ID: 1168894948

View in Genome Browser
Species Human (GRCh38)
Location 20:1317971-1317993
Sequence ATGGATAAACAGAGCCGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168894948_1168894956 18 Left 1168894948 20:1317971-1317993 CCCTCTCGGCTCTGTTTATCCAT 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1168894956 20:1318012-1318034 GATGTCCCCAGGTTCACGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 64
1168894948_1168894955 17 Left 1168894948 20:1317971-1317993 CCCTCTCGGCTCTGTTTATCCAT 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1168894955 20:1318011-1318033 TGATGTCCCCAGGTTCACGCTGG 0: 1
1: 0
2: 1
3: 11
4: 96
1168894948_1168894952 7 Left 1168894948 20:1317971-1317993 CCCTCTCGGCTCTGTTTATCCAT 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1168894952 20:1318001-1318023 GCCCTGCTTTTGATGTCCCCAGG 0: 1
1: 0
2: 0
3: 9
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168894948 Original CRISPR ATGGATAAACAGAGCCGAGA GGG (reversed) Intronic
903787692 1:25872297-25872319 TTGGAGAAACAGGGCCAAGAGGG - Intergenic
906888371 1:49678003-49678025 TTGGATAAACAGTGCAGAGCTGG + Intronic
913406587 1:118500350-118500372 ATGGATAAACAAAACTGTGATGG + Intergenic
915405940 1:155659838-155659860 GTCGATAAACAGTGCCAAGAAGG - Exonic
919166071 1:193894984-193895006 ATGCAAAAACAGAGAGGAGAAGG - Intergenic
920194759 1:204219554-204219576 CTGAATGAACAGAGCCCAGATGG - Exonic
921877682 1:220217421-220217443 ATGGAAAAACAGAAAGGAGAGGG - Intronic
1063026039 10:2179669-2179691 ATAGATAGATAGAGCAGAGATGG - Intergenic
1066215595 10:33283831-33283853 ATGGTTAAACTTAGCTGAGATGG - Intronic
1072673026 10:97445692-97445714 AGGGAAAAACAGAGGGGAGATGG + Intronic
1079080533 11:17410624-17410646 ATGGATATCCAGAGCTGAGAAGG + Exonic
1083170198 11:60919614-60919636 TGGGATAATCAGAGCTGAGAGGG + Intronic
1084323104 11:68384461-68384483 AAGGATGCACAGAGCCAAGAAGG - Intronic
1084377053 11:68784686-68784708 AGAGAAAAACAGAGCCGAGGTGG + Intronic
1085018707 11:73191778-73191800 AGGAAGAAACAGAGCCCAGAGGG + Intergenic
1086110400 11:83192915-83192937 GTGGAAAAACTGGGCCGAGAGGG + Intergenic
1089096470 11:115923771-115923793 ATGGATAAAGAGTGGCCAGAAGG + Intergenic
1094445759 12:30528223-30528245 ATGTAAAAACACAGCAGAGATGG - Intergenic
1096010845 12:48213063-48213085 AAGGAGAAACAGAGCAGAGGGGG - Intergenic
1096077611 12:48815029-48815051 CTGGAGACACAGAGCCGAGCCGG + Intronic
1096388101 12:51208495-51208517 ATGGTGAAACAAAGCCCAGAGGG + Intronic
1097977177 12:65699033-65699055 ATGGAAAAACAGAACAGAAATGG - Intergenic
1099383567 12:81985810-81985832 AGGGATACATAGAGCAGAGAGGG + Intergenic
1102698120 12:114815677-114815699 ATGGAAAAACAGAGCTAAGAAGG - Intergenic
1103420457 12:120777412-120777434 ATGTATAAACAGAGCATATAGGG - Intronic
1105234893 13:18541187-18541209 ATGGATAAAGGGAGGCAAGAGGG - Intergenic
1105603100 13:21904459-21904481 ATGGAGAAACAGAGTCCTGAAGG - Intergenic
1105807635 13:23965634-23965656 ATGGAGAAACACCGCCTAGAAGG + Intergenic
1105852664 13:24349595-24349617 ATGAATGAACACAGCAGAGAAGG - Intergenic
1109815578 13:67578604-67578626 ATGGAAAAACAAAGCCTGGATGG - Intergenic
1110094696 13:71502480-71502502 ATGGTTAAACAGCTCCGACAAGG - Intronic
1117026497 14:51625722-51625744 TTGGATAAGCAGAGAAGAGAGGG - Intronic
1117201751 14:53397092-53397114 ATGGAACAACAAAGCCTAGATGG + Intergenic
1120555383 14:85923799-85923821 ATGGAAAAACAGAGCTGAAGAGG + Intergenic
1127411860 15:58716727-58716749 ATTGATAAACAGAGCAGAAGCGG + Intronic
1129047187 15:72746123-72746145 AAGGATGAACAGAGCACAGAGGG + Intergenic
1129826246 15:78636982-78637004 AAGAAGAAACAGAGCTGAGATGG + Intronic
1129885838 15:79036420-79036442 GTGGAGAAACAGAGGCGGGAGGG - Intronic
1130768987 15:86905315-86905337 ATTGATGAACAGAGCCTACAGGG - Intronic
1132516375 16:367984-368006 ATGGATAAACAGAGGGAATAGGG + Intronic
1133537993 16:6720582-6720604 ATGGAGAAACAGAAGTGAGAGGG + Intronic
1134039690 16:11059119-11059141 AGGAAGAAACAGAGCTGAGAGGG - Intronic
1134749520 16:16614815-16614837 AAGGATAAACAAAGCAGAGAAGG + Intergenic
1134995950 16:18738809-18738831 AAGGATAAACAAAGCAGAGAAGG - Intergenic
1137845000 16:51678370-51678392 ATGGATAATCAGAGGCAGGAGGG - Intergenic
1140626117 16:76796263-76796285 GTAGCTAAACAAAGCCGAGAAGG - Intergenic
1147447000 17:40480564-40480586 ATGCAGAAACAAAGCTGAGATGG + Intronic
1153779855 18:8484953-8484975 ACAGATTAACAGAGCCGAAAGGG + Intergenic
1156848161 18:41693751-41693773 ATGGATAAAAAGAGCAGAGGTGG - Intergenic
1157751011 18:50178465-50178487 ATGCATAAACATAGCCCAGCAGG + Intronic
1159029229 18:63213986-63214008 AGGGATGAACAGAGCTAAGATGG + Intronic
1159593885 18:70363858-70363880 ATGGATCTACAGAACCAAGAGGG - Intergenic
1161938076 19:7384374-7384396 ATGGGCAAACAGATCCTAGATGG + Intronic
1164515985 19:28935879-28935901 ATTTATTAAAAGAGCCGAGAGGG + Intergenic
1164720312 19:30427114-30427136 ATAGGTAAACAGAGGCCAGATGG - Intronic
1165641152 19:37388112-37388134 AAGAATAAAGAGAGCTGAGAAGG - Intronic
928120331 2:28579328-28579350 ATGGAGGAACAGAGCTCAGAGGG + Intronic
929787776 2:45004538-45004560 AGGGAGAAACAGAGCAGAGGCGG + Intergenic
931016226 2:57983226-57983248 ATGGAAAGAGAGAGCCAAGATGG - Intronic
931024290 2:58091750-58091772 ATGAATAAACAGAACAGAGAAGG + Intronic
932476273 2:72008298-72008320 CTGGATGAACACAGGCGAGAGGG + Intergenic
936409683 2:112246078-112246100 ATGGAGCAACAGAGCCCAGATGG + Intronic
941577022 2:167245773-167245795 ATGGATGAACTGAGAGGAGAAGG + Exonic
945912901 2:215669649-215669671 ATGGATGATCAGAACTGAGAAGG - Intergenic
948506476 2:238430925-238430947 ATGGATCAACAAAGCCCAGGTGG - Intronic
1168894948 20:1317971-1317993 ATGGATAAACAGAGCCGAGAGGG - Intronic
1170389340 20:15854762-15854784 AGGGATAAACAGAGCAGCAAAGG - Intronic
1170979946 20:21202750-21202772 ATGGATAAACAAATATGAGAGGG - Intronic
1175392703 20:58637136-58637158 ATGGAGAGGCAGAGCCAAGATGG - Intergenic
1175511581 20:59531344-59531366 ATGAATAGACAGAGCACAGAGGG + Intergenic
1176778885 21:13169465-13169487 ATGGATAAAGGGAGGCAAGAGGG - Intergenic
1177686216 21:24440368-24440390 CTGGATCAACAGAGACCAGATGG + Intergenic
1180721270 22:17910552-17910574 ATGGATGAACAGAGGCAGGATGG + Intronic
1181090488 22:20469212-20469234 ATGGAAACACAGAACAGAGATGG + Intronic
1181803545 22:25361962-25361984 AAGGATGCACAGAGCCAAGAAGG + Exonic
949372932 3:3354703-3354725 AAGGCTACACAGAGCCGTGAGGG + Intergenic
950312446 3:11970307-11970329 ATGGAGAAGCTGAGCCCAGAGGG + Intergenic
951067675 3:18286404-18286426 AAGGGTAAACAGAGCATAGAAGG + Intronic
951436630 3:22672786-22672808 ATGAATAGACAGAGCACAGAGGG + Intergenic
953370922 3:42387825-42387847 ATGGAAAAAGAGGGCCGAGCTGG - Intergenic
953457829 3:43056571-43056593 ATAAATAGCCAGAGCCGAGAAGG - Exonic
953747287 3:45584984-45585006 TTGGAAAAACAGAGAAGAGAGGG - Intronic
954042668 3:47901169-47901191 ATGGAAATACAGAGCAGAAAGGG - Intronic
956502387 3:69900456-69900478 TTGGTTAAACAGGGCCAAGAAGG - Intronic
957233315 3:77549870-77549892 ATGGAGAAACAGATCCCAGAGGG + Intronic
957632858 3:82740560-82740582 ATGGAGAAGCAGAGAGGAGAGGG + Intergenic
959403963 3:105938085-105938107 ATGGATATACAGAGACAAAATGG - Intergenic
962193260 3:133333331-133333353 ATGGATAAGCAGAGTAAAGAAGG - Intronic
967366151 3:188688437-188688459 ATGGGCAAACAAAGCCAAGAAGG - Intronic
967430246 3:189375668-189375690 ATGAATAGACAGAGCAAAGAGGG - Intergenic
968793182 4:2683357-2683379 GTGGTTACAGAGAGCCGAGATGG - Intronic
971356943 4:25903666-25903688 ATGGATAGACAGAGATGAGAGGG + Intronic
974955980 4:68641939-68641961 ATGGCTAAAAAGAGACGTGAAGG - Intronic
975501506 4:75090833-75090855 ATGGAACAACAAAGCCTAGATGG + Intergenic
976119532 4:81764203-81764225 ATGTATAAAGAGAGCAGGGATGG + Intronic
980468757 4:133221536-133221558 ATGGAGACACAGAGGCTAGAAGG - Intergenic
980841910 4:138273078-138273100 ATTGATAATCAGAGCCGATGTGG - Intergenic
982149466 4:152436776-152436798 ATGGAATAACAGAGCCTAGATGG + Intronic
987463672 5:18246700-18246722 ATGAATACACAGAGCACAGAGGG - Intergenic
991306877 5:65186270-65186292 ATGGAAATTCAGAGCTGAGAAGG - Intronic
993860795 5:93134388-93134410 ATGGATCAACAGAGCACATATGG + Intergenic
997453333 5:134000696-134000718 ATGGAGAAAGAGAGCCTGGATGG + Intronic
998361868 5:141595190-141595212 ATGAATAAATAGAGCACAGAGGG + Intronic
1001855660 5:175008275-175008297 AGGGATAAAGGGAGCAGAGATGG - Intergenic
1003243602 6:4365793-4365815 ATGGATGAAGACAGCTGAGATGG - Intergenic
1003464547 6:6365970-6365992 AGGGTTAAGCAGAGTCGAGATGG + Intergenic
1006805614 6:36787166-36787188 ATGGAGAAAGAGAGATGAGAAGG - Intronic
1008364345 6:50659071-50659093 ATGGTTAAAAAGAGTTGAGATGG + Intergenic
1008784617 6:55152032-55152054 ATGGAACAACAGAGCCTGGATGG - Intronic
1009436799 6:63627872-63627894 AAGGATAAAAGGAGCTGAGATGG - Intergenic
1010724518 6:79318104-79318126 ATGGAGCAACAGAGCCTGGATGG - Intergenic
1011187007 6:84688757-84688779 AGGGATAAGCAGAACGGAGAAGG + Intronic
1011715136 6:90097300-90097322 ATGGATCAGCAGAGCTGAAAGGG + Intronic
1016931627 6:149416563-149416585 ATGGAACAACAGAGCCTGGATGG + Intergenic
1017274176 6:152546757-152546779 ATAGTAAAACAGAGCCGAAAAGG - Intronic
1017336184 6:153263058-153263080 ATGTACAAAAAGAGCTGAGATGG + Intergenic
1019894756 7:3975126-3975148 AGGGAGAAAGAGAGCAGAGACGG - Intronic
1020386442 7:7609241-7609263 ATTGAAAAACAGAGCCTAAAAGG - Intergenic
1020572250 7:9879136-9879158 ATGTATAAATAAAGCCTAGATGG + Intergenic
1020845374 7:13274818-13274840 ATGGATTCAGAGAGCCAAGATGG - Intergenic
1021402567 7:20226268-20226290 ATGGATAAAGAGAGGCCAGCTGG - Intergenic
1022198865 7:28096131-28096153 AGGGATAAGCAGAACTGAGAGGG + Intronic
1026883589 7:73922561-73922583 AGGGATGAAGAGAGCAGAGAGGG - Intergenic
1028276888 7:88868313-88868335 ATGGATATACATAGCCCAGTTGG - Intronic
1032997917 7:137468923-137468945 ATGAATATACAGAGGTGAGAAGG + Intronic
1033530521 7:142258233-142258255 ATGGATAAACAGTGACATGAAGG - Intergenic
1035127419 7:156618604-156618626 ATGGAGAAACACAGCTGAGCTGG + Intergenic
1039544615 8:38400349-38400371 AAGGAGGAACAGAGCCAAGATGG + Exonic
1045535982 8:103028280-103028302 ATGGATAAAGAGAGCTCAGGAGG + Intronic
1046727711 8:117692766-117692788 ATGGAAAAACAGAGTGGAGCAGG - Intergenic
1048511410 8:135065727-135065749 ATGCATAAACAGAGCAGCCATGG - Intergenic
1051683123 9:19628386-19628408 ATGGAGAAAGAGAGGCAAGAAGG + Intronic
1053024823 9:34720707-34720729 ATGGAGAAACAGGGCAGAGATGG - Intergenic
1055852388 9:80647819-80647841 ATGGACAAATAGAACTGAGAGGG - Intergenic
1056070531 9:82982186-82982208 ATGAAGAAACAGATCCGACATGG + Exonic
1056448740 9:86693451-86693473 AAGGAAAAAATGAGCCGAGAAGG + Intergenic
1058320876 9:103629188-103629210 ATGGATCAGCAGAGGAGAGAGGG - Intergenic
1058608700 9:106751921-106751943 CTGGAGAAACAGAGCAGAGAGGG + Intergenic
1059099563 9:111456824-111456846 ATGGGTAAAAAGAGTGGAGAGGG + Intronic
1059419143 9:114180360-114180382 ATGGGGAAACTGAGCCTAGAAGG - Intronic
1062009481 9:134259291-134259313 GTGGGTAAACACAGCCCAGAGGG - Intergenic
1062570778 9:137184205-137184227 ATGCAGACACAGAGCCGACATGG + Intronic
1185825385 X:3244271-3244293 ATGGATAAACAGAGGAAGGAAGG + Intergenic
1188535707 X:31194541-31194563 ATACATAAACAGAGCTGAGAGGG + Intronic
1194260012 X:91683341-91683363 ATGGAAAAATAGAGCAGATATGG - Intergenic
1194342852 X:92727298-92727320 ATGAATAAACTTAGCCAAGAAGG + Intergenic
1200578710 Y:4922532-4922554 ATGGAAAAATAGAGCAGATATGG - Intergenic
1200651214 Y:5843963-5843985 ATGAATAAACTTAGCCAAGAAGG + Intergenic
1201253811 Y:12087759-12087781 ATGGATAAACAGAGGAAGGAAGG - Intergenic
1201693890 Y:16802024-16802046 ATGGATAAGCAGAGAGTAGATGG + Intergenic