ID: 1168887005

View in Genome Browser
Species Human (GRCh38)
Location 20:1266793-1266815
Sequence CACCTGCCGCGGTGCAGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168887005_1168887016 21 Left 1168887005 20:1266793-1266815 CCTGCGCTGCACCGCGGCAGGTG 0: 1
1: 0
2: 2
3: 4
4: 104
Right 1168887016 20:1266837-1266859 CTGCGGTAGAATCCCTTGGAGGG 0: 1
1: 0
2: 0
3: 6
4: 91
1168887005_1168887012 4 Left 1168887005 20:1266793-1266815 CCTGCGCTGCACCGCGGCAGGTG 0: 1
1: 0
2: 2
3: 4
4: 104
Right 1168887012 20:1266820-1266842 CCGCTTGCAACCGCTCGCTGCGG 0: 1
1: 0
2: 0
3: 2
4: 36
1168887005_1168887015 20 Left 1168887005 20:1266793-1266815 CCTGCGCTGCACCGCGGCAGGTG 0: 1
1: 0
2: 2
3: 4
4: 104
Right 1168887015 20:1266836-1266858 GCTGCGGTAGAATCCCTTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 72
1168887005_1168887014 17 Left 1168887005 20:1266793-1266815 CCTGCGCTGCACCGCGGCAGGTG 0: 1
1: 0
2: 2
3: 4
4: 104
Right 1168887014 20:1266833-1266855 CTCGCTGCGGTAGAATCCCTTGG 0: 1
1: 0
2: 0
3: 1
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168887005 Original CRISPR CACCTGCCGCGGTGCAGCGC AGG (reversed) Intronic
900349282 1:2227315-2227337 CACCGGCCACGGCGCAGCGGGGG + Intergenic
900402760 1:2479359-2479381 CACCTGCGGCGCTGGAGCCCTGG + Intronic
904909562 1:33923793-33923815 CACCTCCTGCTGTGCAGCCCAGG - Intronic
906380139 1:45327411-45327433 CAGCTCCCGGGTTGCAGCGCCGG - Exonic
918341005 1:183567883-183567905 CAGCTGCCGTGGTGCAGTGTCGG + Intronic
920034216 1:203055621-203055643 CACCTCCCGCAGTGCTGCCCAGG + Exonic
923562139 1:235049432-235049454 CACCAGCCCCAGTGCAGCCCTGG - Intergenic
1063960196 10:11300365-11300387 CACCTGGCTTGGTGCAGTGCTGG - Intronic
1064380463 10:14837774-14837796 CAGCTGCTGCGCCGCAGCGCGGG + Intronic
1064739113 10:18413903-18413925 CACCTGCCGTGGAGCAGTTCAGG + Intronic
1075630732 10:123999396-123999418 CACCTCCCGCTGTGTAGCCCAGG + Intergenic
1076064804 10:127440729-127440751 CACAGGCCGCAGAGCAGCGCTGG - Intronic
1076691204 10:132224667-132224689 CACCTGCCGCGGAGGAGCCTGGG + Intronic
1080645179 11:34182927-34182949 CACCTGCCAAGGAGCAGAGCTGG + Intronic
1089716144 11:120361189-120361211 CACCTCCTGCTGTGCAGCCCTGG - Intronic
1097293731 12:57941725-57941747 CCCCTGCCGCGGGGCCCCGCCGG - Exonic
1099739058 12:86607834-86607856 CACCTGGCGGGGTGCAGGGTTGG + Intronic
1102903519 12:116657409-116657431 CACCTGCCACTGCGCAGCCCTGG + Intergenic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1103377553 12:120469059-120469081 AAGCGGCCGCGGGGCAGCGCGGG - Intronic
1103464603 12:121132279-121132301 GACCTGCCGGGGTGCAGAGGAGG + Intergenic
1104841454 12:131828033-131828055 CACCTGCTGCGCTGCGGCGGCGG + Intergenic
1105578023 13:21670970-21670992 CGCCTGCCGCAGAGCGGCGCGGG + Intergenic
1107964782 13:45588787-45588809 CACCTGCCGGGAAGCAGAGCCGG + Intronic
1112192322 13:97190070-97190092 CACCTGCCGCAGTGGACCCCTGG + Intergenic
1113656165 13:112068737-112068759 CAGCGGCCGCGGCGCAGAGCCGG + Exonic
1121352599 14:93185161-93185183 CCCCTGCCGCGCTGCAGCGCCGG - Exonic
1121660591 14:95632395-95632417 CACCTGCAGCGGTGCAGGGCAGG + Intergenic
1122961004 14:105093594-105093616 CGCCTGCGGCGGCGCAGCCCAGG - Intergenic
1124244869 15:28060151-28060173 CACCTGCCTCAGTGCGGGGCCGG - Intronic
1126406939 15:48331675-48331697 CCCCGGCCGCTGTCCAGCGCTGG + Exonic
1130596937 15:85255266-85255288 CACCTGCCGAGGTGCTGCAGCGG + Intergenic
1131097513 15:89665865-89665887 CACCAGCCGAGGTCGAGCGCCGG - Exonic
1131837816 15:96408560-96408582 CAGCTGCCGGGGTTCAGCGTTGG + Intergenic
1132634959 16:939503-939525 CACGTGCCGCCGAGCAGCGGAGG + Intronic
1132685642 16:1160935-1160957 CCCCAGCCTCGGTGCAGCCCTGG + Intronic
1132841502 16:1980364-1980386 CACCTGCCGGGTGGCAGCGCGGG + Exonic
1135105474 16:19645677-19645699 CACCTGCTGGGCTGCAGAGCTGG - Intronic
1141175122 16:81713648-81713670 CAGCTGCTGCGGGGCAGAGCAGG - Intergenic
1142045287 16:87921430-87921452 CACCTGCTGCGGGGCACAGCTGG + Intronic
1142421447 16:89972840-89972862 CGCCGGCCGCGGGGGAGCGCGGG + Intergenic
1142489622 17:269914-269936 CATCTGCAGGGGTGCAGTGCAGG + Intronic
1142767893 17:2075941-2075963 CACCAGCCTCTGTGCAACGCCGG + Intronic
1145165845 17:20612894-20612916 CACCTGCCGCAGCACAGGGCGGG - Intergenic
1145265815 17:21379164-21379186 CACCTGCAGCTCTGCAGCACTGG + Intronic
1148866923 17:50633641-50633663 CACCTGCCGCTGAGCAGCCAAGG + Intergenic
1151155259 17:72119916-72119938 CACCTGAAGGGGTGAAGCGCCGG - Intergenic
1151578658 17:74965189-74965211 CACCTCCAGCGCTGCAGCTCAGG + Intronic
1152037055 17:77880066-77880088 CTCCTGCCGCCCGGCAGCGCTGG - Intergenic
1160909646 19:1468733-1468755 CACCTTCCGCGGTGTGGCGCGGG - Exonic
1161206045 19:3041976-3041998 CTCCTCCCGCGGTGCTGCGGGGG + Intronic
1161288896 19:3482505-3482527 TACCTGCTGCTGTGCAGAGCAGG - Intergenic
1161608812 19:5229659-5229681 CACCTTCCGCGGCGGCGCGCTGG + Exonic
1162959478 19:14117574-14117596 CACCCGCCGCGCCGCAGCTCCGG - Exonic
1163758205 19:19119529-19119551 CACCTGCCCGGGTGCAGGGTGGG - Intronic
1165067094 19:33235758-33235780 CACCTGCCTCGGGGCAGGGCTGG + Intergenic
1165446786 19:35861015-35861037 GACCCGCCGCGGTGGCGCGCAGG + Exonic
1167507659 19:49879386-49879408 CTCCTGCCCTGGGGCAGCGCAGG - Intronic
932490066 2:72114744-72114766 CACCTGCGGCTCTGCAGCCCTGG + Intergenic
932597921 2:73105774-73105796 CACCTGGCCCTGTGCAGAGCAGG + Intronic
943672651 2:190680065-190680087 CACCTGCCACTGTCCAGGGCTGG + Intronic
948596056 2:239080430-239080452 CACCTGCCGTGGTGGAGTGACGG - Intronic
1168887005 20:1266793-1266815 CACCTGCCGCGGTGCAGCGCAGG - Intronic
1171316358 20:24199236-24199258 CACCTGCCGTGCTGCAACACTGG + Intergenic
1172458050 20:35092943-35092965 CACCTACCCCGCTGCCGCGCAGG - Intergenic
1174554331 20:51383002-51383024 CACCTGCAGCCGTGCAGTTCAGG - Intergenic
1179481876 21:41683752-41683774 CACCTGCCGCAGAGTAGAGCTGG + Intergenic
1181831749 22:25565244-25565266 CACCCGCCCCGGGGCAGCGGAGG - Intronic
1184101476 22:42343673-42343695 CACCCGGCGCGGCGCTGCGCAGG - Intergenic
950098339 3:10343003-10343025 CACCTGCTGCTGTGAAGTGCTGG + Intronic
950604322 3:14064863-14064885 CAGCTGCCCCAGTGCAGCCCTGG + Exonic
958953447 3:100441004-100441026 CACCTGCTCCTGTGTAGCGCAGG - Intronic
962264373 3:133934920-133934942 CACCTTCCGCGGGCCAGCGTGGG - Intronic
964051203 3:152395923-152395945 CACCTCCTGCTGTGCAGCCCAGG - Intronic
966712238 3:182981804-182981826 AACCTGCCTTGGTACAGCGCTGG - Intronic
968188067 3:196646769-196646791 CACGAGCCCCGGTACAGCGCAGG + Intronic
968440991 4:624360-624382 CAGCTGCAGCGGTGCAGCCCAGG + Intergenic
968816441 4:2824104-2824126 CACCTGCCCCGGTGCCTGGCTGG + Intronic
968973763 4:3810552-3810574 CCCCTGCCGAGCTGCAGAGCGGG + Intergenic
971365198 4:25971534-25971556 GGCCTGCCGCGATGCAGAGCTGG - Intergenic
984811406 4:183798403-183798425 CTCCAGCCGCGGAGCAGTGCCGG - Intergenic
985462566 4:190121269-190121291 CTCCCGCCCCGGTGCCGCGCCGG + Intergenic
990410333 5:55535033-55535055 CCCCTCCCGCTGAGCAGCGCAGG + Intronic
996726096 5:126674395-126674417 CACCTGGCGCGGAGCAGCCTGGG + Intergenic
999300202 5:150486154-150486176 GAGCTGCCCCGGCGCAGCGCCGG + Intronic
1002323278 5:178388400-178388422 AACCTGCAGCGGGGCAGCTCAGG + Intronic
1002547963 5:179964170-179964192 CCCCTGCCGAGGAGCAGCACTGG + Intronic
1003481995 6:6543009-6543031 CAGCTGGCAAGGTGCAGCGCAGG - Intergenic
1004193920 6:13487485-13487507 CCGCTGCCGCGCTGCAGCTCGGG - Exonic
1007264793 6:40587962-40587984 CAGCTGCAGAGGTGCAGCCCTGG - Intergenic
1007371109 6:41427617-41427639 CACCTGCCCCGGGGCAGGCCGGG - Intergenic
1010043985 6:71420121-71420143 CACCGGCCGCGCTGCGGCCCCGG + Intergenic
1014233981 6:118935032-118935054 CACCGGCCGCGGGGACGCGCGGG + Exonic
1017399103 6:154039284-154039306 CTCCTGCAGCGGTGCGGGGCAGG + Exonic
1018876718 6:167827423-167827445 CCCCTGCCGCGGTGTATCCCGGG + Intronic
1019486353 7:1291137-1291159 CACGTCCCGGGGGGCAGCGCGGG - Intergenic
1022750487 7:33219306-33219328 GACCGGCCGCGGTGGAGCACGGG - Intronic
1027246188 7:76369217-76369239 CTCCTGCCCCGGTGCAGCCTGGG - Intergenic
1028641137 7:93043491-93043513 CAGCTGCCGCAGCCCAGCGCCGG + Intergenic
1030262484 7:107580257-107580279 CGGCGGCCGCGGAGCAGCGCAGG + Intronic
1035265272 7:157686563-157686585 CACCCGCCGTGGTGCAGCCTTGG - Intronic
1042372348 8:68006160-68006182 CAACTGCCCTGGTGCAGCCCTGG + Intronic
1044867071 8:96582041-96582063 CAACTGCCATGGTGCAGCTCGGG + Intronic
1044995667 8:97835856-97835878 CACCTCCTGCTGTGCAGCCCGGG - Intronic
1045350405 8:101333078-101333100 CACCTGCCGCTCAGCAGGGCCGG - Intergenic
1061511904 9:131066849-131066871 CACCTTCCCCGGAGCAGCACGGG - Intronic
1062362352 9:136193860-136193882 CGGCCGCCGGGGTGCAGCGCGGG - Intergenic
1187397657 X:18932112-18932134 CAGCTGTGGCGGTGCATCGCTGG + Intronic
1189301255 X:39954166-39954188 GCCCTGCCCCGGTGCAGTGCAGG - Intergenic
1192194054 X:69016842-69016864 CAGCTGGGGCGGTGCAGGGCAGG + Intergenic
1200155321 X:153971952-153971974 CCCCCGCCGCGAGGCAGCGCAGG - Intergenic