ID: 1168880378

View in Genome Browser
Species Human (GRCh38)
Location 20:1201435-1201457
Sequence CTGAAGTTCTTGGGGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168880368_1168880378 14 Left 1168880368 20:1201398-1201420 CCATACCTGGCCTCAAAATACTT No data
Right 1168880378 20:1201435-1201457 CTGAAGTTCTTGGGGGAAGGGGG No data
1168880370_1168880378 4 Left 1168880370 20:1201408-1201430 CCTCAAAATACTTTTAATTATCT No data
Right 1168880378 20:1201435-1201457 CTGAAGTTCTTGGGGGAAGGGGG No data
1168880369_1168880378 9 Left 1168880369 20:1201403-1201425 CCTGGCCTCAAAATACTTTTAAT No data
Right 1168880378 20:1201435-1201457 CTGAAGTTCTTGGGGGAAGGGGG No data
1168880367_1168880378 17 Left 1168880367 20:1201395-1201417 CCACCATACCTGGCCTCAAAATA No data
Right 1168880378 20:1201435-1201457 CTGAAGTTCTTGGGGGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168880378 Original CRISPR CTGAAGTTCTTGGGGGAAGG GGG Intergenic
No off target data available for this crispr