ID: 1168891987

View in Genome Browser
Species Human (GRCh38)
Location 20:1300709-1300731
Sequence GCTCGTGGCCACCCGCTCAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 61}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168891987_1168892004 28 Left 1168891987 20:1300709-1300731 CCGGTGAGCGGGTGGCCACGAGC 0: 1
1: 0
2: 0
3: 8
4: 61
Right 1168892004 20:1300760-1300782 ACTCAGGGAAACCAGGGCTCTGG 0: 1
1: 0
2: 1
3: 30
4: 289
1168891987_1168891995 12 Left 1168891987 20:1300709-1300731 CCGGTGAGCGGGTGGCCACGAGC 0: 1
1: 0
2: 0
3: 8
4: 61
Right 1168891995 20:1300744-1300766 ACCCCACCAGCTCCACACTCAGG 0: 1
1: 0
2: 2
3: 15
4: 234
1168891987_1168892006 30 Left 1168891987 20:1300709-1300731 CCGGTGAGCGGGTGGCCACGAGC 0: 1
1: 0
2: 0
3: 8
4: 61
Right 1168892006 20:1300762-1300784 TCAGGGAAACCAGGGCTCTGGGG 0: 1
1: 0
2: 3
3: 28
4: 334
1168891987_1168892001 21 Left 1168891987 20:1300709-1300731 CCGGTGAGCGGGTGGCCACGAGC 0: 1
1: 0
2: 0
3: 8
4: 61
Right 1168892001 20:1300753-1300775 GCTCCACACTCAGGGAAACCAGG 0: 1
1: 0
2: 2
3: 15
4: 199
1168891987_1168892005 29 Left 1168891987 20:1300709-1300731 CCGGTGAGCGGGTGGCCACGAGC 0: 1
1: 0
2: 0
3: 8
4: 61
Right 1168892005 20:1300761-1300783 CTCAGGGAAACCAGGGCTCTGGG 0: 1
1: 0
2: 3
3: 35
4: 315
1168891987_1168891997 13 Left 1168891987 20:1300709-1300731 CCGGTGAGCGGGTGGCCACGAGC 0: 1
1: 0
2: 0
3: 8
4: 61
Right 1168891997 20:1300745-1300767 CCCCACCAGCTCCACACTCAGGG 0: 1
1: 0
2: 3
3: 34
4: 260
1168891987_1168892002 22 Left 1168891987 20:1300709-1300731 CCGGTGAGCGGGTGGCCACGAGC 0: 1
1: 0
2: 0
3: 8
4: 61
Right 1168892002 20:1300754-1300776 CTCCACACTCAGGGAAACCAGGG 0: 1
1: 0
2: 2
3: 33
4: 537

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168891987 Original CRISPR GCTCGTGGCCACCCGCTCAC CGG (reversed) Exonic
901766237 1:11501864-11501886 GATCGTGACCAGGCGCTCACTGG - Exonic
903384235 1:22916300-22916322 GCTAGTGGTCACCAGCTCAGCGG - Intergenic
910064281 1:83134709-83134731 GCTTCTGGCCAACAGCTCACAGG + Intergenic
1068810034 10:61244908-61244930 CCTCCTGGCCACTGGCTCACGGG - Intergenic
1071566415 10:86673577-86673599 GCTCATGCTCACCCTCTCACTGG - Intronic
1077233494 11:1469037-1469059 GCACGTGCCCACCCACTCCCAGG + Intergenic
1081614872 11:44584879-44584901 GTTCTTGGCCACCAGCTCTCTGG - Intronic
1083197954 11:61102272-61102294 GCTCTCGGCCACCCCCACACAGG - Intergenic
1084600362 11:70141905-70141927 GGTCGTGGCCACCCGCCCGCCGG + Intronic
1088889984 11:114036563-114036585 GCTCGCGCCCACCCGCGCACAGG - Intergenic
1089528900 11:119113921-119113943 CTTCTTGGCCACCCGCCCACTGG - Exonic
1092506801 12:9109975-9109997 GCTTGAGGCCACCCTCTAACTGG + Exonic
1095225465 12:39672540-39672562 GTTTGTGGCCACCCTGTCACTGG + Intronic
1096611052 12:52801957-52801979 GCTCTGGGCCACCTGCTCTCAGG - Intergenic
1100618402 12:96249358-96249380 GCGCGTCACCACCAGCTCACAGG - Intronic
1110257155 13:73444964-73444986 GCTCTTGGCCTCCCTCTCCCTGG + Intergenic
1115850073 14:37584013-37584035 GCTCCTGGGGACCCGCACACAGG - Intergenic
1121224141 14:92308900-92308922 GCTCGTGGCCAGACGAGCACTGG - Intergenic
1123733729 15:23166021-23166043 CTTGGTGGCCCCCCGCTCACAGG - Intergenic
1124284226 15:28387320-28387342 CTTGGTGGCCCCCCGCTCACAGG - Intronic
1124298471 15:28524294-28524316 CTTGGTGGCCCCCCGCTCACAGG + Intronic
1128109930 15:65069847-65069869 GCTGGTGGCCACCTGGTTACTGG + Intronic
1131564604 15:93474734-93474756 GCTCGTGGCCGCCTGCTGAACGG + Intergenic
1132840655 16:1977089-1977111 GCTGCTGGCCACAGGCTCACAGG + Exonic
1133296078 16:4752944-4752966 GGGCCTGGCCACCCGCTCCCAGG - Exonic
1136702818 16:32158782-32158804 GCACGTGGCCATCAGCTCACAGG + Intergenic
1136764881 16:32768814-32768836 GCACGTGGCCATCAGCTCACAGG - Intergenic
1136803218 16:33101570-33101592 GCACGTGGCCATCAGCTCACAGG + Intergenic
1139679885 16:68553317-68553339 GCCCGTGGCTCCCCACTCACTGG - Intronic
1203067238 16_KI270728v1_random:1030939-1030961 GCACGTGGCCATCAGCTCACAGG - Intergenic
1148051329 17:44771472-44771494 GATTGTGGCCACCTGCACACAGG + Intronic
1152072452 17:78140666-78140688 GCTCGAGGCCACACCCTCCCAGG - Intronic
1152706170 17:81844730-81844752 GCTGCTGGCCACGCGCTGACGGG + Intronic
1155972095 18:32092424-32092446 GCTCTAGGCCACGCCCTCACCGG - Intronic
1160765039 19:803833-803855 GCTCCTGACAACCCGCCCACAGG - Intronic
1160843249 19:1155737-1155759 GTTTGTGGCCACCAGCACACGGG - Intronic
1160895998 19:1402208-1402230 CCTCGTGGCCACCAGACCACCGG - Intergenic
1160902001 19:1433417-1433439 GCCCGTGGCCACCTGCAGACAGG - Intronic
1163128214 19:15255905-15255927 GCTGGTGGCCACTTGCACACAGG - Intronic
1163598328 19:18233236-18233258 GCTCCTCGGCGCCCGCTCACGGG - Exonic
925119697 2:1408595-1408617 GCACGTGCCCACCCACTCACAGG - Intronic
927147950 2:20179293-20179315 GCTCATGGCCACCAGATGACGGG - Intergenic
928683472 2:33726412-33726434 GCTTGAAGCCTCCCGCTCACTGG + Intergenic
943369848 2:187002744-187002766 GATCATGGCCACCAGCTCATCGG + Intergenic
1168891987 20:1300709-1300731 GCTCGTGGCCACCCGCTCACCGG - Exonic
1168911332 20:1449580-1449602 GCAGATGGCCAGCCGCTCACTGG - Intronic
1172633111 20:36392124-36392146 GCTCCTGCCCCCCAGCTCACTGG - Intronic
1174541877 20:51296204-51296226 GCAGATGGCCACCCGCACACAGG - Intergenic
1180101600 21:45590344-45590366 GCGCGCGGCCGCCCGCTCCCAGG + Intergenic
1180974631 22:19841243-19841265 GCTCTTGGCCACAGTCTCACAGG + Intronic
1181441144 22:22935763-22935785 GCTCATGGCCACCCGGGCATGGG + Intergenic
1183365507 22:37404582-37404604 GCGTGTGGCCACCTGCTGACTGG - Intronic
961746300 3:129065449-129065471 TCTGCTGGCCACCTGCTCACTGG + Intergenic
964476146 3:157099772-157099794 GCTGGTGGCCACCCTAACACAGG + Intergenic
969289429 4:6229275-6229297 GCTCTTGGCCACATGCTCAGGGG - Intergenic
985026207 4:185741876-185741898 GCTCGTGGCCTCCCGCCCCACGG + Intronic
1010507813 6:76681953-76681975 GTTCTTGGCCACCTTCTCACTGG - Intergenic
1013524070 6:110958588-110958610 GCCCGTAGCCACCCGCCCGCCGG + Exonic
1013793857 6:113862525-113862547 GCTCTTTGCCACCCGATAACTGG + Exonic
1017034624 6:150256048-150256070 GCCCATCCCCACCCGCTCACAGG + Intergenic
1019504699 7:1385167-1385189 TCTCTTGGCCACCAGCTCCCTGG + Intergenic
1023999027 7:45178857-45178879 GCTCTTGCCCACTCACTCACTGG - Intronic
1027279827 7:76600033-76600055 GCTTCTGGCCAACAGCTCACAGG - Intergenic
1029599999 7:101557957-101557979 TCTCTTGGCCACCAGATCACGGG + Exonic
1049227900 8:141466435-141466457 GAAGGTGGCCACCAGCTCACAGG + Intergenic
1060207760 9:121692675-121692697 CCTGGTGGCCACCTACTCACAGG - Intronic
1061303728 9:129720931-129720953 GCTCGTGAACACCCACTCACAGG - Intronic
1061509352 9:131050985-131051007 GCATGTGGCCACCAGCTCCCGGG + Intronic
1062331098 9:136045284-136045306 GCACAGGGCCACCCACTCACGGG + Intronic
1062367481 9:136218166-136218188 GCTCCTGGCGACCCCCTCAGTGG + Intronic