ID: 1168879907

View in Genome Browser
Species Human (GRCh38)
Location 20:1197631-1197653
Sequence CTTGTGGCCCGCAAGTAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168879907_1168879911 -1 Left 1168879907 20:1197631-1197653 CCCTCTTACTTGCGGGCCACAAG No data
Right 1168879911 20:1197653-1197675 GCCCTGAGAGGTCAAGCGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168879907 Original CRISPR CTTGTGGCCCGCAAGTAAGA GGG (reversed) Intergenic
No off target data available for this crispr