ID: 1168890750

View in Genome Browser
Species Human (GRCh38)
Location 20:1294191-1294213
Sequence AGTAACAAAGCCGGCCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168890746_1168890750 -7 Left 1168890746 20:1294175-1294197 CCTTGGGCCCAAATGCAGTAACA No data
Right 1168890750 20:1294191-1294213 AGTAACAAAGCCGGCCTTGAAGG No data
1168890742_1168890750 23 Left 1168890742 20:1294145-1294167 CCAGAGCATGTCACACCTGCAGC No data
Right 1168890750 20:1294191-1294213 AGTAACAAAGCCGGCCTTGAAGG No data
1168890741_1168890750 30 Left 1168890741 20:1294138-1294160 CCAGAAGCCAGAGCATGTCACAC No data
Right 1168890750 20:1294191-1294213 AGTAACAAAGCCGGCCTTGAAGG No data
1168890745_1168890750 8 Left 1168890745 20:1294160-1294182 CCTGCAGCTGTGTGACCTTGGGC No data
Right 1168890750 20:1294191-1294213 AGTAACAAAGCCGGCCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168890750 Original CRISPR AGTAACAAAGCCGGCCTTGA AGG Intronic