ID: 1168896710

View in Genome Browser
Species Human (GRCh38)
Location 20:1328715-1328737
Sequence GTGGATTCCTTGGGAGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168896703_1168896710 5 Left 1168896703 20:1328687-1328709 CCTCAGGCCAGAGAAGTCGGCCT 0: 1
1: 0
2: 3
3: 23
4: 142
Right 1168896710 20:1328715-1328737 GTGGATTCCTTGGGAGAAATGGG 0: 1
1: 0
2: 2
3: 21
4: 216
1168896704_1168896710 -2 Left 1168896704 20:1328694-1328716 CCAGAGAAGTCGGCCTGAGCTGT 0: 1
1: 0
2: 1
3: 8
4: 91
Right 1168896710 20:1328715-1328737 GTGGATTCCTTGGGAGAAATGGG 0: 1
1: 0
2: 2
3: 21
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168896710 Original CRISPR GTGGATTCCTTGGGAGAAAT GGG Intronic
901957939 1:12800637-12800659 GTGATGTCCTTTGGAGAAATGGG + Intergenic
904886848 1:33744471-33744493 GTGGATCCTTAGGGTGAAATAGG - Intronic
905646692 1:39629797-39629819 GTGGGGTCCTTGGCAGAACTGGG - Intronic
906718124 1:47985472-47985494 GTGGTTTCCTTGGGAGAACCTGG - Intronic
906935257 1:50208998-50209020 TTTGAATCCTTGGGAGAAAAAGG + Intergenic
907005706 1:50911023-50911045 GTGGTTACCTTAGGAGAAAAAGG - Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
907308379 1:53525989-53526011 GTGGAAGCCTTGGGAGAGATTGG - Intronic
908323731 1:63003085-63003107 GTGGAATCCTTGGGAGAACTAGG + Intergenic
909798670 1:79777701-79777723 GTTGCTTCCTCTGGAGAAATAGG + Intergenic
909995044 1:82268886-82268908 GTCAGTTGCTTGGGAGAAATAGG + Intergenic
910085095 1:83391841-83391863 GTGGCTTCCTGGAGAGAACTTGG + Intergenic
910980689 1:92957890-92957912 GTGGTTGCCTGGGGGGAAATGGG - Intronic
912526106 1:110283991-110284013 TTGGTTTCCTTGGGATAAAATGG + Intergenic
912526323 1:110286012-110286034 TTGGTTTCCTTGGGATAAAATGG - Intergenic
912562166 1:110558825-110558847 GTGGAATGAGTGGGAGAAATAGG + Intergenic
912778530 1:112522781-112522803 GGGGATGCCTGTGGAGAAATGGG + Intronic
915291707 1:154888550-154888572 GGGAATTACTTTGGAGAAATTGG + Intergenic
916330603 1:163612026-163612048 GTGATGTGCTTGGGAGAAATTGG + Intergenic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
917293701 1:173496349-173496371 GTGGAGCCCTTGGAAGAAAAGGG - Intergenic
918465109 1:184813103-184813125 GTGGAGTCCTTGGAAGAACAGGG - Intronic
919570019 1:199236693-199236715 GTGGATTGCTGAGTAGAAATGGG - Intergenic
920157717 1:203968763-203968785 GTGGAGTCCTTGGAAGAACAGGG + Intergenic
924565563 1:245195473-245195495 TTGAATTCCTTGGGAGACGTGGG + Intronic
924642555 1:245848291-245848313 GTGTATTTCTTGGTAGAGATAGG + Intronic
924729420 1:246697993-246698015 GTGCATTCCTGGGGAGACAGAGG + Intergenic
924774353 1:247105317-247105339 GCGGTTTCCAAGGGAGAAATGGG + Intergenic
1063487806 10:6436374-6436396 ATGGAACCGTTGGGAGAAATAGG - Intronic
1063525102 10:6777991-6778013 GTGGATTCCTCACGATAAATTGG - Intergenic
1063527078 10:6796361-6796383 GTGGCTTCCGTGGAAGGAATGGG - Intergenic
1064052472 10:12069962-12069984 CTGCATTGCTTGGGAGAAGTGGG + Intronic
1064593866 10:16923189-16923211 GTGAACTCCTTGGCAGAACTCGG + Intronic
1066514741 10:36145418-36145440 GTGGATTCCCTGACAGAAATGGG + Intergenic
1067150569 10:43729114-43729136 TTGGATTCCTTTGGAGTAGTGGG + Intergenic
1068532882 10:58209241-58209263 GTGGAGTCCTGGGGAGAACAAGG + Intronic
1068658517 10:59599361-59599383 GTGGATTCAGTGGAATAAATGGG - Intergenic
1069704311 10:70448215-70448237 CTGGATTCTGTGGGAGAAATAGG - Intergenic
1069806819 10:71131540-71131562 CTGGAGTCCTTGGGAGATCTAGG - Intergenic
1070148133 10:73789352-73789374 GTGGAACCCTGGGGAGAAATGGG - Exonic
1070531571 10:77341834-77341856 CAGGATTCCTTGGCAGAACTTGG + Intronic
1076264359 10:129098298-129098320 GTGAAGTCTTTGGGACAAATAGG - Intergenic
1078523987 11:12086680-12086702 GTGGATCCCCTTGGAGAGATGGG - Intergenic
1078724134 11:13913439-13913461 CTGGTCTCCTTGAGAGAAATTGG - Intergenic
1079417053 11:20248042-20248064 GAGGATTTCTTGCCAGAAATGGG + Intergenic
1080810632 11:35701049-35701071 GTGGAGTCCTTGGAAGAACAGGG + Intronic
1086324049 11:85680714-85680736 GTGTATTCCTAAGGACAAATTGG - Intronic
1086749172 11:90468947-90468969 GTGGATTCTTTGCGAGAAAAAGG - Intergenic
1088780200 11:113126863-113126885 GTGGATATCCTGGGATAAATGGG - Intronic
1093616465 12:21231454-21231476 GAGGAGTCCTTGGGAAAAATAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1099669249 12:85669401-85669423 GTGGATGCCTTAAGAGAAGTAGG - Intergenic
1099788541 12:87299263-87299285 GTGTAGTATTTGGGAGAAATTGG + Intergenic
1100816363 12:98390850-98390872 GAAGAGTCCATGGGAGAAATGGG + Intergenic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1101318257 12:103649701-103649723 TGGGATGCCTTGGGAAAAATGGG - Intronic
1102911414 12:116717401-116717423 TTGGATTCCTTTGGAGTAATGGG - Exonic
1103601175 12:122055512-122055534 GAGGATTCGATGGGAGAACTTGG + Intronic
1106780264 13:33052127-33052149 TTGGATTTTTTGGTAGAAATGGG + Intronic
1107842932 13:44478093-44478115 ATAGATTCCTTGGGAAAACTAGG + Intronic
1108286717 13:48916111-48916133 CTGCATTCATTGGGAGAGATAGG - Intergenic
1110059821 13:71027292-71027314 GTGGCTTCCTTGGAAGACACAGG - Intergenic
1110591949 13:77273539-77273561 GTGGCTTCTTGGGGAGAAACAGG - Exonic
1110618851 13:77572265-77572287 GTGGATGTTTTGGGATAAATTGG + Intronic
1110751120 13:79117937-79117959 GTGGATTCACTCAGAGAAATAGG + Intergenic
1113224066 13:108140069-108140091 GTGGATTCCTGGGGAGGATATGG - Intergenic
1114414315 14:22529983-22530005 GTTGATTCCTAGGTAAAAATGGG + Intergenic
1116678840 14:47940014-47940036 GTGGAGTCCTTGGAAGAACAGGG - Intergenic
1117496928 14:56314684-56314706 GTGGTTTCCATGGGAGAGAAAGG - Intergenic
1118060634 14:62134564-62134586 TTGGATTCATTGGGTGAACTGGG + Intergenic
1121338003 14:93088985-93089007 GTGACTTCCTGGGGAGAAAGGGG + Intronic
1125723546 15:41856712-41856734 CTGGATTCTTTGGGAGTCATGGG - Intronic
1126029056 15:44478139-44478161 GTGAATTCCTTGGAAAAGATTGG + Intronic
1127462799 15:59215051-59215073 GTGGGTTCTTTGTGTGAAATAGG - Intronic
1128650916 15:69413072-69413094 CTGGCTTGCTTGGGAGAAAAGGG + Intergenic
1130829086 15:87581325-87581347 CTGAATTCCTTGGTACAAATTGG + Intergenic
1134422227 16:14104604-14104626 TTGGATTCCTTATGACAAATGGG - Intronic
1135481939 16:22827929-22827951 GAGGATTGCTTGAGAGGAATTGG - Intronic
1135534764 16:23284770-23284792 TTGCATTCCTTGGCAGAAATTGG - Intronic
1137569917 16:49558621-49558643 GTGGATCCCTTAGCAGAATTGGG - Intronic
1138787528 16:59864809-59864831 GTGGCTGGCTTGGGAGAAAAGGG + Intergenic
1139282573 16:65783364-65783386 TTTGATTTCTTGGGAGAAAAAGG + Intergenic
1139432056 16:66916096-66916118 GTAGATGGCTTGAGAGAAATGGG + Exonic
1143419492 17:6777725-6777747 GTGGGTCCCTTGGGAGAGAAAGG + Intronic
1143930912 17:10423053-10423075 GTAGTTACCTTGGGAGAAAAGGG - Intergenic
1145021993 17:19439412-19439434 GTGGATTTTTTAGGAGAATTAGG + Intergenic
1146960354 17:36969818-36969840 GTGGTTGCCTAGGGACAAATAGG - Intronic
1148779687 17:50114299-50114321 GTGGATTCCTAGACAGAAAAAGG + Exonic
1151121480 17:71797763-71797785 GTGTATTCATTGTGTGAAATTGG - Intergenic
1151484237 17:74388545-74388567 ATGGAGTCCCTGGGAGAAAGGGG + Intergenic
1152191617 17:78891713-78891735 GTGGCTGCTGTGGGAGAAATCGG - Exonic
1152204653 17:78968031-78968053 GTCGATTCCTGGGGAGCAAGCGG - Intergenic
1153643152 18:7172795-7172817 GTGGTTTACTTGGGAGACCTTGG + Intergenic
1154246460 18:12703240-12703262 GGCGGTGCCTTGGGAGAAATAGG + Intronic
1158531134 18:58262737-58262759 GTGGCTTCCTTGGGCCAACTAGG + Intronic
1159473874 18:68891964-68891986 GTGGGTTCTATGGGAGAAAGTGG + Intronic
1159651913 18:70987761-70987783 CTTGATTATTTGGGAGAAATTGG + Intergenic
1159748848 18:72274566-72274588 GTGGATTTTTTAGAAGAAATAGG - Intergenic
1160202218 18:76805603-76805625 GTGGATTCCTTCCCAGAACTTGG - Intronic
1162581006 19:11530288-11530310 GTGGAGTCTTTGGAGGAAATGGG + Intergenic
1164700283 19:30280006-30280028 GTGTATTCCTGGGGAGACACAGG - Intronic
1166303537 19:41925220-41925242 GAGGATTCCCTGGGATAAACAGG + Intronic
1167058078 19:47125482-47125504 ATTGCTTCCTTGGGAGAATTTGG + Intronic
1168599429 19:57706207-57706229 GTGGATGCCCTGGGAGATCTAGG - Intronic
927261306 2:21094244-21094266 TTTGATACCTTGGGAGACATGGG - Intergenic
927277842 2:21276672-21276694 GTGGCTTCCTTAGGAGAGCTGGG + Intergenic
927676678 2:25111406-25111428 GTGGGATCCCAGGGAGAAATGGG - Intronic
930761996 2:55048807-55048829 GTGGATTCCTTGCCAGGAATTGG - Intronic
931175690 2:59852270-59852292 GTGGGTGCCATAGGAGAAATGGG + Intergenic
932049843 2:68387625-68387647 GTGGATTTCTTGGGGGATTTTGG + Intronic
932344026 2:70984214-70984236 GTGGATTCCTTTGGAGAAGAAGG + Intronic
932829755 2:74977757-74977779 AAGGGTTCCTGGGGAGAAATGGG + Intergenic
932965895 2:76474217-76474239 CTGGATGCCTTGGGAAAAACAGG + Intergenic
932965905 2:76474264-76474286 GTGGAGTCCTTGGAAGAACAGGG - Intergenic
936686969 2:114838671-114838693 GCATATTCCTAGGGAGAAATTGG - Intronic
936799057 2:116244065-116244087 GTAAATTCCTTGAGAGCAATAGG - Intergenic
938008823 2:127811888-127811910 GTGGATTTCTACAGAGAAATAGG + Intergenic
940368468 2:152875230-152875252 GTGGAGTCTTTGGGAGCAATAGG - Intergenic
941639623 2:167972983-167973005 GTGGAGTCCTTGGAAGAACAGGG - Intronic
943911723 2:193577319-193577341 GTGGAAACCTTGAGAGAATTTGG + Intergenic
946112178 2:217429621-217429643 CTGCTTTCCTTGGGAGTAATAGG + Intronic
1168896710 20:1328715-1328737 GTGGATTCCTTGGGAGAAATGGG + Intronic
1169663574 20:8007618-8007640 GTGGAGTACTTGAGATAAATGGG - Intronic
1169999674 20:11601238-11601260 GGGGTTTCCTGGGAAGAAATGGG + Intergenic
1170930318 20:20763861-20763883 CTGGGCTCCTTGGGAGAACTGGG + Intergenic
1171430508 20:25081022-25081044 CTGGATTTCTTTGGGGAAATGGG + Intronic
1172659127 20:36555369-36555391 GTGGATTCCTAGGGTGAGGTGGG + Intergenic
1176218972 20:63961122-63961144 CTGGCTTCCCTGGGAGAACTGGG - Intronic
1179537517 21:42062009-42062031 GTGGTTTCCTCAGGACAAATTGG + Intergenic
1183190316 22:36318264-36318286 GAGGATTCCTCTGGTGAAATCGG + Exonic
1183728002 22:39600132-39600154 ATGGGGTCCTTGGGAGAATTAGG + Intronic
1184591688 22:45488414-45488436 GTAGCTTTCTTGGGAGAAATAGG - Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605707 3:14078168-14078190 GTGGAGTCCTTGGAAGAACAGGG + Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
952341152 3:32448714-32448736 GTGGATTCATTGGCAGAGCTTGG + Intronic
952697090 3:36278769-36278791 GTGGATTTCTTGTTAGAAACTGG + Intergenic
954420035 3:50413914-50413936 GTGGGTTTCATGGGGGAAATGGG - Intronic
955163551 3:56488669-56488691 GGGGATTAATTGGGGGAAATGGG - Intergenic
955398985 3:58577769-58577791 GTGGATTCTTCAGGAGAAAATGG + Intronic
956306149 3:67828683-67828705 GTTGATTAATTGGTAGAAATGGG - Intergenic
957330108 3:78751886-78751908 GTGGGTATCTTGGGAAAAATAGG + Intronic
957726247 3:84071137-84071159 GGGGATTCCTTGGGAAAAATAGG - Intergenic
961040391 3:123674182-123674204 GAGGGGGCCTTGGGAGAAATGGG - Intronic
964100912 3:152987446-152987468 GTGGTTTCCTGGGGAGCAAGTGG + Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
969209076 4:5672462-5672484 CTGGATGCCAAGGGAGAAATAGG + Intronic
970615329 4:17763491-17763513 TAGGCTTCCTTGGGACAAATAGG + Intronic
970855605 4:20647227-20647249 GTAGCTTTCCTGGGAGAAATAGG + Intergenic
972327800 4:38034246-38034268 GTGGATTTCTCTGGAGAAAGTGG - Intronic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
972857689 4:43127169-43127191 ATGCATTCCTTGAGAGAAAAAGG + Intergenic
973100253 4:46258788-46258810 GGGGATTCCTTGAGAAAAATAGG + Intronic
975964071 4:79948192-79948214 GTGGCATCCTTAGGAGAATTGGG + Intronic
977691812 4:99919753-99919775 TTGTACTCATTGGGAGAAATGGG + Intronic
977909609 4:102517685-102517707 TAGGATTTCTTGGCAGAAATTGG + Intronic
978698569 4:111614938-111614960 CTGGATTCCTTGATAGCAATGGG - Intergenic
981201085 4:141980164-141980186 GTGGAGTCCTTGGAAGAACAGGG - Intergenic
983859402 4:172686439-172686461 GTAGATTCCTTTGGAGAAAAAGG - Intronic
984673034 4:182513970-182513992 GTGGTTTCCTTGGGAAGAAATGG - Intronic
986257500 5:6112445-6112467 GTGGTTTCCTTAGGAAATATTGG - Intergenic
988553687 5:32218817-32218839 CTCGATTCCCTGGTAGAAATAGG + Intergenic
990290599 5:54346807-54346829 GTGGAGTCCTTGGAAGAACAGGG - Intergenic
990392478 5:55339733-55339755 GTGTTTTCCTTGCAAGAAATAGG + Intronic
995157810 5:108936164-108936186 GGGGATTCATTGGGAGCAAAGGG + Intronic
996443112 5:123512915-123512937 GGGGCTTCCTTAGGAGAGATTGG + Intronic
997939651 5:138145634-138145656 GTGGGTACTTTGGGATAAATCGG + Intronic
1000728161 5:164798441-164798463 GTGAATTCCATGGGGGAAACTGG - Intergenic
1001539466 5:172527236-172527258 GTGGTTTCCATGGGAAAAAATGG + Intergenic
1001585577 5:172831937-172831959 TAGGTTTCCTTGGGAGAACTGGG - Intergenic
1004107743 6:12681573-12681595 GTGAATTCCTTGGGCTAAATTGG - Intergenic
1004983027 6:21047537-21047559 GTGAAATGCTTGGGAGAACTTGG - Intronic
1005430514 6:25751921-25751943 GTGGCTTCCTTGAAACAAATGGG - Intergenic
1006882816 6:37354421-37354443 GTGGATTCCTGGGGAGAGAAGGG + Intronic
1007952607 6:45885700-45885722 GTAGAGACCTTGGGAGAAAGTGG + Intergenic
1010823727 6:80447614-80447636 ATGGATTCCTTGGGACAAAAGGG - Intergenic
1011651149 6:89507601-89507623 GTGGCCTCATTGGAAGAAATAGG + Intronic
1011686865 6:89830296-89830318 ATGGAGTTCTTTGGAGAAATGGG + Intronic
1011793198 6:90922221-90922243 ATTGTTTTCTTGGGAGAAATTGG - Intergenic
1014138790 6:117917734-117917756 GTGGAATTCTGGGGAGAAGTCGG + Intronic
1014642438 6:123929062-123929084 GTGGTTTCCTTGGGAGATGAAGG + Intronic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1018277533 6:162149016-162149038 ATGGATTTCTTGGCACAAATAGG + Intronic
1020770970 7:12394164-12394186 GTGGCTACTTTGGGAGAAACTGG - Intronic
1022418289 7:30197110-30197132 GTAGCTTTCCTGGGAGAAATAGG + Intergenic
1022555345 7:31289147-31289169 GTGAAGACCTTGGGAGGAATGGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1027301966 7:76848311-76848333 GTGGCTTCCTGGAGAGAACTTGG + Intergenic
1028285310 7:88989481-88989503 GGCTATTCCTTGAGAGAAATAGG - Intronic
1028370170 7:90082917-90082939 GTGGATTCCTTGAAGGAAGTAGG + Intergenic
1028918663 7:96287420-96287442 GTGGAATCTTTGGTATAAATGGG - Intronic
1030363889 7:108624697-108624719 GTGGAGCCCTTGGGGGAAAGGGG + Intergenic
1030729196 7:112964791-112964813 GTGATATCCTTGGGGGAAATGGG + Intergenic
1031714613 7:125092823-125092845 GTAGGTTGCTTGGGACAAATAGG + Intergenic
1031988679 7:128181155-128181177 GAGGATGTCTTGGGAGAAAAGGG - Intergenic
1041445150 8:57943180-57943202 GGGCAATCCTTGGGAGAAACTGG + Intergenic
1041975616 8:63795871-63795893 CAGGATTCCTTGGTAGAACTGGG - Intergenic
1043638238 8:82413815-82413837 GGTCATTCTTTGGGAGAAATCGG - Intergenic
1046031744 8:108790272-108790294 GTGTAATCCTTGGAAGAAAAAGG - Intergenic
1046910558 8:119621738-119621760 TTGGGTTCCTTTGGAAAAATGGG + Intronic
1048590907 8:135820061-135820083 TGGGATTCCATGGGAGTAATGGG - Intergenic
1049094781 8:140542011-140542033 GTAGTTTCTTTGGAAGAAATAGG - Intronic
1049649471 8:143758618-143758640 TTGGATTCCTTTGGAGTAGTGGG - Intergenic
1050157132 9:2679494-2679516 GTGGCTTGCCTGGGAAAAATAGG - Intergenic
1050256667 9:3799568-3799590 GTAGGTACCTTGGGAGGAATGGG - Intergenic
1050657911 9:7849082-7849104 GTGGAGTCCTTGGAAGAACAGGG - Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1055886010 9:81063710-81063732 ATGGAGTCCATGGGAGACATGGG + Intergenic
1055970836 9:81911272-81911294 GTGGAGTCCTTGGAAGAACAGGG + Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1057518291 9:95739557-95739579 GTGCAATCCTGGAGAGAAATGGG + Intergenic
1057819975 9:98322994-98323016 GTTGATTGATTGGGTGAAATGGG - Intronic
1058895511 9:109397457-109397479 GTGGGCTCTTTGGGAAAAATGGG - Intronic
1058901430 9:109445984-109446006 GTGGAGTCATTGGCAGAAACAGG - Intronic
1059100487 9:111466832-111466854 GAGGATTGCTTGGGCAAAATAGG - Intronic
1059516601 9:114901732-114901754 GTAGATTCTTTGGGAGAAGCAGG - Intronic
1059946805 9:119417525-119417547 GAACATTCCTTGGGAGACATGGG - Intergenic
1059997891 9:119931374-119931396 GTGAATTAGTTTGGAGAAATAGG + Intergenic
1060521751 9:124298006-124298028 GTAGATTCCTTGGAACAAAGAGG + Intronic
1060642149 9:125248034-125248056 GAGGCTACCCTGGGAGAAATAGG + Intergenic
1060681587 9:125569685-125569707 GTGGAGTCCTTGGAAGAACAGGG - Intronic
1060686437 9:125618071-125618093 GTTGGTTGCTTGGGAGTAATTGG - Intronic
1186203098 X:7173891-7173913 GTAGAATCTTTGGGAGAAAGTGG + Intergenic
1187350628 X:18512839-18512861 GGATATTACTTGGGAGAAATAGG + Intronic
1187592141 X:20729156-20729178 GTGGAAAGCTGGGGAGAAATAGG + Intergenic
1188582736 X:31735095-31735117 GAGCCTTCCTTGGGAGACATGGG + Intronic
1191871885 X:65752957-65752979 GTAGCTTTCCTGGGAGAAATAGG - Intergenic
1192972101 X:76243651-76243673 TTGTATTTTTTGGGAGAAATGGG - Intergenic
1193263711 X:79442106-79442128 GTGGCTTCCTTGGGTGATAATGG - Intergenic
1193572691 X:83162683-83162705 GTGGCTTCCCCAGGAGAAATAGG - Intergenic
1194312970 X:92337701-92337723 GTAGATTCCTAGGGATTAATTGG + Intronic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1195059138 X:101177229-101177251 GTGGATAGCTTGGGAGCAAAAGG - Intergenic
1196649021 X:118149916-118149938 ATGGATTGATGGGGAGAAATTGG - Intergenic
1197831395 X:130646715-130646737 TTGGATTCCTTTGGAGTAGTGGG + Intronic
1198227479 X:134658936-134658958 GTGGGCTCCTTGAGAGAACTGGG - Intronic
1199687058 X:150273958-150273980 AGGCATTCCATGGGAGAAATTGG - Intergenic
1200621236 Y:5451815-5451837 GTAGATTCCTAGGGATTAATTGG + Intronic