ID: 1168884187

View in Genome Browser
Species Human (GRCh38)
Location 20:1234079-1234101
Sequence CTGAAACATCAATAGCACTA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168884187 Original CRISPR CTGAAACATCAATAGCACTA TGG (reversed) Exonic
900804614 1:4759257-4759279 TTGAAACATCACTAAAACTAAGG + Intronic
902850470 1:19151814-19151836 TAGTAACAACAATAGCACTATGG - Exonic
905913433 1:41669334-41669356 GTGAAAGATCAATAGCAGTCTGG + Intronic
907604289 1:55801461-55801483 CTTAAACATCAATATTACAAAGG - Intergenic
908074405 1:60498491-60498513 CTGTAACATCAAAAACACAAAGG + Intergenic
908191895 1:61712227-61712249 CCAAAAAATCAATAGCACTGAGG + Intronic
908597085 1:65699701-65699723 CTAAAACATGAAAAGCACAAAGG - Intergenic
908658485 1:66413326-66413348 CTGAAACACCAGAAGTACTAGGG - Intergenic
909273327 1:73652477-73652499 CTGAATCACCAATAGCATTTTGG + Intergenic
911780521 1:101870241-101870263 CTGAGACATCAGTAGCTCAAGGG + Intronic
912837919 1:113013045-113013067 GTCAAACATCAAAAGCACTTGGG + Intergenic
914325862 1:146615711-146615733 CTGAAAGATCAAAACCCCTAAGG + Intergenic
914738278 1:150439307-150439329 CTGAAATCTCAATATCTCTAAGG - Intronic
914798774 1:150944072-150944094 CTGAAATACCAAAAACACTAGGG - Intronic
916913818 1:169384267-169384289 CTGTAAAATCAACAGGACTAGGG - Intronic
917407593 1:174723901-174723923 CTCAAACATCAATTTCACCATGG - Intronic
918436619 1:184520573-184520595 CTGAAACATTATGAGCAGTAAGG - Intronic
918498722 1:185169911-185169933 CTGAGGCATCAATAGCTCTTTGG - Intronic
918853411 1:189720338-189720360 CTCAAACATCAATAATACAAAGG + Intergenic
921012577 1:211157458-211157480 CTGAAAAAACAAAAGAACTAGGG + Intergenic
922260362 1:223937660-223937682 CTCAAACTTCATCAGCACTAAGG - Intergenic
924341537 1:243039849-243039871 CTCAAACCTCATCAGCACTAAGG - Intergenic
1064930222 10:20617297-20617319 GTGAAACATCCAGAGCACTCAGG + Intergenic
1074259103 10:111834010-111834032 CAGTAACATCAGTAGCACTTGGG - Intergenic
1074885265 10:117688495-117688517 ATGAAATGTCAATAGCACCATGG - Intergenic
1075153758 10:119957144-119957166 ATGAAGCATGAATAGCACTCGGG - Intergenic
1075190036 10:120298836-120298858 CTAAAATATCAATAGTACCAAGG - Intergenic
1078372498 11:10761061-10761083 CCAAAACATCAATAGTACTGAGG - Intronic
1079436021 11:20451575-20451597 CCAAAATGTCAATAGCACTAAGG - Intronic
1079986193 11:27203074-27203096 CTGAAATATGGATAGCACCATGG + Intergenic
1087261403 11:96016494-96016516 CTAAAACATCAACAGAAGTAAGG - Intronic
1087537825 11:99473928-99473950 CTTAAAAACCAGTAGCACTATGG - Intronic
1088204770 11:107379433-107379455 CCAAAATATCAATAGCGCTAAGG + Intronic
1091827229 12:3521928-3521950 CTTTAACCTCAAGAGCACTAAGG + Intronic
1093811500 12:23498039-23498061 CTAAAACATCAATAGAATCAAGG + Intergenic
1094078338 12:26503563-26503585 CTGAGACATCATTTCCACTAAGG - Intronic
1095843500 12:46720563-46720585 CTGATACATCAATACCTCCAAGG + Intergenic
1098471283 12:70847176-70847198 CTGTAACATCAATATAACAATGG + Intronic
1101191181 12:102334538-102334560 CTGTAACAACAATAGCACTAAGG - Intergenic
1103143970 12:118577766-118577788 CCAAAATATCAATAGCACTGAGG + Intergenic
1103847357 12:123910824-123910846 CTGAAACACCACTATCACTTAGG + Intronic
1105359873 13:19700377-19700399 CTGAAATATCAATAATATTAGGG - Intronic
1105388628 13:19956656-19956678 ATAAAACAGCAATAACACTAGGG + Intergenic
1106964168 13:35038982-35039004 CTTAAACACCAAGAGCACTCTGG + Intronic
1110123510 13:71912610-71912632 CTGAAACAGAAACAGCACTGAGG - Intergenic
1114780191 14:25530524-25530546 CTGAAAACTCCATAGAACTAGGG - Intergenic
1115386678 14:32805987-32806009 GTGATACATTAATAGTACTAAGG - Intronic
1118345627 14:64938811-64938833 AGGAAGCATCAATAGCACTGTGG - Intronic
1120802069 14:88701322-88701344 CCGAAACATCAATAGTGCTAAGG + Intronic
1123120631 14:105914782-105914804 CTGGAACCTCAGTAGCACTGAGG - Intergenic
1123403342 15:20006329-20006351 CTGGAACCTCAGTAGCACTGAGG - Intergenic
1123512680 15:21012983-21013005 CTGGAACCTCAGTAGCACTGAGG - Intergenic
1131652601 15:94417556-94417578 CTGAAACATCACCAGCGCTCAGG - Intronic
1133751478 16:8729473-8729495 CTCAAACATCTATAGGAGTAGGG - Intronic
1138717684 16:59043052-59043074 CTGAAGCATCAACATCACTTGGG + Intergenic
1139092141 16:63661543-63661565 CTGAAAGATCAAAATCCCTAGGG - Intergenic
1140007703 16:71095231-71095253 CTGAAAGATCAAAACCCCTAAGG - Intronic
1151485870 17:74399471-74399493 CCAAAATATCAATAGCACTGAGG + Intergenic
1153747637 18:8196357-8196379 CTCTAACAGTAATAGCACTAAGG - Intronic
1156437629 18:37150241-37150263 TTGAAACATCAATAGTACCAAGG - Intronic
1156758659 18:40559637-40559659 CTGTAAAATCAATATCTCTAGGG + Intergenic
1157081135 18:44526520-44526542 CTGAGGCATCAATAGCTCTATGG - Intergenic
1158124413 18:54085606-54085628 CTTAAAAATCAATTGCATTAGGG + Intergenic
1158260719 18:55603113-55603135 CTGAAATATCAATAGTGCCAAGG - Intronic
925568532 2:5283786-5283808 CTCAAATGTCAATAGCACCAAGG - Intergenic
932302925 2:70679891-70679913 CAGAAACATCAATAGAAAAATGG - Intronic
932947558 2:76254342-76254364 CTTAAACATCAAGAGGACAAAGG - Intergenic
933568997 2:83986240-83986262 ATGCAACAACAATAGCACAAAGG - Intergenic
939949328 2:148450087-148450109 CAGAAATTTTAATAGCACTAGGG - Intronic
941585737 2:167355963-167355985 ATGAATCATCTTTAGCACTAGGG - Intergenic
942600552 2:177636684-177636706 CCAAAACATCAATAGTACTGAGG - Intronic
942913333 2:181272415-181272437 CTGAAACATTTCTATCACTAGGG + Intergenic
944462626 2:199967166-199967188 CTTAAACAGCAATTGCACAATGG - Intronic
944929786 2:204505424-204505446 CTGTGACATGAATAGCCCTATGG + Intergenic
947522023 2:230853633-230853655 CTAAAATATCAATAGCTCCAAGG - Intergenic
949083857 2:242130382-242130404 CTCAAACCTCATCAGCACTAAGG + Intergenic
1168884187 20:1234079-1234101 CTGAAACATCAATAGCACTATGG - Exonic
1169303730 20:4469972-4469994 CTGAAATGTCCAAAGCACTATGG - Intergenic
1170473004 20:16686974-16686996 CTATAACATCAATATCACTCTGG + Intergenic
1171128798 20:22628911-22628933 CTCATACATCATTAGTACTATGG - Intergenic
1171236196 20:23526938-23526960 CCAAAATATCAATAGCACTGAGG + Intergenic
1172651801 20:36508395-36508417 CTGAAACATCAGTAGGAAAATGG - Intronic
1174781141 20:53389873-53389895 CTGAAATGTCAATAGCGCTGAGG + Intronic
1176280439 20:64302903-64302925 CTCAAACCTCATCAGCACTAAGG + Intergenic
1177736590 21:25098211-25098233 GAGAAACATTAATAGCAATATGG + Intergenic
1177819090 21:26011586-26011608 CCAAAACATCAATAGTACTAAGG + Intronic
1177872428 21:26589792-26589814 CCCAAACATCAATAGCGCTGAGG + Intergenic
1180757269 22:18170730-18170752 CTGAAAAATCAAAATCACTCTGG - Intronic
1181074510 22:20366735-20366757 CTGAAAAATCAAAATCACTCTGG + Intronic
1184569882 22:45315815-45315837 CTGAAGCAGCATTAGGACTAAGG - Intronic
950022431 3:9797255-9797277 CTCAAATATCAATAGTGCTAAGG - Intronic
951281633 3:20757386-20757408 CAGAAGCATCAATATCACTTGGG - Intergenic
951616738 3:24555820-24555842 CTAAAACATCACTATGACTATGG - Intergenic
951629959 3:24708938-24708960 CAGAAACATCAATATCACTTTGG + Intergenic
952590698 3:34950263-34950285 CTGGAACATCATTATCACTAAGG + Intergenic
952785727 3:37153072-37153094 CTAAAATTTCAATAGCATTAAGG + Intronic
953961915 3:47273111-47273133 CTGAAAGATCAAAAGCAAGAAGG - Intronic
956488174 3:69743071-69743093 CCAAAATATCAATAGCACTGAGG - Intronic
957202648 3:77156933-77156955 CAGCAACATCAATATCACTCGGG + Intronic
957479748 3:80776323-80776345 CTGTAAAATTAATAGCACAATGG - Intergenic
959301867 3:104612823-104612845 CTGTAACAGCAATATCAATACGG + Intergenic
963401899 3:144808255-144808277 TTGAAACATCACTTGCACAAAGG - Intergenic
965069333 3:163897929-163897951 GTGAACCATCAATAGCACAATGG + Intergenic
965355876 3:167672324-167672346 CTGAAACGTAAATAGCATAAAGG - Intergenic
966584624 3:181608279-181608301 CTGAAACATCAAGGGAAATAGGG + Intergenic
968513700 4:1006525-1006547 ATGTAACAACAATAGCACAATGG - Intergenic
969377053 4:6769701-6769723 CAACAACATCAATAACACTAAGG - Intergenic
969919317 4:10522886-10522908 CTGAAGCATGAATAGGAGTAAGG + Intronic
970239992 4:13999158-13999180 CTGAAACATCAAGTGCAGAAGGG - Intergenic
970709529 4:18845562-18845584 CACAAACATCAATATTACTAAGG + Intergenic
972433805 4:39012354-39012376 CCAAAATATCAATAGCACTAAGG + Intronic
974238768 4:59215745-59215767 CAGAGCCATCAATAGCATTATGG - Intergenic
975942434 4:79662946-79662968 ATGAAACACCAATAGAACTCTGG + Intergenic
975958724 4:79874740-79874762 TAGAAACATCCAAAGCACTAAGG - Intergenic
977355911 4:95946166-95946188 CTGAAACCCCAATATCTCTAAGG - Intergenic
977953097 4:102996414-102996436 CTTAAACAACAAAAGCTCTAAGG - Intronic
979102615 4:116640013-116640035 CTGCAACATCAATATGAATATGG - Intergenic
981576534 4:146211816-146211838 CTGAAACTTCACCAGCACTTCGG + Intergenic
982741520 4:159061838-159061860 CTGAAACAGCAGGAGCACCATGG + Intergenic
984038716 4:174702445-174702467 CTGAACCAGCAATAGCTCTAAGG + Intronic
984201954 4:176733879-176733901 CTGAGAAATCAAGAGCATTAGGG - Intronic
984907639 4:184644163-184644185 CTACAACATCTATAGCATTAAGG + Intronic
986219769 5:5757415-5757437 CTGAAACCTCAACAGACCTAAGG - Intergenic
987141332 5:14949633-14949655 CTGATACACCAATAGGCCTATGG - Intergenic
987707338 5:21473189-21473211 CTAAAACATCAATAGTGCCAGGG + Intergenic
988268262 5:28979779-28979801 ATGATACATCAAATGCACTAAGG - Intergenic
989998877 5:50869182-50869204 GTGAAAGATAAACAGCACTATGG + Intergenic
991002497 5:61796416-61796438 CAGAAATAAGAATAGCACTATGG - Intergenic
992573554 5:78086196-78086218 CTGAAACATGAAAATTACTATGG - Intronic
993057922 5:83003682-83003704 CTAAAGCATCAATAGAACTATGG + Intergenic
994900842 5:105767293-105767315 CTCAAACATCAATAACAGTCTGG - Intergenic
995323319 5:110861560-110861582 CTGAAAAATCTAAAGCATTAAGG + Intergenic
997048001 5:130343143-130343165 CTGAAACCTCAATAACAAGAAGG + Intergenic
1000724712 5:164754953-164754975 CTAAAATTTCAATAGCACCAAGG - Intergenic
1001182411 5:169532882-169532904 CCGTAACTTCAATAGCACAAGGG + Intergenic
1004633009 6:17439398-17439420 CTGAGACATGAACAGCACAATGG - Intronic
1008328373 6:50215078-50215100 CTGAAACCACAATAGACCTAGGG - Intergenic
1011098862 6:83698744-83698766 CTGAAACATATATTGCCCTAAGG - Intronic
1012298617 6:97555986-97556008 CTGAAACAGCAATCATACTATGG + Intergenic
1014950732 6:127551934-127551956 CTGAAACATCAATAGTGCCAAGG - Intronic
1017345567 6:153376342-153376364 GTTAAAAATCAATAGCAATAAGG + Intergenic
1019236100 6:170614049-170614071 CTCAAACCTCATCAGCACTAAGG + Intergenic
1021882546 7:25108662-25108684 CCAAAACATCAATAGCACCAAGG - Intergenic
1023176669 7:37442202-37442224 CCGAAATGTCAATAGCACTGAGG + Intronic
1024792180 7:52979071-52979093 CAGAAATATCAATGGCACTTAGG + Intergenic
1027623664 7:80522576-80522598 CTGAAATGTCAATAGTACTGAGG + Intronic
1031293982 7:119979642-119979664 CTATAACAACAATAGCACAAGGG + Intergenic
1035340930 7:158161030-158161052 CTGAAATATCAAAATCCCTAAGG - Intronic
1035789787 8:2294165-2294187 CTTAAACATCAAAAGCAATCAGG + Intergenic
1035803018 8:2427540-2427562 CTTAAACATCAAAAGCAATCAGG - Intergenic
1039157289 8:34575325-34575347 CTTAAACATAAATAAAACTATGG - Intergenic
1039670281 8:39588609-39588631 TTGAACCAACAATGGCACTATGG - Intronic
1040603571 8:48908393-48908415 CTGAAATAACAAAACCACTATGG + Intergenic
1040709312 8:50169142-50169164 CTGAAACACAAATATCACTGAGG - Intronic
1041190054 8:55344189-55344211 CTGAAAAATCCATAGGCCTAGGG - Intronic
1041401253 8:57447759-57447781 CTGACACATGAATAGAACTCAGG - Intergenic
1042035318 8:64526631-64526653 CTAAAACATTAAAAGCACAAAGG - Intergenic
1043288543 8:78566983-78567005 CTTCAACATCAATATCAGTAAGG + Intronic
1043665109 8:82800456-82800478 CTGAAAGTTCAATACCACAAAGG - Intergenic
1045663818 8:104465884-104465906 CTGCAACATCAGTAAAACTATGG + Intronic
1047270808 8:123356325-123356347 CTCACACATCAATACCACTCAGG + Intronic
1051075725 9:13232839-13232861 CTGAAAAATCAATAGAAAAATGG + Intronic
1051477068 9:17519482-17519504 CTGAAACATAAATAAAACAAAGG + Intergenic
1051506794 9:17836012-17836034 CCCAAATATCAATAGTACTAAGG + Intergenic
1051702527 9:19839339-19839361 CTGAAACAGAAATAGCAACAAGG - Intergenic
1053402802 9:37842124-37842146 ATGACACTACAATAGCACTATGG + Exonic
1055918196 9:81429348-81429370 CTGAAACAGCAATTTCATTATGG - Intergenic
1059619521 9:115988078-115988100 CTGAAGCAGCAATAACTCTATGG + Intergenic
1060603752 9:124896018-124896040 CTCAAACGTCAATAGCGCTGAGG + Intronic
1186494954 X:10005697-10005719 CTAAAACGTCAATAGCACCAAGG - Intergenic
1186643491 X:11482220-11482242 CTCAAATATCAATAGTACTTGGG + Intronic
1188759308 X:34005999-34006021 CTGAAACATCAAAAGCAATAAGG + Intergenic
1194994087 X:100574232-100574254 CAGAAAAATCAACAGCATTAGGG - Intergenic
1196334581 X:114516795-114516817 CTGAAACATAAATAGGGCCAAGG - Intergenic