ID: 1168887006

View in Genome Browser
Species Human (GRCh38)
Location 20:1266794-1266816
Sequence CTGCGCTGCACCGCGGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168887001_1168887006 1 Left 1168887001 20:1266770-1266792 CCGCGGCGGAGCGGGGAGCTGGC 0: 1
1: 0
2: 2
3: 20
4: 189
Right 1168887006 20:1266794-1266816 CTGCGCTGCACCGCGGCAGGTGG 0: 1
1: 0
2: 1
3: 12
4: 123
1168886994_1168887006 23 Left 1168886994 20:1266748-1266770 CCAGTGGACTCAGGTGAGGAGGC 0: 1
1: 0
2: 1
3: 21
4: 244
Right 1168887006 20:1266794-1266816 CTGCGCTGCACCGCGGCAGGTGG 0: 1
1: 0
2: 1
3: 12
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168887006 Original CRISPR CTGCGCTGCACCGCGGCAGG TGG Intronic
900583051 1:3418779-3418801 CAGCGGTGCACGGAGGCAGGCGG - Intronic
901776594 1:11564350-11564372 GTGCGGTGCACTGCGGTAGGAGG + Intergenic
903145367 1:21368644-21368666 CAGCCGTGCACCGTGGCAGGTGG - Intergenic
907310325 1:53535396-53535418 CTGGGCTGGACCGGTGCAGGAGG + Intronic
1064289846 10:14023501-14023523 CTGCGCTGCCCCCGGGAAGGCGG - Intronic
1072189134 10:93066350-93066372 CTGGGCGCCGCCGCGGCAGGCGG - Intronic
1073347554 10:102795488-102795510 CTTCTGTGCACCGAGGCAGGGGG - Intronic
1074735245 10:116424585-116424607 CTGGGCTGCACAGCAGGAGGTGG + Intergenic
1076683171 10:132185747-132185769 CAGCGCTGCCGGGCGGCAGGAGG + Intergenic
1077079900 11:720615-720637 CTGCGCTGCACCGTGGGCAGCGG - Exonic
1080008005 11:27429916-27429938 CTGCCCTGCAGGGCTGCAGGGGG - Intronic
1081529267 11:43946927-43946949 CTGCCCTGCACAGAGGAAGGAGG + Intergenic
1083936592 11:65872814-65872836 GTGGGCCGCGCCGCGGCAGGCGG - Exonic
1084307545 11:68296905-68296927 CTGCGAGGCACAGCGGCACGAGG + Intergenic
1093711566 12:22334676-22334698 CGGCGCAGCAGCGCGGGAGGCGG - Exonic
1094391703 12:29958744-29958766 CTGCTCTGCACCCAGGCAGCAGG - Intergenic
1096596236 12:52697544-52697566 CTGCACTGCACAACTGCAGGAGG - Intronic
1097250886 12:57631885-57631907 CTGCGCTGCGCCGCCGCGGTCGG + Intronic
1112022488 13:95383775-95383797 CTGGGCTGCACAGCAGGAGGTGG + Intergenic
1114525588 14:23365527-23365549 CCGCTCTGCAGCGCGGCCGGCGG - Exonic
1120877253 14:89386404-89386426 CTGCCCTGCACAACTGCAGGAGG + Intronic
1121352601 14:93185162-93185184 CGGCGCTGCAGCGCGGCAGGGGG + Exonic
1121495363 14:94388432-94388454 CTGCCCTGCACCTCAGCAGGCGG + Intronic
1122075257 14:99231420-99231442 GCGCGCTGCAGCACGGCAGGGGG + Exonic
1122859481 14:104576132-104576154 CTGCTCTGCACAGGGGCTGGTGG - Intronic
1122961005 14:105093595-105093617 CTGGGCTGCGCCGCCGCAGGCGG + Intergenic
1123036604 14:105474396-105474418 CTGCGCTCCGCCGCGGGAAGGGG - Intronic
1123119287 14:105909387-105909409 CTGTGCTGCACCAGGGCAGGAGG + Intergenic
1123679157 15:22745243-22745265 CTGGGCTGCACAGCAGGAGGTGG + Intergenic
1124331376 15:28819693-28819715 CTGGGCTGCACAGCAGGAGGTGG + Intergenic
1125731136 15:41893435-41893457 CTGCAGGGCACCGCAGCAGGAGG - Exonic
1128551604 15:68601281-68601303 CTGGGCTCCAGGGCGGCAGGCGG + Intronic
1131231713 15:90665005-90665027 GTCCGCTGCACCGGGCCAGGGGG - Intergenic
1131735477 15:95326968-95326990 CTGCGGCGCTCCGCGGGAGGAGG + Intergenic
1132685640 16:1160934-1160956 CAGGGCTGCACCGAGGCTGGGGG - Intronic
1132939559 16:2500087-2500109 GTGCGCTGCTCCGGGGCAGGGGG + Intronic
1136580534 16:31148676-31148698 CTGCGCTCGACCGGGGCAGTAGG + Intronic
1138708477 16:58942020-58942042 CTGGGCTGCACAGCAGGAGGAGG + Intergenic
1141175123 16:81713649-81713671 CTGCTCTGCCCCGCAGCAGCTGG + Intergenic
1142190786 16:88716395-88716417 CAGCACTGCACGGCGGCAGCTGG - Exonic
1142245364 16:88967830-88967852 ACGCGCTGCTCCGGGGCAGGGGG - Intronic
1142489621 17:269913-269935 CTGCACTGCACCCCTGCAGATGG - Intronic
1147018302 17:37510263-37510285 CTGGGCGGCACCGCGGTGGGAGG - Intronic
1147971525 17:44220931-44220953 CTGCGCTGCGCCGAGGCGGGCGG - Intronic
1151478969 17:74359099-74359121 CTGAGCAGCATCACGGCAGGAGG + Intronic
1151491059 17:74432491-74432513 CTGCGCTGGAGCGGGGCCGGCGG + Intronic
1151578657 17:74965188-74965210 CTGAGCTGCAGCGCTGGAGGTGG - Intronic
1152037056 17:77880067-77880089 CAGCGCTGCCGGGCGGCAGGAGG + Intergenic
1153688090 18:7566839-7566861 CTGCGCTGCTCGGCGGCTGCGGG - Exonic
1158836248 18:61334078-61334100 CTGGGGCGCACCGGGGCAGGTGG + Intronic
1160364528 18:78313023-78313045 CTGCTCTGCCCAGGGGCAGGTGG - Intergenic
1160570716 18:79815862-79815884 CTGAGCTGCACTGCCACAGGGGG + Intergenic
1160909648 19:1468734-1468756 CCGCGCCACACCGCGGAAGGTGG + Exonic
1161206043 19:3041975-3041997 CCCCGCAGCACCGCGGGAGGAGG - Intronic
1163424932 19:17236053-17236075 CCGCGCTGCACCGCTGCGGGAGG + Exonic
1165828829 19:38720464-38720486 CTGCGCAGCCCTGGGGCAGGAGG - Intronic
1167507660 19:49879387-49879409 CTGCGCTGCCCCAGGGCAGGAGG + Intronic
1167738694 19:51311728-51311750 CTGCGCTGCACCGGCCCGGGGGG - Intergenic
925899241 2:8496566-8496588 CTGAGCTGCACTGAGGGAGGAGG - Intergenic
927943250 2:27118842-27118864 CCGCGCGGCGCCGCAGCAGGTGG - Exonic
932580511 2:72990136-72990158 CTGCGCTGCCCCGGGGCTGGCGG - Intronic
932827315 2:74953507-74953529 CTGGGCTCCACTGAGGCAGGGGG - Intergenic
934569897 2:95362747-95362769 CTGGGCTGCACAGCAGGAGGTGG - Intronic
937224008 2:120357806-120357828 CTGGGCTGCACTGCAGCTGGGGG + Intergenic
938293251 2:130161470-130161492 CTGCGCTGGCCCGCGGCTGCTGG - Intronic
938406973 2:131038231-131038253 CTGGGCTGCAAGGCTGCAGGAGG - Intronic
938407006 2:131038353-131038375 CTGGGCTGCAAGGCTGCAGGAGG - Intronic
938407027 2:131038444-131038466 CTGGGCTGCAAGGCTGCAGGAGG - Intronic
938463300 2:131511495-131511517 CTGCGCTGGCCCGCGGCTGCTGG + Intergenic
939969647 2:148644912-148644934 CCGCGCTGCACTGAGGAAGGAGG + Intronic
944716261 2:202377652-202377674 CTCCGCTGCACCGCGATCGGGGG - Intronic
945337158 2:208605953-208605975 CTGGGCTGCACGCAGGCAGGAGG - Intronic
947623312 2:231604535-231604557 CTGCGCTGCCGCGGGCCAGGCGG + Intergenic
947721142 2:232369900-232369922 CTGCTCGGGACCGAGGCAGGTGG - Intergenic
948050678 2:234977231-234977253 CTGAGCTTCTCCCCGGCAGGAGG - Intronic
1168887006 20:1266794-1266816 CTGCGCTGCACCGCGGCAGGTGG + Intronic
1170630021 20:18057766-18057788 CTGGGCCGCGCCGCGGCGGGGGG - Exonic
1172458051 20:35092944-35092966 CTGCGCGGCAGCGGGGTAGGTGG + Intergenic
1174268500 20:49349516-49349538 CTGCGCTGCACTACACCAGGGGG - Intergenic
1176013160 20:62911352-62911374 TTGCGCGGCGCCGCGGCAGGAGG - Exonic
1178092622 21:29180542-29180564 GAGCGCTGCACCGCTGCATGTGG + Intergenic
1179472067 21:41617747-41617769 TTGCCCTGCACTGCAGCAGGGGG - Intergenic
1179992476 21:44955307-44955329 GTGCCCAGCACCGCGGCAGCGGG - Intronic
1180703059 22:17792102-17792124 CTGGGCTTCACTGTGGCAGGAGG + Intronic
1182527205 22:30927873-30927895 CTGCACAGCACCCTGGCAGGAGG - Intronic
1183770424 22:39920493-39920515 CTGAGCTGCACCCCGGCTGCAGG - Intronic
1184101477 22:42343674-42343696 CTGCGCAGCGCCGCGCCGGGTGG + Intergenic
1184228325 22:43143391-43143413 CTGCGCCGCGCCGCCGCAGTCGG - Exonic
1185285950 22:49999955-49999977 CTGAGCTTCCCCGCTGCAGGAGG + Exonic
950507842 3:13406769-13406791 CTTCTCTGCACCTCAGCAGGTGG + Intronic
954197855 3:49007022-49007044 CTGCGCCGTATCGCGGCTGGCGG - Exonic
961913485 3:130345789-130345811 CCGCGCCGCACAGCTGCAGGTGG - Exonic
962323076 3:134407170-134407192 CTGCCCTGCCACTCGGCAGGAGG + Intergenic
962714427 3:138114839-138114861 CTGGGCTGGACCTCAGCAGGAGG - Intronic
963133137 3:141876622-141876644 CTGCGCCGCGCCGCGCCGGGCGG - Exonic
963275931 3:143329805-143329827 CTGCTGTGCACCGGGGCACGAGG - Intronic
968188066 3:196646768-196646790 CTGCGCTGTACCGGGGCTCGTGG - Intronic
968973760 4:3810551-3810573 CCGCTCTGCAGCTCGGCAGGGGG - Intergenic
970062473 4:12050632-12050654 CTGCCCTGCACCACCTCAGGAGG + Intergenic
982266762 4:153544860-153544882 CTCAGCTGCACGGAGGCAGGTGG - Intronic
997899867 5:137754462-137754484 CGGCGCTGCGGCGCGGTAGGCGG - Intergenic
1000230435 5:159310680-159310702 CTGCGCACGACCGCGGCGGGCGG + Intergenic
1002541327 5:179908039-179908061 GTGGGCTGCACCGCTCCAGGAGG - Intergenic
1003481996 6:6543010-6543032 CTGCGCTGCACCTTGCCAGCTGG + Intergenic
1005597584 6:27394292-27394314 CTGCCCTGCACCACTCCAGGAGG + Intronic
1006624489 6:35387596-35387618 CTGCTCTTCACCGTGGCAGTGGG + Intronic
1006851622 6:37102735-37102757 GCGCGCTGCTCTGCGGCAGGCGG + Intergenic
1007785207 6:44275906-44275928 CTGTGTTGACCCGCGGCAGGCGG - Exonic
1008659500 6:53651843-53651865 CTACGCGGCGCCGCTGCAGGTGG - Exonic
1011912991 6:92465729-92465751 CTGCCCTGCACCACTCCAGGAGG - Intergenic
1014461629 6:121703334-121703356 CTGCGCAGCAGCCTGGCAGGGGG + Intergenic
1015201219 6:130583502-130583524 CTGGGCTGCACAGCAGGAGGCGG - Intergenic
1015965704 6:138693449-138693471 CTGCGCTGCACCCCGGCCCGGGG - Intergenic
1017399102 6:154039283-154039305 CTGCCCCGCACCGCTGCAGGAGG - Exonic
1018395912 6:163377921-163377943 CTGCGCTGCTCCAGGGAAGGAGG - Intergenic
1018876715 6:167827422-167827444 CCGGGATACACCGCGGCAGGGGG - Intronic
1019343963 7:520687-520709 CTGAGCTGCGCCTCGGCCGGAGG - Intergenic
1023046563 7:36215235-36215257 CAGCGCTGCACCAGGGCAGTAGG + Intronic
1027202787 7:76073727-76073749 CTGGGCTGCCGCGAGGCAGGTGG + Intergenic
1027246190 7:76369218-76369240 CCAGGCTGCACCGGGGCAGGAGG + Intergenic
1027441720 7:78226252-78226274 CTGCACTGCACACCGGTAGGGGG - Intronic
1032194096 7:129779930-129779952 CTCCGCTGCCCCGCGAGAGGGGG + Intergenic
1034965617 7:155388940-155388962 CTGCCCAGCAGCGGGGCAGGTGG + Intronic
1037690375 8:21176837-21176859 CTGGGCTGCACAGCAGGAGGTGG - Intergenic
1038312741 8:26457261-26457283 CTGCTCTGCACCTCAGCAGTTGG + Intronic
1038776832 8:30538924-30538946 CTGCCCTGCACCACGGGAGCTGG + Intronic
1039521534 8:38176338-38176360 CTGCAATGCACAGCGGCGGGAGG + Exonic
1053815064 9:41898898-41898920 CTGCGCTGCTCCCCTGAAGGCGG - Exonic
1054615532 9:67288543-67288565 CTGCGCTGCTCCCCTGAAGGCGG + Intergenic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1060474592 9:123977191-123977213 CTCTGCTGCACCGCGGCTGCCGG - Intergenic
1060476770 9:123992932-123992954 CTCTGCTGCACCGCGGCTGCCGG + Intergenic
1061384281 9:130279184-130279206 CTGTCCTTCACCACGGCAGGTGG - Intergenic
1203778567 EBV:87927-87949 ATGCGAGGCCCCGCGGCAGGAGG - Intergenic
1186475819 X:9856912-9856934 CTGCGCTGCAAGGGGGCACGAGG + Intronic
1192194053 X:69016841-69016863 CTGCCCTGCACCGCCCCAGCTGG - Intergenic
1193270948 X:79530189-79530211 CTGTGCTGCACCTTGGCAGGGGG + Intergenic