ID: 1168879504

View in Genome Browser
Species Human (GRCh38)
Location 20:1194533-1194555
Sequence TGGAGTTTAATCACCATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168879495_1168879504 17 Left 1168879495 20:1194493-1194515 CCTGCACCTGGTCCCTCTGCATT No data
Right 1168879504 20:1194533-1194555 TGGAGTTTAATCACCATGGGAGG No data
1168879498_1168879504 5 Left 1168879498 20:1194505-1194527 CCCTCTGCATTCTGACAGGTCAG No data
Right 1168879504 20:1194533-1194555 TGGAGTTTAATCACCATGGGAGG No data
1168879494_1168879504 18 Left 1168879494 20:1194492-1194514 CCCTGCACCTGGTCCCTCTGCAT No data
Right 1168879504 20:1194533-1194555 TGGAGTTTAATCACCATGGGAGG No data
1168879499_1168879504 4 Left 1168879499 20:1194506-1194528 CCTCTGCATTCTGACAGGTCAGT No data
Right 1168879504 20:1194533-1194555 TGGAGTTTAATCACCATGGGAGG No data
1168879496_1168879504 11 Left 1168879496 20:1194499-1194521 CCTGGTCCCTCTGCATTCTGACA No data
Right 1168879504 20:1194533-1194555 TGGAGTTTAATCACCATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168879504 Original CRISPR TGGAGTTTAATCACCATGGG AGG Intergenic
No off target data available for this crispr