ID: 1168881823

View in Genome Browser
Species Human (GRCh38)
Location 20:1212719-1212741
Sequence CCTTATATGGAAAGAAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168881823_1168881832 30 Left 1168881823 20:1212719-1212741 CCTGCCTTTCTTTCCATATAAGG No data
Right 1168881832 20:1212772-1212794 AATTTCCCTCTCATTCCTTCTGG No data
1168881823_1168881829 1 Left 1168881823 20:1212719-1212741 CCTGCCTTTCTTTCCATATAAGG No data
Right 1168881829 20:1212743-1212765 AACATATAAGGATTAGGATGCGG No data
1168881823_1168881830 6 Left 1168881823 20:1212719-1212741 CCTGCCTTTCTTTCCATATAAGG No data
Right 1168881830 20:1212748-1212770 ATAAGGATTAGGATGCGGAGAGG No data
1168881823_1168881828 -5 Left 1168881823 20:1212719-1212741 CCTGCCTTTCTTTCCATATAAGG No data
Right 1168881828 20:1212737-1212759 TAAGGTAACATATAAGGATTAGG No data
1168881823_1168881831 7 Left 1168881823 20:1212719-1212741 CCTGCCTTTCTTTCCATATAAGG No data
Right 1168881831 20:1212749-1212771 TAAGGATTAGGATGCGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168881823 Original CRISPR CCTTATATGGAAAGAAAGGC AGG (reversed) Intergenic
No off target data available for this crispr