGGCCGAACCAGCCCCGG + Intronic
963760582 3:149284119-149284141 CCGGCAGGCCCCACCGGTCCCGG + Intergenic
968510912 4:995534-995556 CTGGAAGGCCAACCCGGCCCTGG + Intronic
972533118 4:39977792-39977814 CCGGACCGCCGACTCGGACCCGG + Exonic
984087701 4:175332750-175332772 CTGGAAGCCAGAACTGGACCAGG - Intergenic
1023417802 7:39949507-39949529 CCGGCAGGCCGCACCGGAAGTGG - Intergenic
1026647291 7:72182912-72182934 GAGGAAGGTCGAACGGGACCAGG + Intronic
1026966831 7:74445499-74445521 CAGGAAGGCCGAGGAGGACCTGG + Intergenic
1034263681 7:149771893-149771915 GCGGAGGGCCGACCCGGACGGGG - Intronic
1035623632 8:1054027-1054049 GCGGAAGGCTGAATCTGACCGGG - Intergenic
1036665422 8:10734160-10734182 CCGGAGCTCTGAACCGGACCAGG + Intronic
1041693681 8:60714357-60714379 CCGGAAGGCCGAGCCCCACCTGG + Intronic
1052313423 9:27092753-27092775 CCGGCAGGCCCCACCGGCCCGGG + Intergenic
1062012663 9:134275397-134275419 CCTGAAGGCAGACCCTGACCAGG - Intergenic
1062617272 9:137403510-137403532 CTGGAGGGCTGAAACGGACCTGG - Intronic