ID: 1168888180

View in Genome Browser
Species Human (GRCh38)
Location 20:1274969-1274991
Sequence GTGCAGCCCCAGAGGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 365}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168888174_1168888180 4 Left 1168888174 20:1274942-1274964 CCCTTTCAGAAGTGGCGGACTTT 0: 1
1: 0
2: 1
3: 6
4: 89
Right 1168888180 20:1274969-1274991 GTGCAGCCCCAGAGGGAGAAGGG 0: 1
1: 0
2: 2
3: 40
4: 365
1168888171_1168888180 11 Left 1168888171 20:1274935-1274957 CCAGCCTCCCTTTCAGAAGTGGC 0: 1
1: 0
2: 0
3: 26
4: 303
Right 1168888180 20:1274969-1274991 GTGCAGCCCCAGAGGGAGAAGGG 0: 1
1: 0
2: 2
3: 40
4: 365
1168888168_1168888180 16 Left 1168888168 20:1274930-1274952 CCCTTCCAGCCTCCCTTTCAGAA 0: 1
1: 0
2: 2
3: 52
4: 377
Right 1168888180 20:1274969-1274991 GTGCAGCCCCAGAGGGAGAAGGG 0: 1
1: 0
2: 2
3: 40
4: 365
1168888173_1168888180 7 Left 1168888173 20:1274939-1274961 CCTCCCTTTCAGAAGTGGCGGAC 0: 1
1: 0
2: 0
3: 1
4: 55
Right 1168888180 20:1274969-1274991 GTGCAGCCCCAGAGGGAGAAGGG 0: 1
1: 0
2: 2
3: 40
4: 365
1168888167_1168888180 19 Left 1168888167 20:1274927-1274949 CCTCCCTTCCAGCCTCCCTTTCA 0: 1
1: 0
2: 7
3: 198
4: 2573
Right 1168888180 20:1274969-1274991 GTGCAGCCCCAGAGGGAGAAGGG 0: 1
1: 0
2: 2
3: 40
4: 365
1168888169_1168888180 15 Left 1168888169 20:1274931-1274953 CCTTCCAGCCTCCCTTTCAGAAG 0: 1
1: 0
2: 3
3: 52
4: 384
Right 1168888180 20:1274969-1274991 GTGCAGCCCCAGAGGGAGAAGGG 0: 1
1: 0
2: 2
3: 40
4: 365
1168888175_1168888180 3 Left 1168888175 20:1274943-1274965 CCTTTCAGAAGTGGCGGACTTTG 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1168888180 20:1274969-1274991 GTGCAGCCCCAGAGGGAGAAGGG 0: 1
1: 0
2: 2
3: 40
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168888180 Original CRISPR GTGCAGCCCCAGAGGGAGAA GGG Intronic
900322480 1:2092066-2092088 GTGCGGCCGCAGAGTGAGACAGG + Intronic
900974577 1:6009048-6009070 CTGCAGCTCCTGGGGGAGAAGGG - Intronic
901140539 1:7026406-7026428 TGGCAGCCCCGGTGGGAGAAGGG + Intronic
901197782 1:7449891-7449913 ATGCAGCCCCCAGGGGAGAAAGG + Intronic
901324146 1:8356921-8356943 GAGCAGCCACAGAGGCAGAGCGG - Intronic
901416558 1:9120560-9120582 GTCCAGCTCCAGCGGCAGAAGGG + Intronic
902598666 1:17526187-17526209 TTGCAGCCACACAGGGAGGAAGG - Intergenic
903546808 1:24129429-24129451 GGCCAGCCCCAGAGAGAGGAGGG - Intronic
904261547 1:29290543-29290565 GTGCAGGCCCAGAGGGCGCCAGG + Intronic
904304271 1:29577522-29577544 GCGCAGCCCCAGAGGGAGGCGGG - Intergenic
904585723 1:31579573-31579595 CTGCAGAGTCAGAGGGAGAAGGG + Intronic
904975084 1:34449752-34449774 GAGCAGCCCCAGGGGCAGCAGGG + Intergenic
905788751 1:40778922-40778944 GAGGAGACACAGAGGGAGAAAGG - Intergenic
907719726 1:56960561-56960583 GTGCAGGCCCAGTGGGAGTCAGG + Intronic
908817355 1:68047900-68047922 GTGCAGCCCCAGAAGAGGCATGG + Intronic
909034838 1:70584868-70584890 GTGCCGCCCCTGAGTGAGAAAGG + Intergenic
909197296 1:72643868-72643890 GTGCAGACCCAAAGAAAGAAAGG - Intergenic
910715140 1:90222454-90222476 GTGCAGCTCCAGAGCTAGCAAGG - Intergenic
910930984 1:92442297-92442319 GGCCAGACCCAGAGGGAGAAAGG + Intergenic
911357916 1:96844301-96844323 AAGCAGCCCCAGAGAGGGAATGG + Intergenic
912474925 1:109929129-109929151 GTGCAGCCCCTGAGGGAAGAGGG - Exonic
912828161 1:112925199-112925221 CTCCAGCCACAGAGGGAGACTGG - Intronic
915163703 1:153936564-153936586 GTGCTGCGCCAGATGGAGAGCGG - Exonic
916352118 1:163862468-163862490 ATGCAGTGGCAGAGGGAGAAGGG + Intergenic
916730788 1:167564940-167564962 GTAAAGCCCCTGAGGCAGAAGGG - Intergenic
917508266 1:175648654-175648676 TTGCTGCCACAGAAGGAGAAAGG - Intronic
919242806 1:194936443-194936465 TTGCAGCCTCATAGGCAGAAGGG + Intergenic
919767785 1:201138501-201138523 GCCCAGCCTCAGAGGGAGAGGGG - Intronic
919825468 1:201500314-201500336 GGTCTCCCCCAGAGGGAGAAGGG - Intronic
920040313 1:203091144-203091166 GTGCAGACCCGGAGGTGGAAGGG + Intronic
920363904 1:205438148-205438170 CTGAAGCCCAAGAGGGAAAATGG + Intronic
920706103 1:208251717-208251739 CTGCAGCCCCAGAGAGAAAGAGG - Intergenic
920792530 1:209106651-209106673 GTACAGCACCAGATGGAGAGAGG - Intergenic
921669002 1:217906072-217906094 GCATAGCCCCAGAGGGTGAAGGG - Intergenic
922427947 1:225517301-225517323 GGGCAGCTGCAGAGGGAGAAGGG + Exonic
922455146 1:225768329-225768351 TTGCAGCCCCAGGGGAAGAAGGG + Intergenic
923473600 1:234313300-234313322 ATTCAGCCCCACAGGGAGCAGGG + Intronic
923992748 1:239456901-239456923 GTGCAGCTCCTGTGGAAGAAAGG - Intronic
924092455 1:240515546-240515568 GTGCCCTCCCAGAGAGAGAAAGG - Intronic
1062947291 10:1471257-1471279 GTGGAGCTTCAGAAGGAGAACGG - Intronic
1063341704 10:5271404-5271426 CTCCAGCTCCAGAGGGAAAAGGG + Intergenic
1065438672 10:25727135-25727157 GTGGACCTTCAGAGGGAGAAGGG - Intergenic
1065540705 10:26763925-26763947 GTGGAGCTCCAGAAGGAGGAGGG + Exonic
1067286747 10:44912596-44912618 GTGCAGCCTCAGAGGGGTCAGGG - Intronic
1067297369 10:44982507-44982529 GTGGACCCCCACAGGAAGAAGGG + Exonic
1067668532 10:48299497-48299519 CTGCAACCCCAAAGGGAGACTGG - Intergenic
1067777446 10:49173842-49173864 GTTCAGCCACAGAGAGACAAGGG + Intronic
1068688098 10:59889739-59889761 GTGCTGCCCAAGTTGGAGAAAGG - Intronic
1068778029 10:60888669-60888691 GTGTCGACCCAGAGGAAGAAAGG - Exonic
1069091418 10:64203712-64203734 GTCCAGCTTCAAAGGGAGAATGG - Intergenic
1072526539 10:96276655-96276677 GTGAAGAGCCAGAGGGAAAAAGG + Intergenic
1074548038 10:114417022-114417044 TTACAGCCCCAGAGGGAGACAGG + Intergenic
1075201616 10:120409283-120409305 ATGCAGCCAGAGAGGGGGAAGGG - Intergenic
1075679643 10:124323075-124323097 GTGAACTCCCAGAGGGAGAGGGG + Intergenic
1075778920 10:125004713-125004735 GTCCAGCCTCAGAGGGAGGGAGG - Intronic
1076068154 10:127464993-127465015 GTGCAGACCCCGAGAGAGCACGG + Intergenic
1076539481 10:131205018-131205040 GTGCAGCCCCAGAAAGAGCCGGG - Intronic
1076888783 10:133274227-133274249 GTGCAGGCCCTGAGCGAGGAGGG + Exonic
1077293553 11:1812954-1812976 GTGGAGCCTTAGAGAGAGAATGG - Intergenic
1077459747 11:2703090-2703112 GGCCAGCCCCAGAGGCAGATGGG + Intronic
1078202968 11:9200804-9200826 GTATATCCCCAAAGGGAGAATGG - Intronic
1079251498 11:18791150-18791172 CTGAAGCCCCTGAGGGAGATTGG - Intronic
1081605438 11:44524620-44524642 GAGCAGGCCCAGAGGGAGCCGGG - Intergenic
1081908875 11:46687346-46687368 GGGCAGCCGCAGAAGGAGAAGGG - Intronic
1082786534 11:57320378-57320400 GTGCAGCCCCAGGGGGTGTACGG - Exonic
1083609175 11:63997027-63997049 CTGCAGCCACGGAGGGAGAAAGG - Intronic
1083643730 11:64159928-64159950 GTACATACCTAGAGGGAGAATGG + Intronic
1083879668 11:65541763-65541785 GTGCAGCCCCAGGGAAAGAGGGG - Intronic
1084660903 11:70545751-70545773 GTGCAGACCCTGCGGGCGAAGGG + Intronic
1084670388 11:70603365-70603387 CTGCTGCCCCAGAGGAGGAAGGG - Intronic
1086160587 11:83718026-83718048 ATGGACCCCCAGAGGGAGTACGG - Intronic
1088907754 11:114167674-114167696 GTGCAGGCTCAGAGGAAGGAGGG - Intronic
1089869425 11:121658933-121658955 GAGCAGCCCCAGGGGAAGAGAGG - Intergenic
1090534280 11:127623816-127623838 CTGAAGCCCTGGAGGGAGAAAGG + Intergenic
1091234679 11:134013196-134013218 GTAAAGCCCCAGTGGGAGAGTGG - Intergenic
1092049774 12:5459966-5459988 GTGAAGCCCCAGTGGGAGGGTGG - Intronic
1092088287 12:5783821-5783843 CTGGAGCCCTAGTGGGAGAAGGG - Intronic
1093012064 12:14117855-14117877 TTGGAGTCCCAGAAGGAGAAGGG + Intergenic
1093044054 12:14421421-14421443 CAGCACCCTCAGAGGGAGAATGG - Intronic
1093350918 12:18102676-18102698 TTGCAGGCTCAGAGGCAGAAGGG - Intronic
1094131933 12:27083903-27083925 GTGAAGCCCCAGAGTAAGTAGGG + Intergenic
1094375986 12:29787692-29787714 CTGCAGCCCCAGGAGGAAAAAGG + Intergenic
1095641144 12:44486394-44486416 GTGCTGCCTCAGGGGTAGAATGG - Intergenic
1096076889 12:48811474-48811496 GGGCTGCCCCACATGGAGAATGG - Intergenic
1096832503 12:54325239-54325261 GTTCAGCCCGAGTGGGAGACGGG + Intronic
1096834445 12:54340457-54340479 TTGCAGCCCCAGTGGGACTAGGG + Exonic
1097250485 12:57629984-57630006 CAGCAGGGCCAGAGGGAGAAAGG - Intronic
1100392749 12:94158359-94158381 GTGCAGGTCCAGATGGTGAAGGG + Intronic
1101192952 12:102353973-102353995 TTGCAGCCTCATAGGTAGAAGGG - Intergenic
1101506535 12:105351968-105351990 GTGCAGGCACAGAGGAATAATGG + Intronic
1102455274 12:113066982-113067004 GAGCAGCTCCAGAGGGATGATGG - Intronic
1102658335 12:114502639-114502661 GTGCAGTGGCAGAGGGAGATTGG + Intergenic
1102998664 12:117368510-117368532 GTTAAGGCCCAGAGGGAGGAGGG - Intronic
1103016654 12:117499970-117499992 ATTCAGCCCCAGTGGCAGAAGGG - Intronic
1104315228 12:127692692-127692714 ATGCGGTCCCAGCGGGAGAAGGG - Intergenic
1104398525 12:128456119-128456141 GCCCTGCACCAGAGGGAGAATGG + Intronic
1104423267 12:128654372-128654394 CTGCAGCCTCAGAGGGAGCACGG + Intronic
1104450211 12:128863005-128863027 GTGAACCCTCAGAGGGGGAAAGG - Intronic
1104483622 12:129130258-129130280 GGGCATCCCCAGAAGGAGATGGG - Intronic
1104970975 12:132530570-132530592 GTGGAGACCCAGAAGCAGAAGGG - Intronic
1105067940 12:133216613-133216635 GTGCAGCCCCAGGGACAGCAAGG - Intergenic
1105294002 13:19072626-19072648 GGGCAGCCCCAGAGGGGAAGTGG + Intergenic
1107781978 13:43913137-43913159 GAACAGCCAGAGAGGGAGAAGGG + Intergenic
1110699824 13:78534030-78534052 GTGAAGGCCGAGAAGGAGAAAGG - Intergenic
1112504249 13:99966048-99966070 CTGCAGTCCCAGAGGGATCAGGG + Intronic
1113610934 13:111644835-111644857 GGGCAGCGCCAGGGGGGGAAAGG + Intronic
1113675690 13:112205535-112205557 GTGCACCCGCAGAGGGAAGAGGG + Intergenic
1113739288 13:112700359-112700381 GTCCTGCTCCAGAGAGAGAAGGG + Intronic
1113953082 13:114082633-114082655 GGGCAGCCCCAGAGAAGGAATGG + Intronic
1114246504 14:20919449-20919471 GGGCAGCAACTGAGGGAGAAGGG + Intergenic
1115960970 14:38836073-38836095 GGGGAGCCCCACAGGGAGACTGG - Intergenic
1119918033 14:78420567-78420589 GTGCAGCTTCAGGGTGAGAATGG + Intronic
1121286900 14:92743097-92743119 GTGAAGGCCCAGAGAGAGGAAGG - Intronic
1122297121 14:100711960-100711982 GATCAGCCCCAGAGGCAGGAGGG + Intergenic
1122417776 14:101558473-101558495 GTGCAGCCCTAGAGAGAGGTAGG + Intergenic
1122634224 14:103122757-103122779 CCCCAGCCCCAGAGGGGGAAAGG + Intergenic
1122634615 14:103124101-103124123 GTGCAGCCAGAAAGGAAGAAGGG - Intronic
1122892651 14:104739994-104740016 GTGCAACCCCAGAGAGAGACGGG - Intronic
1124155733 15:27223979-27224001 CTCCAGCTCCAGTGGGAGAAAGG - Intronic
1124405912 15:29391310-29391332 GTGCAGCCCCTGAAGGGAAATGG - Intronic
1124819413 15:33029765-33029787 GTTAAGCCCCTGAGGAAGAAGGG + Intronic
1127904834 15:63368802-63368824 ATGCTGCCCCAGTGGGAAAAGGG + Intronic
1129194006 15:73953552-73953574 GTCCAGCTCCAGAGGGAGAGTGG - Intergenic
1129314101 15:74730875-74730897 GTGAAGCCCCAGGGGGCCAAAGG + Intergenic
1129921059 15:79319511-79319533 GTCCAGCCCCACAGGGTGGATGG + Intronic
1130551069 15:84890236-84890258 GTGCTGCCACAGAGGCAGGAAGG + Intronic
1130990835 15:88874772-88874794 GTGCAGGGACAGGGGGAGAAGGG + Exonic
1131535414 15:93233109-93233131 CTGCAGCTTCAGTGGGAGAAAGG - Intergenic
1132463286 16:66101-66123 GTGGAGACCCAGATTGAGAAGGG + Intronic
1132524134 16:406000-406022 CGCCAGCCCCACAGGGAGAAGGG + Intronic
1133960205 16:10486602-10486624 GACCCGCCCCAGATGGAGAATGG - Intergenic
1134093476 16:11403873-11403895 GTGCAGCCGGGCAGGGAGAAGGG - Intronic
1136285194 16:29236583-29236605 CAGCAGCGCCAGAGGCAGAAGGG + Intergenic
1137376808 16:47958788-47958810 GTGCAGCCAGAGAGGCAGGAGGG - Intergenic
1137495839 16:48968593-48968615 TGGCATCCCCAGAGGGAGCAAGG + Intergenic
1138101638 16:54256612-54256634 CTGCAGCCCCCCAGGGAGAAAGG - Intronic
1138313880 16:56051805-56051827 GTGCAGCCTCACTAGGAGAAGGG + Intergenic
1138520088 16:57566074-57566096 GAGCTGACCCAAAGGGAGAAGGG - Intronic
1139890774 16:70252027-70252049 CTGGAGGCCCGGAGGGAGAACGG + Intergenic
1140143750 16:72285563-72285585 CTGTAGCCCCAGAGGTAGAGCGG + Intergenic
1140887075 16:79253635-79253657 GTGGAGCCCAAGATGAAGAAAGG - Intergenic
1141376914 16:83539798-83539820 GTGTGGCCCCAGAGGAGGAATGG + Intronic
1141749105 16:85946467-85946489 GTGGTGGCCCAGAGGGAGCAGGG - Intergenic
1203143106 16_KI270728v1_random:1781825-1781847 GTGGATCCCCAGATGGAGGATGG + Intergenic
1203143170 16_KI270728v1_random:1782250-1782272 GTGGATCCCCAGATGGAGTATGG + Intergenic
1142737038 17:1907688-1907710 GCGCACCCCCAAATGGAGAAGGG + Intergenic
1143353344 17:6306121-6306143 GTCCAGCCACAGAGAGAGAGGGG - Intergenic
1143604734 17:7976216-7976238 GTTCATCCCCTGAGGGAAAAGGG + Intergenic
1144668639 17:17118859-17118881 CTGCAGCCCCAGAGGGACTTTGG + Intronic
1144674680 17:17154198-17154220 GTAAAGTCCCACAGGGAGAAAGG - Intronic
1144854470 17:18260464-18260486 GTCCCGCCCCAGAGGGAGTGCGG + Intergenic
1145246423 17:21272817-21272839 CAGCAGCCCCTGAGGGAGATTGG + Intergenic
1146149267 17:30453227-30453249 TTACAGCCTCAGAGGCAGAAGGG - Intronic
1146945313 17:36869566-36869588 TTCCAGTCCCCGAGGGAGAAAGG - Intergenic
1147564953 17:41530255-41530277 GGAGAGCCCAAGAGGGAGAAAGG + Intergenic
1147924131 17:43936194-43936216 GTGGAGCCTCAGAGGGAAAGGGG + Intergenic
1148210748 17:45807011-45807033 GTTCAGCCCCAGAAGGAGAAGGG - Exonic
1148555305 17:48575593-48575615 AAGCAGCCCCAGAGGTAGGAAGG + Exonic
1149620293 17:58039779-58039801 GTGCAGCCACAGAAGAAGGAGGG + Intergenic
1150002876 17:61452343-61452365 GGGCGGCCCCAGAGGGAGGGAGG + Intergenic
1151106898 17:71625701-71625723 GATCAGTCCCAGAGGGATAAGGG + Intergenic
1151232348 17:72694028-72694050 GTCCAGCCCCAGACTGAGCAAGG - Intronic
1151367509 17:73626932-73626954 GCGCAGGCCAAGATGGAGAAGGG - Intronic
1151534252 17:74729759-74729781 GTGGAGCCCCAGAAGGAGATGGG - Intronic
1151786812 17:76279145-76279167 GGGCAGGGACAGAGGGAGAAGGG + Intronic
1152013995 17:77737544-77737566 GGAGAGCCCCAGAGGGAGCAAGG + Intergenic
1152557688 17:81062550-81062572 GAGCAGCCCACGAGGGAGCAGGG - Intronic
1152637688 17:81436813-81436835 GTGCGGCCTCACAGGGAGATGGG + Intronic
1152814779 17:82401061-82401083 CTGCAGCCCGAGAGGGAGAGAGG + Intronic
1152904800 17:82964620-82964642 GTGCACCCCCACGGGGAGGACGG + Intronic
1152904924 17:82964984-82965006 GTGCACTCCCACAGGGAGGACGG + Intronic
1152904935 17:82965025-82965047 GTGCACACCCACAGGGAGGACGG + Intronic
1152904947 17:82965066-82965088 GTGCACCCCCATGGGGAGGACGG + Intronic
1152904961 17:82965107-82965129 GTGCACCCCCATGGGGAGGACGG + Intronic
1152905018 17:82965271-82965293 GTGCACCCCCGGGGGGAGGATGG + Intronic
1153742006 18:8138870-8138892 GAGCAGCCAGAGAGGAAGAAAGG - Intronic
1154172417 18:12061314-12061336 GTGCAGCCCCAGATAGTGGATGG - Intergenic
1155429709 18:25742739-25742761 GAGCAGCCCCAGAGGAAAAGAGG + Intergenic
1157310198 18:46546948-46546970 GTGCTGCCACAGAGCGAGGAGGG - Exonic
1157483648 18:48072397-48072419 ATGCAGCCACCCAGGGAGAAGGG - Intronic
1159020290 18:63137812-63137834 GTGCTGCCTAAGAGGGTGAAAGG + Intronic
1160411553 18:78678506-78678528 CTGGAGCCCCAGAGGGGGCAGGG - Intergenic
1161148462 19:2694085-2694107 GCCCAACCCCAGAGAGAGAAAGG - Intronic
1161504683 19:4637497-4637519 ATGGAACCCCAGAGGGAGGAAGG - Intergenic
1162241986 19:9362705-9362727 CTGCAGCCGCAGAGGGAAAGGGG - Intronic
1162448285 19:10737909-10737931 GTGCATCCCGAGAGGGAGATGGG - Intronic
1162641616 19:12014639-12014661 GAGAAGTCACAGAGGGAGAATGG - Intergenic
1162852547 19:13441920-13441942 CTCCAGCCCCACAGGGAAAATGG + Intronic
1163242936 19:16075622-16075644 GGTCAGAACCAGAGGGAGAAAGG + Intronic
1164259119 19:23553904-23553926 GAGGAGCCACAGAGGAAGAAGGG - Intronic
1165386558 19:35513591-35513613 CTGCAGACCCAGAGGGAGGGAGG - Exonic
1165740626 19:38203294-38203316 CTGCAGCTGCAGAGGGAGATGGG - Intronic
1165854527 19:38871482-38871504 TTGTAGTCCCAGAGGGAGGAGGG - Intronic
1166189553 19:41166920-41166942 CTGCAACCACAGAGGGAGCAGGG - Intergenic
1166792618 19:45406833-45406855 GTGCATTCCCAGTGGGCGAACGG + Intronic
1166885965 19:45961051-45961073 GTGCAGCTGCAGAAGGAGACCGG - Exonic
1167161523 19:47770526-47770548 GTGCTGGCCCAGAGAGAGAGAGG + Intergenic
1167622397 19:50567314-50567336 GGGTGACCCCAGAGGGAGAAGGG + Intronic
1167631088 19:50626625-50626647 GGACAGACCCAGAGAGAGAAAGG + Intronic
1202692569 1_KI270712v1_random:101932-101954 GTGCAGCCCCAGTGGGCCCAGGG - Intergenic
926832730 2:16981066-16981088 GTACAGCCCCACAGGGAACATGG + Intergenic
929921258 2:46173130-46173152 GTGCAGCCCTAGAATAAGAATGG + Intronic
929977282 2:46647139-46647161 GTGAAGCCCCAGAGGAGAAATGG + Intergenic
931823035 2:65971724-65971746 GAGAAGCCGCAGAGGAAGAAGGG - Intergenic
931940954 2:67252013-67252035 TTTGAGCCCCTGAGGGAGAAAGG + Intergenic
932413198 2:71559221-71559243 GTGTAGCCCCAGACGCAGCACGG - Intronic
932495779 2:72145082-72145104 GTGCTGCCCCGGCAGGAGAAGGG - Intronic
933636789 2:84717058-84717080 GTGCTGCCCCAGAAGGACTAAGG - Intronic
933980885 2:87549843-87549865 GTGCAGCCTCAGCAGGAGAATGG + Intergenic
934477846 2:94604760-94604782 GGGGTGCCCCAGGGGGAGAATGG + Intergenic
935744545 2:106179101-106179123 ATGGAGCCACAGAGGGAGACTGG - Intronic
936069253 2:109354289-109354311 CTGCAGGCCCAGAGGCTGAAGGG + Intronic
936312945 2:111400942-111400964 GTGCAGCCTCAGCAGGAGAATGG - Intergenic
937156765 2:119725288-119725310 GGCTAGGCCCAGAGGGAGAAGGG + Intergenic
937776335 2:125780873-125780895 GTGCAGCCCAAGAAGGTGCATGG + Intergenic
937832014 2:126434499-126434521 GTGCAGGGCCAGAGGCAGACAGG - Intergenic
937869148 2:126775413-126775435 GTGCTGCACCAGAGGGACGAGGG + Intergenic
938405652 2:131031803-131031825 GTGCAGCCCAAGAGAGTCAAGGG - Intronic
940568903 2:155405178-155405200 TTGCCCCCCCAAAGGGAGAAGGG + Intergenic
941981612 2:171464451-171464473 TTGAAGACACAGAGGGAGAAAGG - Intronic
945688896 2:213007924-213007946 GTGCTGCATCAGAGGGTGAAGGG + Exonic
945736901 2:213611867-213611889 GTGAAGCGCCATAGGGAAAATGG - Intronic
946389112 2:219404911-219404933 GTGGAGCCCCAGAGGAGAAAAGG + Intergenic
946517879 2:220432971-220432993 GAGGAGCCCCAGAGGAAGCAGGG - Intergenic
947241500 2:227999343-227999365 GTGCAGCCAAAGAGGCAGCATGG + Intronic
947784830 2:232807604-232807626 GAGCAGCCCAAGAGGAAGAAGGG - Intronic
947982394 2:234421432-234421454 AAGCATCCCCAGAGGGACAAAGG - Intergenic
948393566 2:237628549-237628571 TTGCGGCCCCAGGGGGACAAAGG + Intronic
948889016 2:240897811-240897833 GGGCCGCTCCCGAGGGAGAAGGG - Intergenic
949031677 2:241800091-241800113 GTGTAGCCCCCGAGGGAAACAGG + Intronic
1168888180 20:1274969-1274991 GTGCAGCCCCAGAGGGAGAAGGG + Intronic
1168889623 20:1286402-1286424 CTGCAGCTGGAGAGGGAGAAGGG + Intronic
1169543693 20:6629415-6629437 GTGCTGCCCAAAATGGAGAAGGG + Intergenic
1170478914 20:16745640-16745662 GTGAAATCCCAGAGGTAGAAGGG + Intergenic
1172461010 20:35118739-35118761 GTGCAGCCACTGAGTGAGGAGGG - Intronic
1172620144 20:36313301-36313323 TGGCAGCCACGGAGGGAGAAAGG - Intronic
1172998421 20:39088320-39088342 TTCCAGCTGCAGAGGGAGAAGGG - Intergenic
1173495079 20:43513047-43513069 CTGAATCCCCAGAGGGAGGAGGG + Intronic
1173583814 20:44166748-44166770 ATGCATCCACAGAGGGAGAGAGG + Intronic
1174386168 20:50189827-50189849 GTGGAGGCCCAGAGAGAGCATGG - Intergenic
1174743475 20:53039173-53039195 GTGTAGACCAAGAAGGAGAAGGG - Intronic
1175237168 20:57522769-57522791 TTGCAGCCCCAGAGGGATATGGG - Intronic
1175838857 20:62014226-62014248 GTGAAGCCACAGGGAGAGAAGGG + Intronic
1175934106 20:62507288-62507310 GTCCAACCCCAGAGGGAGGAGGG - Intergenic
1179026601 21:37683818-37683840 GTGAAGTGGCAGAGGGAGAAAGG + Intronic
1179775581 21:43659773-43659795 GTGAAGACGCAGAGGGAGACAGG + Exonic
1179798297 21:43798428-43798450 GTCCAGCCCCAGAGAGTGATGGG - Intronic
1180060733 21:45383673-45383695 GTGCAGCCCCGGTAGGTGAAGGG - Intergenic
1180084588 21:45502129-45502151 GCCCAGCCCGAGAGGGAGCACGG + Intronic
1180631433 22:17232841-17232863 CTGGAGCCCCAGGGAGAGAAGGG - Intergenic
1180831567 22:18909638-18909660 ACACAGCACCAGAGGGAGAAGGG - Intronic
1181068285 22:20316750-20316772 GCACAGCGCCAGAGGGAGAAGGG + Intronic
1181175386 22:21032133-21032155 GAGCAGCTCCAGGGGGAGCAGGG + Intronic
1181437033 22:22917086-22917108 GTCCAGGCCAAGAGGGAGACAGG + Intergenic
1181437933 22:22921198-22921220 CTTCACCCCCAGAGGGAGAGGGG - Intergenic
1182067327 22:27439828-27439850 CTGCAGCCCCAGAGAGTGGATGG + Intergenic
1182367628 22:29789499-29789521 ATGTGGCCCCAGAGGGAGAAAGG - Intronic
1183068350 22:35379296-35379318 GTGGAGCCGCACAGGGACAAAGG - Intergenic
1183764865 22:39863623-39863645 GTTCATCCCAAGATGGAGAAAGG - Intronic
1184140783 22:42576434-42576456 GTGGCGCCCCAGAGGGAGGGCGG - Intergenic
1184368777 22:44069351-44069373 CTGCGGCCCCAGAGGGATGAGGG + Intronic
1184417327 22:44359880-44359902 ATGCAGCCCCATGGGGAGGATGG - Intergenic
1184955040 22:47880263-47880285 GTGCAGCCTCAGAGGAAGCCCGG + Intergenic
1184999837 22:48238617-48238639 CTGAAGCCTGAGAGGGAGAATGG + Intergenic
1185369520 22:50454611-50454633 CTGAACCCCCAGAGGAAGAACGG - Exonic
1203281651 22_KI270734v1_random:134909-134931 ACACAGCACCAGAGGGAGAAGGG - Intergenic
950024532 3:9811070-9811092 CAGCAGCCAAAGAGGGAGAAAGG - Intronic
950106785 3:10393615-10393637 GGGCAGCCCCAAGGAGAGAAAGG + Intronic
950211162 3:11124591-11124613 GTGCAGCCCTGGTGGGAGAGAGG - Intergenic
950232001 3:11284258-11284280 GTCCAATCCTAGAGGGAGAATGG + Intronic
950293625 3:11808459-11808481 GTGCAGGCCCAGGAGGAGAGTGG + Intronic
950553655 3:13682466-13682488 GGCCTGCCCCACAGGGAGAAGGG + Intergenic
950769670 3:15301513-15301535 GAGAAGCCCCACAGGGAAAAAGG + Intronic
950812048 3:15658399-15658421 ATGCTGCCCCACAGGGACAATGG + Intergenic
952383152 3:32819582-32819604 AAGCAGCCGCAGAGAGAGAAGGG - Intronic
952793844 3:37221690-37221712 GAGCAGGCTCAAAGGGAGAAAGG + Intergenic
953210152 3:40868471-40868493 GGGTAGCTGCAGAGGGAGAATGG - Intergenic
953901046 3:46844601-46844623 CAGCAGCCCCAGAAGGAGCAGGG - Intergenic
955057677 3:55471100-55471122 GTCCAGCCCCAGTGGGATCAGGG + Intronic
955396985 3:58564556-58564578 ATGAAGCCCCAGAGGTAGAAGGG - Intronic
955980800 3:64525362-64525384 GTGCAGGCGCAGAGGGTGGAGGG - Intronic
956523412 3:70130618-70130640 GTGCATCCCAAGAGGGAGTGAGG - Intergenic
957012843 3:75027904-75027926 TTGCAGCCTCATAGGAAGAAGGG - Intergenic
961567043 3:127771282-127771304 GAGCAGGACCAGAGGGAGGATGG - Intronic
962210287 3:133471898-133471920 TTTCAGCAGCAGAGGGAGAAGGG + Intronic
962303971 3:134269638-134269660 GAGAAGCTCCATAGGGAGAAGGG + Intergenic
962369067 3:134805690-134805712 GTGCAGACCCAGAGGCACACGGG - Intronic
963249760 3:143092276-143092298 TGGCAGCTGCAGAGGGAGAAAGG + Intergenic
963940966 3:151096005-151096027 GTACAGGCACAGAAGGAGAATGG + Intronic
967783040 3:193460173-193460195 GTGCGACACCAGAGGGAGAGAGG - Intronic
968646587 4:1744165-1744187 GCTCAGCTCCAGAGGGAGACGGG + Intronic
968660048 4:1795076-1795098 CTGCAGCCGCCGACGGAGAAAGG - Intronic
968871891 4:3246576-3246598 CAGCAGCACCTGAGGGAGAAGGG - Intronic
969431950 4:7160531-7160553 GTGCTGCCCCAGAGGGAGGCTGG + Intergenic
969707390 4:8819227-8819249 CTGTAGCCCAAGAGGGAGAAGGG + Intergenic
969714240 4:8860826-8860848 GTGCAGACCCCGAGGGGTAAGGG + Intronic
970603519 4:17658845-17658867 GAGCAGCACCTGAGGGAGGAGGG - Intronic
971533858 4:27722991-27723013 GTGCACATGCAGAGGGAGAAAGG + Intergenic
973336245 4:48959389-48959411 GAGGAGAGCCAGAGGGAGAAGGG + Intergenic
974241330 4:59252207-59252229 TTACAGACCCAGTGGGAGAATGG - Intergenic
975983382 4:80183532-80183554 CTCCATCCCCGGAGGGAGAATGG + Intergenic
977626785 4:99196491-99196513 CTGCAGCCCCAGAAAGAGAATGG - Intergenic
979006808 4:115309296-115309318 GTACAGGCCCATAGGCAGAAGGG + Intergenic
979962502 4:127037159-127037181 GCTCAGCCCCAGTGGGATAAGGG - Intergenic
982278235 4:153658671-153658693 GTGGAGCCCTTGATGGAGAAGGG + Intergenic
983877328 4:172892840-172892862 GGGCTGCCCCTGAGGGAGGAGGG - Intronic
985893592 5:2735994-2736016 GAGCTGCCCCACAGGGAAAAGGG - Intergenic
986736005 5:10667750-10667772 CTGAGGCCCCAGAGGGAGCATGG - Intergenic
989456304 5:41648235-41648257 GTGATACCGCAGAGGGAGAATGG + Intergenic
990539378 5:56757168-56757190 GGACAGCCCTGGAGGGAGAAGGG - Intergenic
992678218 5:79126990-79127012 GAGGAGCCACAGAGGAAGAAAGG + Intronic
992726167 5:79609351-79609373 CTGCAGCCCCAGAAAGAGAATGG - Intergenic
996270965 5:121603890-121603912 GGGCAGCCACAGAGAGAGAAAGG + Intergenic
997667481 5:135643297-135643319 GTTCAGCCCCAGACTGAGAAGGG - Intergenic
998057600 5:139092223-139092245 GGGGAGGCCTAGAGGGAGAAGGG - Intronic
998394047 5:141806802-141806824 CTGCAGCCCTAGAGGGGAAATGG + Intergenic
998805145 5:145911417-145911439 GCTCTGCCACAGAGGGAGAAGGG + Intergenic
999174917 5:149625424-149625446 GAGATTCCCCAGAGGGAGAATGG + Intronic
999296533 5:150462947-150462969 GAGGAGAACCAGAGGGAGAAGGG + Intergenic
999410446 5:151345581-151345603 GTGGACACCCACAGGGAGAAAGG - Intronic
999721519 5:154402241-154402263 GGGCAGGAGCAGAGGGAGAAAGG - Intronic
1002065730 5:176650804-176650826 GTGCAGTCTCAGAGGGGGAAAGG - Intronic
1002563298 5:180096808-180096830 TTGCAGCCTCAGAGGGAGATGGG - Intergenic
1003092388 6:3114989-3115011 CTACAGCCCAAAAGGGAGAATGG + Exonic
1003242034 6:4353348-4353370 GTGCAACCCCACAGGGAGCCAGG + Intergenic
1003815264 6:9833065-9833087 TCGCAGCCCCAGAGGGAGCATGG + Intronic
1004246511 6:13982642-13982664 GTGCAACCAGAGGGGGAGAATGG + Intergenic
1004469231 6:15914154-15914176 GTGCATACCCAGAAGCAGAATGG - Intergenic
1006580050 6:35071912-35071934 GGGCAGCCCCAGATGGGGAGGGG - Intronic
1011186021 6:84676722-84676744 GTTCAGCCCCAGAGGCTGATGGG + Intergenic
1011186083 6:84676993-84677015 GTTCAGCCCCAGAGGTTGATGGG + Intergenic
1012390290 6:98730272-98730294 CTCCAGACCCAGAGGGAGACAGG - Intergenic
1013051504 6:106540005-106540027 GTGCAGCCTGAGAGAGAGCAGGG + Intronic
1013990819 6:116252566-116252588 ATGAAGGCCCAGAGGAAGAATGG + Exonic
1014618635 6:123637119-123637141 CTTCAGCCCCAAAGAGAGAAAGG + Intergenic
1014806681 6:125838054-125838076 GTGAAGCTTCAGAGGGTGAAGGG - Intronic
1015887084 6:137928539-137928561 GTGCAGCCCCAAAGTGACAGAGG + Intergenic
1016383756 6:143511761-143511783 CTCCCGCCCCAGAGGGGGAAGGG - Intergenic
1016852505 6:148635531-148635553 GTGCTGACCCAGAGGCAGGAAGG + Intergenic
1016863728 6:148746926-148746948 GCGGAGCGCCGGAGGGAGAAAGG + Intergenic
1017488178 6:154921789-154921811 ATGCAGCCCAAGAATGAGAAAGG - Intronic
1017995971 6:159531960-159531982 GAGCAGCAGCAGAAGGAGAAGGG - Intergenic
1018782194 6:167078298-167078320 CTGCATCCTCACAGGGAGAAGGG + Intergenic
1018888676 6:167964658-167964680 GTGTAGCTCTAGAGGGAGTAGGG + Intronic
1018928352 6:168222598-168222620 GGGCAGCCACAGAGGGCGGAAGG + Intergenic
1018996187 6:168712143-168712165 GTGCAGCCTCAGAGATAGCAGGG + Intergenic
1019190940 6:170250261-170250283 GTCCAGGCCCAGAGGCAGGAGGG - Intergenic
1020004400 7:4774704-4774726 GGGAAGCTCCTGAGGGAGAAAGG - Intronic
1021215714 7:17913133-17913155 GGACTGCCCCTGAGGGAGAAGGG + Intronic
1021942308 7:25689744-25689766 GTGCAGCCCCAGGTGCAGGATGG + Intergenic
1022522530 7:31017369-31017391 GTGCAGCCCAGGAGGGAAAATGG + Intergenic
1022942480 7:35253982-35254004 CCCCAGCCCCAGAGGGAGGAAGG - Exonic
1024361564 7:48474127-48474149 GTGAAGCTTCAGAGGGTGAAAGG - Intronic
1025255304 7:57380864-57380886 GTACAGACTTAGAGGGAGAAAGG - Intergenic
1025741292 7:64198491-64198513 GTGCAGCATGAGAGGGAGTATGG - Intronic
1026467089 7:70663439-70663461 GTGGAGCCCCACAGGAAGAAAGG + Intronic
1032472299 7:132187428-132187450 CTGCAGCACCAGAGAGGGAAAGG - Intronic
1034337141 7:150330885-150330907 CTGCTGGCCCAGAGGGAGAAGGG + Exonic
1035312520 7:157978709-157978731 GTGCAGTCCCAGAGGGAAGTGGG - Intronic
1035326298 7:158068119-158068141 GTGCAGTCCCAGGGGAAGAACGG + Intronic
1036492087 8:9237143-9237165 GTGGAGCCCAAGAGGGACATTGG + Intergenic
1037246800 8:16844719-16844741 TTAGAGCCCCAGAGGCAGAAGGG + Intergenic
1037524755 8:19713855-19713877 GGGCAGCCCCAGATGGAGAAGGG + Intronic
1038317940 8:26503375-26503397 GTGCAGCCCCTGGAGGGGAAGGG - Intronic
1042788466 8:72576585-72576607 GTCCTGCTGCAGAGGGAGAAAGG - Intronic
1042943555 8:74132002-74132024 GTACAGCGACAGAGGGAGAGGGG + Intergenic
1044844762 8:96370049-96370071 GTTGAGCCCAAGAAGGAGAATGG + Intergenic
1045065480 8:98440106-98440128 GTCTAGCCCCAAAGGGATAAAGG + Intronic
1045961042 8:107968764-107968786 TTGCAGCCCAAGATGGTGAATGG + Intronic
1047437500 8:124847110-124847132 GTACAGTCCCAGTGGGAGGAAGG + Intergenic
1048006217 8:130421368-130421390 GTGCTGCCACAGATGGTGAATGG - Intronic
1048413414 8:134199461-134199483 GAGGAGCCCCAGAAGGAGATGGG + Intergenic
1048861529 8:138727613-138727635 GGGTGCCCCCAGAGGGAGAAAGG - Intronic
1049400676 8:142425619-142425641 GAGGAGCCCCACTGGGAGAAAGG + Intergenic
1049811958 8:144579632-144579654 GTGCAGGCACAGAGGGAGGCGGG - Intronic
1052386559 9:27830014-27830036 GAGGTGCCCCACAGGGAGAAGGG - Intergenic
1052852110 9:33384796-33384818 GGGGTGCCCCAGGGGGAGAATGG - Intronic
1052939955 9:34125632-34125654 GTACAGACTGAGAGGGAGAAGGG - Intronic
1053526142 9:38832812-38832834 GTGGAGCGCCCGAGGGAGACCGG + Intergenic
1053680213 9:40481347-40481369 GGGGTGCCCCAGGGGGAGAATGG - Intergenic
1053930204 9:43109657-43109679 GGGGTGCCCCAGGGGGAGAATGG - Intergenic
1054198369 9:62057237-62057259 GTGGAGCGCCCGAGGGAGACCGG + Intergenic
1054283499 9:63143588-63143610 GGGGTGCCCCAGGGGGAGAATGG + Intergenic
1054293293 9:63316857-63316879 GGGGTGCCCCAGGGGGAGAATGG - Intergenic
1054391321 9:64621350-64621372 GGGGTGCCCCAGGGGGAGAATGG - Intergenic
1054504408 9:65894977-65894999 GGGGTGCCCCAGGGGGAGAATGG + Exonic
1054639985 9:67531126-67531148 GTGGAGCGCCCGAGGGAGACCGG - Intergenic
1056303491 9:85267104-85267126 ATGCAGTCATAGAGGGAGAAGGG - Intergenic
1057198715 9:93129268-93129290 GTTCAGCCCCTAAGGGACAATGG - Intronic
1058971699 9:110089134-110089156 GTGCAGAGCAATAGGGAGAAAGG + Intronic
1061113569 9:128593093-128593115 GAGAAGCGGCAGAGGGAGAATGG - Intronic
1061544200 9:131294472-131294494 GTGCTGCTCGGGAGGGAGAAGGG - Intronic
1061895109 9:133643108-133643130 CTGCAGCCCCAGTGGGAGGCAGG - Intronic
1062179047 9:135180808-135180830 GTCCAGCCCCACAGTGGGAAGGG - Intergenic
1062276819 9:135735322-135735344 TTGGACCCCCAGAGGGAGCAGGG + Intronic
1062546376 9:137065366-137065388 GGGCAGCCACAGGCGGAGAAAGG + Intronic
1062707965 9:137955622-137955644 GTGCAGCCCCAGAGACAAAAAGG - Intronic
1186257893 X:7742378-7742400 CTGCAGTCCCAGGGGAAGAAGGG + Intergenic
1187332419 X:18353805-18353827 GTGAAGAGCCGGAGGGAGAATGG - Intronic
1190305170 X:49077845-49077867 GTGGAGCCCTTGATGGAGAAGGG - Exonic
1190458490 X:50647374-50647396 GTGCAACACCAGAGGGCTAAGGG + Intronic
1190509522 X:51161798-51161820 GTGAAGACCCTGAGCGAGAATGG + Intergenic
1192173692 X:68873046-68873068 CTGAGGCCCCAGAGGGAGAAAGG - Intergenic
1194903188 X:99540672-99540694 ATGGAGTCCCAGAAGGAGAAAGG + Intergenic
1199045009 X:143159513-143159535 GTGCTTCCCCAAAGGGAGGAAGG - Intergenic
1199575296 X:149307859-149307881 GAGCAGCCCCAGAAGGACTATGG + Intergenic
1199945063 X:152658620-152658642 GAGCAGCCCCAGGGGAAGCATGG + Intergenic
1200005935 X:153084111-153084133 GTGCAGCCCCTGAGGGGACACGG - Intergenic