ID: 1168879685

View in Genome Browser
Species Human (GRCh38)
Location 20:1195906-1195928
Sequence ATGGAGAAGGTGAGTGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168879677_1168879685 24 Left 1168879677 20:1195859-1195881 CCTTAAGCAGAGTGAGACCTGCT No data
Right 1168879685 20:1195906-1195928 ATGGAGAAGGTGAGTGTTGAGGG No data
1168879679_1168879685 7 Left 1168879679 20:1195876-1195898 CCTGCTTACAGTAGGAAGCCGTA No data
Right 1168879685 20:1195906-1195928 ATGGAGAAGGTGAGTGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168879685 Original CRISPR ATGGAGAAGGTGAGTGTTGA GGG Intergenic
No off target data available for this crispr