ID: 1168894534

View in Genome Browser
Species Human (GRCh38)
Location 20:1314116-1314138
Sequence GTGTGTTAATTTTGTATCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168894534 Original CRISPR GTGTGTTAATTTTGTATCCC AGG (reversed) Intronic
900076074 1:818837-818859 GTCTTCTAATTTTGCATCCCTGG + Intergenic
900551490 1:3258655-3258677 ATGTGATAATTTTCCATCCCAGG - Intronic
903522693 1:23964096-23964118 GGGTGTTCATTTTGTTTCCAGGG + Intergenic
905587874 1:39135634-39135656 GTGTGTTGACTTTGTCTCTCTGG + Intronic
906746504 1:48225583-48225605 GTGTGTGAGTTTTGCATGCCTGG - Intronic
907473063 1:54686737-54686759 TTGTATTAAGTTTGTATCCAAGG + Intronic
908385292 1:63635562-63635584 GTGTCTTAGGTTTATATCCCTGG + Intronic
908646023 1:66278895-66278917 GTTTGTTACTTGTATATCCCAGG + Intronic
908648934 1:66311030-66311052 CTTAGTTAATTTTGTATCCATGG + Intronic
909054984 1:70810264-70810286 GTGTGTTAATTATGTATTACTGG - Intergenic
910724144 1:90321025-90321047 GTGTCTTAAGTTGGTTTCCCTGG + Intergenic
912131954 1:106614237-106614259 GTGTATTAGTTTTGTATTGCTGG - Intergenic
918386668 1:184014993-184015015 CTGTGTTAATTTTGTCACACAGG - Intronic
919704730 1:200665576-200665598 GTGTGTCAGTTTTGTCTCCTTGG - Intronic
920513869 1:206569832-206569854 TTGTGTTCATTTTGCATCCCAGG + Intronic
922373993 1:224942342-224942364 GTGCATTGATTTTGTATCCTGGG + Intronic
1064501450 10:15977766-15977788 GAGTGTTAATAATGTATCACGGG - Intergenic
1065002902 10:21353266-21353288 GTGTGCTTATGATGTATCCCAGG + Intergenic
1065283165 10:24161469-24161491 GTGTGTTAATAGTGTATTTCAGG - Intronic
1068278038 10:54828507-54828529 GTGTGTATATTTTTTCTCCCAGG + Intronic
1070266999 10:74913126-74913148 GTGTGGTTATTTTGTATGACAGG + Intronic
1070687279 10:78496348-78496370 GTTTGTTCATTTTGTAGCCTGGG - Intergenic
1071233573 10:83617926-83617948 GTGTTTTCATTTTGTGTCCAGGG - Intergenic
1074152716 10:110771809-110771831 GTGTGTACATTTTCTATCACTGG + Intronic
1075148605 10:119905779-119905801 GTATGTTAATTTTATATACACGG - Intronic
1075841677 10:125509903-125509925 GTGTCTTAATTTTTAAGCCCCGG - Intergenic
1079151532 11:17904141-17904163 CTGTGTTGATTTTGTATCAGAGG + Intronic
1080546581 11:33325041-33325063 GAGTGTAACTTTTGTATCTCAGG + Intronic
1080670358 11:34370924-34370946 TTCATTTAATTTTGTATCCCTGG + Intergenic
1082802489 11:57425212-57425234 TTTTGCTAATTTTGTAACCCTGG + Intronic
1085369528 11:75987375-75987397 GTATGTTAATTTTATATCCAAGG + Intronic
1087313669 11:96580275-96580297 GTGTTTTATTTTTATTTCCCTGG + Intergenic
1087865909 11:103226530-103226552 GTATGTTAAACTTGCATCCCTGG + Intronic
1088933536 11:114376495-114376517 GTGTGTTTATTTTTTCTCCTTGG - Intergenic
1099808984 12:87556675-87556697 ATGTGTAGTTTTTGTATCCCTGG - Intergenic
1101423460 12:104568105-104568127 GTGTGTTGTTTTTCTATGCCAGG + Intronic
1106490558 13:30217545-30217567 GTGTGTTAATTTTGTGATACAGG - Intronic
1106803756 13:33284920-33284942 ATGTGTTAATATTGTTTTCCTGG - Intronic
1107837760 13:44425541-44425563 GTGTTTTCATTTTGTACCCATGG + Intergenic
1110672224 13:78194299-78194321 GTGTATTAATTTTGAGACCCTGG + Intergenic
1111623810 13:90757450-90757472 GTGTGTGTATTTTGTTTCTCCGG + Intergenic
1113559762 13:111269268-111269290 AAGTGTTAAATTTGTATCTCTGG + Intronic
1114200252 14:20513373-20513395 GTGAGTTAATTTTCTGCCCCTGG - Intergenic
1116905317 14:50397650-50397672 CTGTGTTAATTTTCTCTCCTCGG - Intronic
1120296764 14:82651505-82651527 ATGTGTTATTTTGGAATCCCTGG + Intergenic
1125120980 15:36158503-36158525 GTCTTTTTATTTTGTATCACAGG + Intergenic
1127358053 15:58220584-58220606 TTGAGTCAATCTTGTATCCCGGG + Intronic
1127413758 15:58735706-58735728 GTCTGTGAATTTTGTATTCATGG - Intronic
1129311108 15:74709961-74709983 CTGTGTTAATTTGGTTTCCCTGG - Intergenic
1130805303 15:87314551-87314573 GAGTGTTCACTTTATATCCCAGG + Intergenic
1133909029 16:10048126-10048148 ATGTATTAATTTTGTAGCCATGG + Intronic
1134222973 16:12369728-12369750 ATGTGGTTATTATGTATCCCTGG - Intronic
1134475758 16:14572191-14572213 GTGTGTCAAGCTTGTCTCCCTGG - Intronic
1136043879 16:27600753-27600775 GAGTTTTAATCTTGTTTCCCAGG + Intronic
1137701625 16:50501957-50501979 GTGGGTGAGTTTTGCATCCCTGG + Intergenic
1139159833 16:64491161-64491183 GAGTTTTAATTATGTAGCCCAGG - Intergenic
1141570782 16:84932480-84932502 ATGTGTTAATTGTCTATCTCCGG - Intergenic
1142486738 17:252308-252330 TTGTGCTAATTTTGTATGCTAGG - Intronic
1143394490 17:6581419-6581441 GTCAGTTAATTTTGCATCACTGG + Intronic
1148742574 17:49901311-49901333 GTGAGGGAATTTTGTCTCCCAGG + Intergenic
1149744511 17:59082532-59082554 TTTTGTTAATTTTGTATCCTGGG - Intronic
1150704450 17:67474607-67474629 GTGTGTTAATTTTAGATCTGTGG - Intronic
1152332213 17:79679826-79679848 GTGTGTTCATTCTGAAGCCCAGG + Intergenic
1153082440 18:1243482-1243504 CTGTGTTAATTTCCTATGCCTGG - Intergenic
1155566340 18:27138801-27138823 GTTTGTTAGCTTTGTAACCCTGG - Intronic
1156859234 18:41817068-41817090 GTGAGTTAATTTTTCCTCCCAGG - Intergenic
1157352571 18:46902067-46902089 GTGTGTTGATTTTATATCCTGGG - Intronic
1163174882 19:15557271-15557293 GTGTCTTAATTTGGGTTCCCTGG - Intergenic
1163193229 19:15695679-15695701 GTTTGTTAATTTTTTACCGCTGG + Intronic
1163259325 19:16178302-16178324 GGGTGTAAATTTTCTATGCCAGG - Intergenic
1164760302 19:30723463-30723485 GTGTGTTTATTTTCTATGTCTGG - Intergenic
1167120441 19:47513609-47513631 ATGTGTTAGTTCTGTCTCCCAGG + Intronic
925674755 2:6350285-6350307 GTGCGTGACTTTTGTTTCCCTGG - Intergenic
927438518 2:23091059-23091081 GTGGGTTCATTTTGTATACCTGG + Intergenic
928190063 2:29156332-29156354 GTGTTTTATTTTTGTGTCCAAGG + Exonic
928534867 2:32230347-32230369 GTTTGTTTGTTTTGTCTCCCAGG + Intronic
933121155 2:78540167-78540189 GTGTGTTCTTTTTGTCTTCCAGG - Intergenic
933486924 2:82935769-82935791 GTGGGCTAATTTTGCTTCCCAGG + Intergenic
934475413 2:94590132-94590154 GGGTTTTGACTTTGTATCCCTGG + Intronic
935470188 2:103450163-103450185 GGGGGCTAATTTTGTTTCCCAGG + Intergenic
935599580 2:104909383-104909405 GAGTCTTCCTTTTGTATCCCAGG - Intergenic
935600029 2:104913267-104913289 GAGTCTTCCTTTTGTATCCCAGG + Intergenic
936534215 2:113299133-113299155 TTGTGTTAATTCTGTTTCTCTGG + Intergenic
939350872 2:141036286-141036308 ATGTGATAATTTAGAATCCCTGG + Intronic
939612481 2:144327855-144327877 GTGGTTTATTTTTGTATTCCAGG - Intronic
939693937 2:145300350-145300372 GTGTGTGAATTTTTTTTCCAAGG + Intergenic
942006383 2:171704192-171704214 CAGTGTTAATTTTATATCCTTGG + Intronic
943088119 2:183339421-183339443 TTGTGTTAATTTTGAATAACTGG + Intergenic
944039849 2:195340613-195340635 GTGTGTTAATTTTATTTCATGGG - Intergenic
944870568 2:203907442-203907464 GTGTGTTAGTTAGGGATCCCTGG - Intergenic
1168894534 20:1314116-1314138 GTGTGTTAATTTTGTATCCCAGG - Intronic
1169548690 20:6678980-6679002 GTGGGTTCATTTTATTTCCCTGG - Intergenic
1169824179 20:9747989-9748011 GTGCATTGATTTTGTATCCTGGG - Intronic
1173017502 20:39238876-39238898 GTGTGTTTATTTTGGACCACTGG + Intergenic
1174878619 20:54252499-54252521 TGGTGTTGATTTTGTACCCCAGG + Intergenic
1175970029 20:62681081-62681103 TTGTGTAAATTTTGTTGCCCAGG + Intronic
1176333967 21:5578327-5578349 TTGTGTTAAAATTGTAACCCCGG + Intergenic
1176393790 21:6242625-6242647 TTGTGTTAAAATTGTAACCCCGG - Intergenic
1176467629 21:7073549-7073571 TTGTGTTAAAATTGTAACCCCGG + Intronic
1176491190 21:7455327-7455349 TTGTGTTAAAATTGTAACCCCGG + Intergenic
1176509452 21:7683056-7683078 TTGTGTTAAAATTGTAACCCCGG - Intergenic
1176524546 21:7856103-7856125 GAGTTTTAGTTTTGTTTCCCAGG + Intergenic
1177346482 21:19879214-19879236 GTATTTTAATTTTGTATGACAGG + Intergenic
1178658566 21:34486116-34486138 GAGTTTTAGTTTTGTTTCCCAGG + Intergenic
1178793658 21:35723328-35723350 GTGTGTTATTTTTCAATCCAAGG + Intronic
1179467217 21:41583870-41583892 AAGTGTTAATTTTGTATCTCTGG + Intergenic
1179982164 21:44901239-44901261 GTGAGTTAAATTTGTGACCCTGG - Intronic
951921552 3:27860147-27860169 GTGTGTTAATTTTGGAGCCATGG - Intergenic
954283070 3:49598409-49598431 TTGTTTTAATTTTTTATCCTAGG + Intronic
957850680 3:85803456-85803478 GTTTCTTCATTTTGTCTCCCTGG - Intronic
958062240 3:88498249-88498271 GTGTGTTAGTGTTGTATTACAGG + Intergenic
959297535 3:104556078-104556100 GTGTGTAAATTCTGGATCCTAGG - Intergenic
961529969 3:127534362-127534384 GTGTGGTCATCTTGTCTCCCTGG - Intergenic
963955821 3:151252481-151252503 GTGTCTTAATTTTGCATCTTTGG + Intronic
964256703 3:154782714-154782736 GTGTGGCAATTTTGTATTCTAGG - Intergenic
967903810 3:194485399-194485421 ATGTATTAATTTTGTTTCACTGG - Intronic
968444236 4:641364-641386 GTATGTTAACTTTGTATCCTGGG + Intronic
968561936 4:1288516-1288538 TTGGGTTAATCTTGAATCCCTGG + Intergenic
968879468 4:3291927-3291949 GTGTGATTAGTTTGGATCCCAGG - Intergenic
972039828 4:34579138-34579160 GAGTGTTAAGTATGAATCCCAGG - Intergenic
973827221 4:54720325-54720347 TTTTGTTAAGTTTCTATCCCAGG - Intronic
974169480 4:58247266-58247288 ATTTGTTAATTTAGTACCCCTGG - Intergenic
974535217 4:63165887-63165909 GTATGTTGATTTTGTATCCTCGG + Intergenic
980004311 4:127523936-127523958 ATGGGTTAATAGTGTATCCCAGG + Intergenic
980209609 4:129770181-129770203 ATCTGTTAATTATATATCCCTGG - Intergenic
983823294 4:172224787-172224809 GTGTTTTAATTTTTTACCTCTGG + Intronic
983873314 4:172847385-172847407 GTGTCTTAACTTTGTCTACCTGG - Intronic
984466608 4:180107525-180107547 GGGTAATGATTTTGTATCCCAGG + Intergenic
984993513 4:185405030-185405052 GTGTCTCACTTTTGTAACCCAGG + Intronic
986501765 5:8408386-8408408 GTGTGTTAATTTTAAATCCTTGG - Intergenic
986725120 5:10589868-10589890 GTGTGTGAATTTGGTGTCACAGG - Intronic
988914496 5:35878784-35878806 GAGCCATAATTTTGTATCCCTGG + Exonic
992151705 5:73910353-73910375 GTGTTTTACTTTTGTCACCCAGG - Intronic
993419040 5:87676804-87676826 GTGTGTTAAGGTTGTCTCTCTGG - Intergenic
993797434 5:92284672-92284694 GTATCTTGATTTTGTATCCTGGG - Intergenic
999014187 5:148080770-148080792 GTTTATTAATTTTGTATTCATGG - Intronic
1003120028 6:3311859-3311881 GTGTGCCAATTTTGTAGCCCTGG + Intronic
1009015951 6:57901878-57901900 GTGTATTATTTTTGTATTGCTGG - Intergenic
1011351337 6:86427077-86427099 GCATGTTAATTCTGTATCCCTGG + Intergenic
1012759003 6:103273006-103273028 GTGTGTTAATTTTATCTCACTGG + Intergenic
1013349383 6:109291696-109291718 CTGTCTTCATTTTGTATCCAAGG + Intergenic
1014136887 6:117899482-117899504 TTGTGTTATTTTTGTTTACCTGG - Intergenic
1017212044 6:151867860-151867882 GTGTGTTAATCTTGTACTACAGG + Intronic
1017776158 6:157682199-157682221 GAGTCTTACTTTTGTCTCCCAGG - Intergenic
1019885954 7:3905307-3905329 GTGCATTATTTTTGTATCACTGG + Intronic
1020975233 7:14998279-14998301 GAGTGTTAATTTTGAAGCCTTGG + Intergenic
1021583821 7:22186586-22186608 TTGTGTCTATTTTGTATCCCTGG + Intronic
1023067845 7:36396735-36396757 GTGTGTAGTTTTTTTATCCCAGG + Intronic
1023122428 7:36923331-36923353 GTGTGTCAATGTTATATCTCAGG + Intronic
1024833471 7:53488715-53488737 GTGCATTGATTTTGTAACCCAGG + Intergenic
1025162217 7:56671348-56671370 TTGTTTTTTTTTTGTATCCCAGG + Intergenic
1028402741 7:90442051-90442073 GTGTGTTAGTTTTATATGACTGG + Intronic
1028892134 7:96000205-96000227 GTGCTTTCATTTTGAATCCCAGG - Intronic
1028973713 7:96889097-96889119 TTGTTTTAGTTTTGTATCACTGG - Intergenic
1030231997 7:107218010-107218032 TTGTCTTAATTTTGTATCCTGGG - Intronic
1030746727 7:113174587-113174609 GTGTGTTGGTTCTGTTTCCCTGG - Intergenic
1031126509 7:117779521-117779543 ATGAATTAATTTTGTATCACAGG - Intronic
1031918325 7:127583570-127583592 GTGTGTTACTGTTGTTTCTCAGG + Intronic
1032484622 7:132276119-132276141 CTGTGTTTATTGTCTATCCCTGG + Intronic
1035300325 7:157893209-157893231 GTTTGGTAATTTTCTGTCCCAGG + Intronic
1035888413 8:3318428-3318450 GTCAGTTAATTTTGTATCTTCGG - Intronic
1036969333 8:13336852-13336874 ATGTGTTAATTTTGTTTCCCTGG - Intronic
1037109083 8:15144328-15144350 CTGTGTTATTTTTGTACCTCAGG + Intronic
1037668350 8:20992567-20992589 GTGTGTTTATCTTGTATTCTAGG - Intergenic
1039750981 8:40478589-40478611 GTGTGTCAGTTTTGTGTTCCAGG + Intergenic
1040449682 8:47532094-47532116 GTTTGGTTATTTTGTTTCCCAGG + Intronic
1041320995 8:56612368-56612390 GTGTGTGATTGTTGAATCCCAGG - Intergenic
1047293113 8:123547091-123547113 GTGTGTTATTTTTGGGTCTCTGG + Intergenic
1052129685 9:24828028-24828050 TTGAGTTAATTTTGTATATCAGG - Intergenic
1052854633 9:33399649-33399671 GGGTTTTGACTTTGTATCCCTGG - Intronic
1053682654 9:40495930-40495952 GGGTTTTGACTTTGTATCCCTGG - Intergenic
1053932636 9:43124271-43124293 GGGTTTTGACTTTGTATCCCTGG - Intergenic
1054281060 9:63128999-63129021 GGGTTTTGACTTTGTATCCCTGG + Intergenic
1054295753 9:63331444-63331466 GGGTTTTGACTTTGTATCCCTGG - Intergenic
1054393772 9:64635939-64635961 GGGTTTTGACTTTGTATCCCTGG - Intergenic
1054428420 9:65141152-65141174 GGGTTTTGACTTTGTATCCCTGG - Intergenic
1054501960 9:65880393-65880415 GGGTTTTGACTTTGTATCCCTGG + Intronic
1055531379 9:77187760-77187782 GTGGGTTAATTGTGTGTCACTGG + Intronic
1058652157 9:107186140-107186162 TTGCATTAATTTTGTATCCTGGG - Intergenic
1060205667 9:121681402-121681424 GTGTCTTCATTCTGTCTCCCAGG + Intronic
1203427730 Un_GL000195v1:56892-56914 TTGTGTTAAAATTGTAACCCCGG - Intergenic
1188456791 X:30375662-30375684 GTCTTTTAATTTTTTATCACGGG - Intergenic
1188608349 X:32062611-32062633 ATGTGTTACTTTTGTATATCGGG + Intronic
1189866207 X:45330087-45330109 GTGTGTTGATTTTGAATCCTGGG + Intergenic
1192635904 X:72817237-72817259 GTATGTTGATTTTGTATCCTGGG + Intronic
1192645810 X:72903566-72903588 GTATGTTGATTTTGTATCCTGGG - Intronic
1193972634 X:88074809-88074831 TTATGTTAATTTTATATCCAGGG - Intergenic
1194238309 X:91412114-91412136 GTATATTGATTTTGTATCCTGGG - Intergenic
1194681371 X:96858171-96858193 CTTTTTTAATTTTGTATTCCAGG + Intronic
1196550033 X:117013439-117013461 GTACATTGATTTTGTATCCCAGG - Intergenic
1197370273 X:125618005-125618027 TTGAATTAATTTTGCATCCCAGG + Intergenic