ID: 1168897150

View in Genome Browser
Species Human (GRCh38)
Location 20:1331445-1331467
Sequence ACCCTAAGTTCCCTGAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 895
Summary {0: 1, 1: 0, 2: 16, 3: 134, 4: 744}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168897147_1168897150 -3 Left 1168897147 20:1331425-1331447 CCTTTTAGGCTACTAGTTAGACC 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1168897150 20:1331445-1331467 ACCCTAAGTTCCCTGAGGGCAGG 0: 1
1: 0
2: 16
3: 134
4: 744

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168897150 Original CRISPR ACCCTAAGTTCCCTGAGGGC AGG Intronic
900753995 1:4420834-4420856 ACTGTAAGCTCCATGAGGGCAGG - Intergenic
901053789 1:6439402-6439424 AGACTGAGTTCCCAGAGGGCAGG - Intronic
901731568 1:11284069-11284091 ACTGTAAGTTCCATGAGGGCAGG - Intronic
901781114 1:11595281-11595303 ACTGTGAGCTCCCTGAGGGCAGG - Intergenic
902210465 1:14901044-14901066 ACAGTAAGCTCCCTGAGGACAGG - Intronic
902569131 1:17335751-17335773 ACCCCAAGGTCACTGAGGGCTGG + Intronic
902845131 1:19104509-19104531 ACCCTTAGTTCCTTGGGTGCTGG - Intronic
902857635 1:19220600-19220622 ACTGTAAGCTCCATGAGGGCAGG + Intronic
903164983 1:21514039-21514061 ACCCTGAGCCCCCTGAGGGCTGG - Intronic
903319393 1:22533289-22533311 ACCCCAAGTTACCCGTGGGCTGG + Intergenic
903664841 1:24999955-24999977 ACTGAAAGCTCCCTGAGGGCAGG + Intergenic
903744493 1:25577439-25577461 ACCTCGAGTTCCTTGAGGGCAGG - Intergenic
903927245 1:26839307-26839329 ATCTTAGATTCCCTGAGGGCAGG + Intronic
904195878 1:28785111-28785133 ATTCTAAATTCCCTGAGGTCAGG + Intergenic
904933251 1:34107334-34107356 ACCGTAAGCTCCATGAGGGCAGG - Intronic
905025796 1:34848417-34848439 ACTGTGAGTTCCTTGAGGGCAGG - Intronic
905342068 1:37286148-37286170 ACCACAAGCTCCATGAGGGCAGG + Intergenic
905394281 1:37657254-37657276 ACACTGGGGTCCCTGAGGGCTGG - Intergenic
905456415 1:38091211-38091233 ACAGTAAGCTCCTTGAGGGCAGG - Intergenic
906048175 1:42848699-42848721 AACATAAGTTCCATGAGAGCTGG - Intronic
906055277 1:42911183-42911205 ATCCTAAATTGCCTGAGGGATGG - Intergenic
906108400 1:43308033-43308055 ACTCTAAGCTCCCTGAGGGCAGG - Intronic
906297658 1:44658994-44659016 AGCCTGAGATCCTTGAGGGCAGG - Intronic
906381883 1:45337837-45337859 AATATAAGCTCCCTGAGGGCAGG - Intronic
906447750 1:45918050-45918072 AATCTAAGCTCCCTGAGGACAGG - Intronic
906692235 1:47800132-47800154 ATCATAAGCTCCATGAGGGCAGG - Intronic
906821934 1:48939144-48939166 ACCCTGAGATTCCTGAGGGTGGG + Intronic
906841414 1:49143519-49143541 ACTGTGAGTTCCGTGAGGGCAGG + Intronic
906930215 1:50162359-50162381 ACCCTAAGTTCCTTAAGGGCGGG - Intronic
906968685 1:50486691-50486713 ACAGTAAGCTCCTTGAGGGCTGG + Intronic
907094620 1:51766463-51766485 CCCAAAAGTTCCCTGTGGGCAGG - Intronic
907174261 1:52503277-52503299 ACTGTAAGCTCCATGAGGGCTGG - Intronic
907474390 1:54695784-54695806 ACCAAAAATTCCTTGAGGGCAGG - Intronic
907797630 1:57733343-57733365 AATGTAAGTTCCATGAGGGCAGG + Intronic
907909057 1:58811255-58811277 ACTAGAAGTTCCATGAGGGCAGG - Intergenic
908413565 1:63890472-63890494 ACTATGAGCTCCCTGAGGGCAGG - Intronic
908418538 1:63936847-63936869 AATATAAATTCCCTGAGGGCAGG + Intronic
908693561 1:66810702-66810724 ACTGTAAGTTCCTTGAGGGTAGG - Intergenic
908701843 1:66910774-66910796 AATCTAAGTTCCATGAGGGTAGG + Intronic
909624559 1:77701228-77701250 AACGTAAGATCCCTGAGGACAGG + Intronic
910286007 1:85555076-85555098 ATCCTAAGTTCTTTGAGGGCAGG + Intronic
910498835 1:87865164-87865186 CCCCTGAGTTGCTTGAGGGCAGG + Intergenic
910682570 1:89882536-89882558 ACTATAACCTCCCTGAGGGCAGG - Intronic
912372462 1:109184676-109184698 AACCTAAGTTCCCTGAAACCTGG - Intronic
912450421 1:109764695-109764717 ACTGTGAGTTCCCAGAGGGCAGG - Intronic
912549277 1:110474190-110474212 ACTACAAGCTCCCTGAGGGCAGG + Intergenic
912722053 1:112028543-112028565 GCACTGAGTCCCCTGAGGGCAGG - Intergenic
912723219 1:112037423-112037445 ATTCTAAGTTCCCTGAGGGCAGG - Intergenic
913261050 1:116998487-116998509 ACCCCAAGTTCCTGGAGGGCAGG + Intergenic
913335694 1:117707509-117707531 ACTGTAAGCTCCATGAGGGCAGG + Intergenic
913353671 1:117893012-117893034 ACCCTAAGCTCCATGCAGGCGGG + Intronic
913531328 1:119736249-119736271 ATCATAAGCTCCCTGAAGGCAGG + Intronic
913588939 1:120303913-120303935 ACTCTAAGTGTCATGAGGGCAGG - Intergenic
913619246 1:120594456-120594478 ACTCTAAGTGTCATGAGGGCAGG + Intergenic
914422752 1:147544115-147544137 ACTGTAAGTTCCCTGAGGGCAGG - Intronic
914570964 1:148915796-148915818 ACTCTAAGTGTCATGAGGGCAGG - Intronic
914601868 1:149214475-149214497 ACTCTAAGTGTCATGAGGGCAGG + Intergenic
914676714 1:149911765-149911787 TTCCTAAGTCCCTTGAGGGCAGG - Intronic
914948883 1:152092392-152092414 AATGTAAGTTCCTTGAGGGCAGG + Intergenic
915232159 1:154453703-154453725 AGACTGAGTTCCCTGAAGGCAGG - Intronic
915339025 1:155166396-155166418 GCCCGGAGGTCCCTGAGGGCAGG + Intergenic
915638581 1:157203783-157203805 ACTGTAAGTTCCTTGAGGGCAGG + Intergenic
915938139 1:160100872-160100894 GAACTATGTTCCCTGAGGGCAGG - Intergenic
916001451 1:160620237-160620259 ATTCTAAGTTCTTTGAGGGCAGG + Intronic
916316574 1:163455120-163455142 ACTATAAGTTCCTTGAGGACAGG - Intergenic
916665617 1:166964419-166964441 ACTATAAGGTCCCTGAGGGCAGG + Intronic
916936983 1:169639444-169639466 ACCATACATTCCCAGAGGGCAGG + Intergenic
916971589 1:170024873-170024895 ACTCTAAGCTCCAAGAGGGCAGG - Intronic
917539037 1:175895761-175895783 ACTGTAAGCTCCCTGAGGGCAGG - Intergenic
917846516 1:179025227-179025249 ACCGTAAGCCCCATGAGGGCAGG - Intergenic
918054066 1:181003292-181003314 ACTCAAAGTTCTGTGAGGGCTGG + Intronic
918068695 1:181119321-181119343 ACTGTGAGCTCCCTGAGGGCAGG - Intergenic
918082012 1:181214952-181214974 ACTCTAAGTCCCTTGAGAGCAGG + Intergenic
918126108 1:181585478-181585500 AATATAAGTTCCATGAGGGCCGG - Intronic
918128791 1:181607054-181607076 AACCTAAGCTCCATGAGAGCAGG + Intronic
918129989 1:181619091-181619113 AATGTAAGTTCCATGAGGGCAGG - Intronic
918249619 1:182690339-182690361 ACCATAAGCTCCATGAAGGCAGG + Intergenic
918381490 1:183960019-183960041 AATATAAGTTCCCTGATGGCAGG + Intronic
918549842 1:185729730-185729752 ACTGTAAGTGCCTTGAGGGCAGG + Intergenic
919929631 1:202213044-202213066 GACCGAAGTTTCCTGAGGGCAGG + Intronic
919937921 1:202266956-202266978 ACTATGAGTTCCTTGAGGGCAGG + Intronic
920022277 1:202965459-202965481 ACCCCAAATTTCCTGAGGGAGGG - Exonic
921165730 1:212505525-212505547 ACTGTAAGTTCCCTGAGGGCAGG - Intergenic
921297359 1:213717185-213717207 ACTGTAAGTTCCTTGAGGGCAGG - Intergenic
921766345 1:218976948-218976970 ACCTTGAGTTCCATGGGGGCTGG - Intergenic
922998589 1:229986877-229986899 AACATAAGTTCCAAGAGGGCAGG - Intergenic
923493761 1:234507231-234507253 ATCCTAAGTCACCAGAGGGCAGG + Intergenic
923554713 1:234991549-234991571 AATGTAAGTTCCATGAGGGCAGG + Intergenic
923859564 1:237879613-237879635 ACCCTAAATTTCTTGAGGGTAGG - Intronic
924038224 1:239957399-239957421 AGCCCATGTGCCCTGAGGGCTGG + Intergenic
924051703 1:240085824-240085846 AATGCAAGTTCCCTGAGGGCGGG - Intronic
924200966 1:241658053-241658075 AATATAAGCTCCCTGAGGGCAGG + Intronic
1062895887 10:1102856-1102878 AACAGAAGTTCTCTGAGGGCAGG + Intronic
1063606058 10:7523920-7523942 ACAGTAAGCTCCCTGAGGGCAGG + Intergenic
1063889915 10:10618613-10618635 ACTGTAAGTTCCCTGAGGACAGG + Intergenic
1064009659 10:11725548-11725570 ACCACAAGTTTCTTGAGGGCAGG - Intergenic
1064301491 10:14127003-14127025 ACTCTAAGCTCCATAAGGGCAGG - Intronic
1064873366 10:19964704-19964726 AGCCTGAGCTCCTTGAGGGCAGG + Intronic
1065915725 10:30353645-30353667 ACCGTGAGTTCCCTGAGGGAAGG + Intronic
1066483711 10:35823388-35823410 ACTATACATTCCCTGAGGGCAGG - Intergenic
1068634260 10:59331094-59331116 ACTGTGAGCTCCCTGAGGGCAGG - Intronic
1068767683 10:60781803-60781825 ACCATAGGATCCTTGAGGGCTGG + Intronic
1069079835 10:64076867-64076889 ACACTGAGTTCCCTGAAGGCAGG - Intergenic
1069676014 10:70248393-70248415 ACCATAAGCTCCATGAGGACAGG - Exonic
1069684395 10:70308471-70308493 CCTCTCAGTTCCCTGAAGGCAGG + Intronic
1069911528 10:71762614-71762636 CCTCCAAGTGCCCTGAGGGCTGG - Intronic
1070183816 10:74040235-74040257 ACTGTAAGTTCCGTGAAGGCAGG + Intronic
1070409084 10:76122902-76122924 GCTCTAAGTTCCTTCAGGGCAGG + Intronic
1070707606 10:78652071-78652093 ACTGGAAGTTCCCTGAGGGCAGG - Intergenic
1070715882 10:78720533-78720555 ACTGCAAGTTCCCTGAGGGCAGG + Intergenic
1070734398 10:78853309-78853331 ACCACAAGTTTCATGAGGGCAGG + Intergenic
1070810335 10:79294416-79294438 AACCTCACTTCCCAGAGGGCAGG - Intronic
1071059037 10:81548362-81548384 ACGCTAAGCTCCCTGAGCGGGGG + Intergenic
1072128088 10:92465324-92465346 AGCCTGAGTTCCTTGAGGGCAGG - Intronic
1072156872 10:92731523-92731545 ACTATAAGTTCCCTGAGAACAGG + Intergenic
1072308765 10:94133841-94133863 ACTATAAATTCCATGAGGGCAGG - Intronic
1072728946 10:97831881-97831903 AACATATGTCCCCTGAGGGCAGG - Intergenic
1072826217 10:98609268-98609290 ACTGTAAGCTCCTTGAGGGCAGG + Intronic
1072925018 10:99609542-99609564 ACAGTAAGCTCCTTGAGGGCTGG + Intergenic
1072983591 10:100120207-100120229 CCCTTAAGCTCCCGGAGGGCTGG - Intergenic
1073039898 10:100596428-100596450 ACCCTACGTTTCTGGAGGGCTGG + Intergenic
1073046473 10:100641999-100642021 ACTCTAAGCTCTCTGAGGGCAGG + Intergenic
1073112196 10:101069353-101069375 AATCCAAGTTCCATGAGGGCAGG - Intergenic
1073295106 10:102434007-102434029 ACTGTGAGCTCCCTGAGGGCAGG - Intergenic
1073328086 10:102654115-102654137 ACCCTGAGCTTTCTGAGGGCAGG - Intronic
1073527605 10:104199512-104199534 AAGGTAAGTTCCGTGAGGGCAGG - Intronic
1073649539 10:105343833-105343855 AGTCTAAGTTCCTTGAGGGAAGG - Intergenic
1074142743 10:110689319-110689341 AAGCTAAGCTCCATGAGGGCAGG - Intronic
1074358268 10:112804700-112804722 ACCATAAGTTCCCATAGGGCAGG + Intronic
1074552142 10:114454241-114454263 CCTCTAAGTCCCTTGAGGGCAGG - Intronic
1074724055 10:116289457-116289479 ACTGTAAATTCCATGAGGGCAGG - Intergenic
1075172403 10:120127886-120127908 ACTCTAAGCTCCCTGAGCGGGGG - Intergenic
1075175887 10:120160758-120160780 ACTGTAAGTTCCCCGAGGACAGG - Intergenic
1075201640 10:120409419-120409441 AGCATTAGCTCCCTGAGGGCAGG + Intergenic
1075356397 10:121780915-121780937 TCACTAGGTTCCCTGAGGACTGG + Intronic
1075676374 10:124298658-124298680 ACTATGAGTTCCTTGAGGGCAGG + Intergenic
1076109383 10:127849324-127849346 AATCTAAGTGCCCTGAGGGCAGG - Intergenic
1076220786 10:128731651-128731673 ACCCGATGCTCCCTGAAGGCAGG - Intergenic
1076374708 10:129975321-129975343 ACAGTAAGCTCCATGAGGGCAGG - Intergenic
1076557244 10:131335057-131335079 ACCTAATGTTCCCTGAGAGCAGG - Intergenic
1076715276 10:132360886-132360908 GCCCAAAGCTCCCTGAGGTCCGG + Intronic
1077457071 11:2687664-2687686 ACCCTGAGCTCCCTGAGACCTGG - Intronic
1078225322 11:9386128-9386150 ACTGTAAGTTCCGTGAGGGCAGG - Intronic
1078924687 11:15864028-15864050 ACTCTAAGTTCTATGAAGGCAGG + Intergenic
1078974855 11:16461924-16461946 ACTCTAAGGTTCTTGAGGGCAGG + Intronic
1079075667 11:17384141-17384163 AGCTTAAGGTCCCTGAGGGGTGG + Intergenic
1079312476 11:19378843-19378865 GCTCTGAGCTCCCTGAGGGCAGG + Intronic
1079471285 11:20780528-20780550 ACTGTAAGTTCCATGAGGGCAGG - Intronic
1079652334 11:22944821-22944843 ACTCTATCTTCCCTAAGGGCTGG + Intergenic
1079817824 11:25084405-25084427 ACTTTAAGTTCCATCAGGGCAGG - Intergenic
1080406742 11:31986811-31986833 ACTGTAAGTTCCATGAGGGCAGG - Intronic
1080573886 11:33580757-33580779 AACATAAGCTCCATGAGGGCAGG - Intronic
1080861197 11:36151604-36151626 ATGCTAAGTTCCGTGAGGGCGGG + Intronic
1081219319 11:40440125-40440147 ACTATAAGTTACATGAGGGCAGG + Intronic
1081617512 11:44599562-44599584 ACTGTGAGCTCCCTGAGGGCAGG - Intronic
1081622949 11:44629854-44629876 ACCCTAAGTTCCTCGAGGGCAGG + Intergenic
1081739988 11:45432221-45432243 TCCCTGAGTGCCTTGAGGGCTGG - Intergenic
1081753441 11:45528280-45528302 ACCATAAATTCCATGAGGGCAGG + Intergenic
1081781132 11:45713666-45713688 TCCTTGAGCTCCCTGAGGGCAGG - Intergenic
1083955657 11:65981587-65981609 CCCCTCAGGTACCTGAGGGCAGG - Intergenic
1084581843 11:70029085-70029107 ATCCTAAGTTTCTTGAAGGCAGG + Intergenic
1084873668 11:72115035-72115057 ACCATGAGCTCCTTGAGGGCAGG + Intronic
1085501359 11:77028021-77028043 ACACTAAGTGCCATGAGGGCAGG - Intergenic
1086496702 11:87411373-87411395 ACTGTAAGCTCCATGAGGGCAGG + Intergenic
1086940440 11:92792233-92792255 ACTCTAAGCTTCTTGAGGGCAGG + Intronic
1087044895 11:93836748-93836770 ACTGTAAGTTCCATGAGGGCAGG + Intronic
1087176518 11:95101017-95101039 ATTCTAAGTTCCCTGAAGGCAGG + Intronic
1087182617 11:95154729-95154751 AAGCTGAGCTCCCTGAGGGCAGG + Intergenic
1087232026 11:95676611-95676633 ACAGTAAGTTCCCTGAGAACAGG - Intergenic
1087276196 11:96162756-96162778 ACTGTAAGTTCCATGAGGACAGG - Intronic
1088086075 11:105981977-105981999 ACTGTAAGCTCCTTGAGGGCAGG + Exonic
1088222935 11:107589168-107589190 ACTGTAAGTTCCATGAGGGCAGG + Intergenic
1088503357 11:110506374-110506396 ATCCTAAGTTCTTTGAGAGCAGG + Intergenic
1088592628 11:111416440-111416462 AGCCAAAGTCCCCTGAGGTCTGG - Intronic
1088720007 11:112584112-112584134 AATGTGAGTTCCCTGAGGGCAGG - Intergenic
1088752853 11:112859538-112859560 ACATTAAATTCCATGAGGGCAGG - Intergenic
1088852941 11:113720273-113720295 ACTATAAGCTCCCTGAGGGTAGG - Intergenic
1088909829 11:114182443-114182465 AACATAAACTCCCTGAGGGCAGG + Intronic
1089053352 11:115564932-115564954 AGCCTCAGACCCCTGAGGGCAGG + Intergenic
1089066772 11:115668061-115668083 ACCGTAAGTTACTTAAGGGCAGG - Intergenic
1089080301 11:115770821-115770843 AGTGTAAATTCCCTGAGGGCAGG - Intergenic
1089393283 11:118116570-118116592 ATCCTAAGCTTTCTGAGGGCAGG + Intronic
1089521318 11:119066218-119066240 AGCCAGAGTTCCCTGAGAGCGGG - Intergenic
1089568123 11:119383187-119383209 AATGTAAGCTCCCTGAGGGCAGG - Intergenic
1089581749 11:119485645-119485667 AACAAAAGCTCCCTGAGGGCAGG + Intergenic
1089624973 11:119745508-119745530 ATGGCAAGTTCCCTGAGGGCAGG - Intergenic
1089627152 11:119758563-119758585 ACAGTAAGTTCCACGAGGGCAGG + Intergenic
1089672644 11:120067254-120067276 ACCCACAGGTCCCTGAGGGATGG - Intergenic
1089831488 11:121332261-121332283 ACTCTAAGTTCCTTGAGGATAGG - Intergenic
1090611283 11:128473274-128473296 ATTCTAAGTTCCTTGAGGCCAGG - Intronic
1090914270 11:131149225-131149247 ACCTTAAGATCCATGAGGCCAGG + Intergenic
1091034819 11:132223576-132223598 ACTCTAAGCTTCATGAGGGCAGG + Intronic
1091634134 12:2184715-2184737 AACCTAAGTTCCGTGAGCCCAGG - Intronic
1091679388 12:2515985-2516007 AATCTAAGTTCCACGAGGGCAGG - Intronic
1091747591 12:3002721-3002743 ACTGTGAGTTCCTTGAGGGCAGG - Intronic
1093078624 12:14783903-14783925 TCCCTAAGGTCCATGAGGGTAGG + Intergenic
1093818097 12:23574968-23574990 ACCATGAGCTCCTTGAGGGCTGG + Intronic
1094438076 12:30443957-30443979 ACCCTGAATTTCTTGAGGGCAGG - Intergenic
1095744750 12:45645130-45645152 ACATTAAGCTCCATGAGGGCAGG - Intergenic
1096076122 12:48806120-48806142 ACTGCAAGTTGCCTGAGGGCAGG - Intergenic
1096257072 12:50069784-50069806 ACAGTAAGCTCCATGAGGGCAGG + Intronic
1096312282 12:50531797-50531819 AAAATAAGTTGCCTGAGGGCAGG + Intronic
1096533513 12:52256629-52256651 ACTATAAGCTCCCTCAGGGCAGG + Intronic
1096625116 12:52890287-52890309 ACTGTAAGCTCCATGAGGGCAGG - Intergenic
1096672123 12:53206349-53206371 AACCTAAATTCCATGAGGCCAGG + Intronic
1096996845 12:55843512-55843534 TCCGTAAGCTCCCTGAGGGTAGG - Intergenic
1097181147 12:57172757-57172779 AACCTAAGCTCCATGAGGGTAGG + Intronic
1098847277 12:75553167-75553189 ACTATGAGTTCCTTGAGGGCAGG + Intergenic
1099127930 12:78789348-78789370 AACATAACTTCCATGAGGGCAGG + Intergenic
1099380941 12:81951594-81951616 ACCATAAACTCCATGAGGGCAGG - Intergenic
1099662456 12:85581744-85581766 GTCCTAAGATACCTGAGGGCAGG - Intergenic
1100555176 12:95686239-95686261 ACTATAAGTTCCCTGAGGGCTGG - Intronic
1100695281 12:97085960-97085982 ACTATAAGTTCCATGAGGGCAGG + Intergenic
1100737521 12:97553473-97553495 GAACTAAGTTCCATGAGGGCAGG + Intergenic
1100792378 12:98144511-98144533 ACTGTAAGCTCCATGAGGGCAGG - Intergenic
1101198428 12:102409344-102409366 AACATAAGTTCCTTGAGAGCAGG + Intronic
1101898209 12:108771286-108771308 ACTGTGAGCTCCCTGAGGGCAGG - Intergenic
1102082572 12:110110384-110110406 AATGTAAGTTCCCTGAGGGCAGG - Intergenic
1102285930 12:111656644-111656666 ACCCTAAGCTCCATGAGAGCAGG + Intronic
1102344005 12:112146816-112146838 AGGCTGATTTCCCTGAGGGCAGG + Intronic
1102387783 12:112524825-112524847 GCCATCAGTTCCCTGAGGGCTGG + Intergenic
1102747686 12:115263960-115263982 AACATAAGCACCCTGAGGGCCGG - Intergenic
1103222330 12:119256199-119256221 ACCATAAGGTCTTTGAGGGCAGG - Intergenic
1104586384 12:130051235-130051257 ACTCTGAGCTCCCTGAGGACAGG - Intergenic
1106721080 13:32435156-32435178 AACATAAATTCCATGAGGGCAGG + Intronic
1106867320 13:33979864-33979886 ACTCTAAGTTCCTTGAGGTCAGG + Intergenic
1106946853 13:34837777-34837799 AACATAAATTCCTTGAGGGCAGG - Intergenic
1107222621 13:38003512-38003534 CCTCTAAGTGCCCAGAGGGCTGG + Intergenic
1107372975 13:39772426-39772448 ACTACAAGCTCCCTGAGGGCAGG - Intronic
1107872241 13:44758066-44758088 ACCCTACTTTCCATGAGGGTAGG + Intergenic
1107886877 13:44881029-44881051 ACACTAAGTTTGCAGAGGGCAGG - Intergenic
1107978008 13:45708415-45708437 ACTGGAAATTCCCTGAGGGCAGG + Intronic
1108270137 13:48751360-48751382 ACTATGAGCTCCCTGAGGGCCGG + Intergenic
1110287922 13:73771676-73771698 ACTGTAAGCTGCCTGAGGGCAGG - Intronic
1110554384 13:76842242-76842264 ACAGTAAGCTCCATGAGGGCAGG - Intergenic
1111793171 13:92884584-92884606 ATAGTAAGTTGCCTGAGGGCAGG - Intergenic
1112041692 13:95553367-95553389 CCCCTACGTTCCCCGAAGGCTGG + Intronic
1112307481 13:98288154-98288176 ACCCTAAGCTCCATGAGAACAGG - Intronic
1112660968 13:101507230-101507252 ACCAGAAGTTCCATGAGGGCAGG + Intronic
1113276057 13:108731774-108731796 ACTGTAATTTCCCTCAGGGCAGG - Intronic
1113338813 13:109402378-109402400 ACTGGAAGCTCCCTGAGGGCAGG - Intergenic
1113763723 13:112867765-112867787 CCCCCAAGTTCCCTGAGTGCTGG - Intronic
1114415594 14:22541202-22541224 ACCTTAAGCTCCATGAGGGCAGG + Intergenic
1115443237 14:33460279-33460301 ACCCTCACTTCCCTCTGGGCAGG + Intronic
1115635353 14:35285702-35285724 ACCCTCAGCTCCCTGAAGGTGGG - Intronic
1115708090 14:36018617-36018639 ACTGTAAGCTCCCTGAGGCCAGG + Intergenic
1115807273 14:37064993-37065015 ACCATAAGTTCCTTAAGAGCAGG - Intronic
1116795225 14:49383084-49383106 TCTGTAAGTTTCCTGAGGGCAGG - Intergenic
1117271011 14:54143425-54143447 ACCCTTAGTTCCCTCCGGGATGG - Intergenic
1117560226 14:56930008-56930030 TTTGTAAGTTCCCTGAGGGCAGG + Intergenic
1117578916 14:57130989-57131011 ACCATTAATTCCATGAGGGCTGG - Intergenic
1117966716 14:61213932-61213954 ACTATAAGTTCCCAGAGAGCAGG - Intronic
1118136483 14:63033600-63033622 ACTCTGAGTTCCATGAGGTCAGG + Intronic
1118439179 14:65797699-65797721 ACTCTAAGTTCCCTGAAGGCAGG - Intergenic
1119045293 14:71313714-71313736 AAGGTAAGATCCCTGAGGGCAGG - Intergenic
1119655915 14:76416856-76416878 AGGTTAAGTTCCCTGAAGGCAGG - Intronic
1120756530 14:88249820-88249842 ACCTCAAGCTCCCTGAGGACAGG + Intronic
1120841816 14:89092310-89092332 ACTCTATGTTTCATGAGGGCAGG + Intergenic
1120861027 14:89255049-89255071 AGGCTAAGTTCCCAGAGGCCAGG + Intronic
1121001218 14:90453381-90453403 ACCCCAAGTTCCCTCAAGCCAGG + Intergenic
1121074597 14:91057458-91057480 ACTGTAAGGTCCTTGAGGGCAGG - Intronic
1121319391 14:92982200-92982222 ACCCCAAGATCCCTGTGGCCGGG + Intronic
1121829649 14:97039033-97039055 ACCCTAATGTCCATGAGGGCAGG + Intergenic
1121909414 14:97775769-97775791 AGCCTAAGTTCCTTGAGGGCAGG - Intergenic
1122025605 14:98873552-98873574 ACCAGAAGTTGCTTGAGGGCAGG + Intergenic
1122208543 14:100160236-100160258 AACTCAAGTTCCCTGAAGGCAGG - Intergenic
1122797306 14:104212490-104212512 ACCCTGGGGTACCTGAGGGCAGG + Intergenic
1123075264 14:105664769-105664791 GCCCTCAGTGCCCTGAGGGGTGG - Intergenic
1123668417 15:22628769-22628791 ACCTTAATCCCCCTGAGGGCAGG + Intergenic
1124017920 15:25893507-25893529 ACCCTAAGTTACTAGAGGGCAGG + Intergenic
1124524396 15:30435230-30435252 ACCTTAATCCCCCTGAGGGCAGG + Intergenic
1124534269 15:30530993-30531015 ACCTTAATCCCCCTGAGGGCAGG - Intergenic
1124764379 15:32476618-32476640 ACCTTAATCCCCCTGAGGGCAGG + Intergenic
1124774255 15:32572480-32572502 ACCTTAATCCCCCTGAGGGCAGG - Intergenic
1124913535 15:33946521-33946543 AATGTAAGTTCCATGAGGGCAGG - Intronic
1124997218 15:34735546-34735568 ACTCCAAGTTCCAAGAGGGCAGG + Intergenic
1125794963 15:42397295-42397317 CCCCTAAGTTCCCCGAGGACTGG + Intronic
1125899719 15:43334005-43334027 ACTGTAAGTTCCTTGAGGACAGG - Intronic
1126331997 15:47543049-47543071 ACTGTAAGTATCCTGAGGGCAGG + Intronic
1126384367 15:48078605-48078627 ATCATAAGTTCCCTGAAGTCAGG - Intergenic
1126776450 15:52104533-52104555 ACCATAATGTCCTTGAGGGCAGG - Intergenic
1127301665 15:57660755-57660777 ACCATAGCTTCCCTGAAGGCAGG - Intronic
1127710776 15:61595747-61595769 ATCATAAGTTCCTTGAGGGTAGG - Intergenic
1127762713 15:62154802-62154824 ACTGTAAGTTCCTTGAGGGCAGG - Intergenic
1127954074 15:63837221-63837243 ACCATAAGCTCCTTGAGGGCAGG - Intergenic
1128516793 15:68347240-68347262 ACTCTGAGCTCCTTGAGGGCAGG + Intronic
1128679556 15:69638112-69638134 ACTCTAAGCTCTCTGAGGGCAGG + Intergenic
1129073103 15:72968178-72968200 ACCATATATTCCCTTAGGGCTGG - Intergenic
1129180668 15:73872851-73872873 ACCCTGAGTTCCTTTAGGCCAGG - Intergenic
1129479565 15:75812192-75812214 ACTGTGAGTTCCCTGAGGGAAGG - Intergenic
1129554971 15:76498197-76498219 ACTGTAAGTTCCCTAAGGACAGG + Intronic
1129670085 15:77602841-77602863 ACTGTGAGCTCCCTGAGGGCAGG + Intergenic
1129897840 15:79121843-79121865 AGCCTGAGCTCCCTGAGGGCTGG + Intergenic
1129910678 15:79223447-79223469 GCCCTAAGCCCCTTGAGGGCGGG - Intergenic
1130034124 15:80342167-80342189 ACCCCAGGTTCTCTGAGGGAGGG - Intergenic
1130061116 15:80570780-80570802 ACTGTCAGTTCCATGAGGGCAGG + Intronic
1130103171 15:80909317-80909339 CCCCAGAGTTCCCTGAGGGAAGG - Intronic
1130132610 15:81156910-81156932 ACCATAAGCTCCCTGAGGGCAGG + Intergenic
1130663461 15:85850040-85850062 AGGCTGATTTCCCTGAGGGCTGG + Intergenic
1130697556 15:86145794-86145816 AACATAAGTTCCATGAGAGCAGG - Intronic
1131228333 15:90643095-90643117 ACCGTAAGCTCCTTGAGGGCAGG + Intronic
1131519541 15:93103073-93103095 ACCCTAAGATCCCTGGCAGCAGG - Intergenic
1131809072 15:96153547-96153569 ACTGTAAGTGCCTTGAGGGCAGG + Intergenic
1132520662 16:386440-386462 GCCCCGAGTTTCCTGAGGGCAGG + Intronic
1133328419 16:4956484-4956506 ACTGTGAGCTCCCTGAGGGCAGG - Intronic
1133442519 16:5832629-5832651 CCTGTAAGTTCCCTGAAGGCAGG + Intergenic
1133707331 16:8367309-8367331 ACTTTAAGCTCCATGAGGGCAGG - Intergenic
1134072206 16:11267333-11267355 ACTGTAAGTTCCATGAGGGCAGG + Intronic
1134198484 16:12177871-12177893 AACCTAAGCTCCGTGAGGGCAGG - Intronic
1134266924 16:12700795-12700817 ACTCTCAGCTCCCTGAGGGCAGG - Intronic
1134277971 16:12793341-12793363 ACCCTAAGTCACCAGAAGGCTGG + Intronic
1134511966 16:14855759-14855781 CCTGTAAGTTCCCTGAGGTCAGG + Intronic
1134699607 16:16254259-16254281 CCTGTAAGTTCCCTGAGGTCAGG + Intronic
1134972222 16:18540412-18540434 CCTGTAAGTTCCCTGAGGTCAGG - Intronic
1135153765 16:20033769-20033791 ACTGTAATTTCCCTGAGGGAGGG - Intronic
1135209629 16:20513319-20513341 ACCCTAAGTTCAGTGTGGGCAGG + Intergenic
1135569084 16:23534654-23534676 ACTATAAGTCCCTTGAGGGCAGG + Intronic
1135668933 16:24358627-24358649 ACTGTAAACTCCCTGAGGGCAGG - Intronic
1136043933 16:27601100-27601122 ACTCCAAGTTCCTTGAGGCCAGG + Intronic
1136393506 16:29979806-29979828 AATGTAAGTTCCATGAGGGCAGG - Intronic
1137320614 16:47377773-47377795 GTCCAAAGCTCCCTGAGGGCAGG + Intronic
1137345887 16:47659075-47659097 ACAGTAAGTTCCCTAAGAGCAGG - Intronic
1137402644 16:48165702-48165724 ATTCCAAATTCCCTGAGGGCAGG + Intergenic
1137597740 16:49736004-49736026 ACTATAAGCTCCATGAGGGCAGG + Intronic
1138108749 16:54306511-54306533 ACTGTAAGTTCCCTAAAGGCAGG + Intergenic
1138166841 16:54810176-54810198 ACTGTAAATTCCATGAGGGCAGG + Intergenic
1138318058 16:56087295-56087317 ACTACAAGTTCCTTGAGGGCAGG + Intergenic
1138855371 16:60685005-60685027 ACTATAAGCTCCATGAGGGCAGG - Intergenic
1139110164 16:63880828-63880850 ACTCCAAGTTCCTTGTGGGCAGG - Intergenic
1139245224 16:65435132-65435154 ACCCTAAGCTCCATGAGGAAAGG - Intergenic
1140195643 16:72852952-72852974 AGGGTAAGTTCCATGAGGGCAGG - Intronic
1140239952 16:73191748-73191770 ACCCTGAATTCCCTGTGGTCTGG + Intergenic
1140844083 16:78870172-78870194 ACCCTAAGATCCTGGATGGCAGG + Intronic
1140913033 16:79470488-79470510 ACCACAAGTTCCTGGAGGGCAGG + Intergenic
1140973600 16:80037735-80037757 ACAGTAAGTTCCCTGAGGGCAGG + Intergenic
1141053403 16:80793644-80793666 ACCCTAAGCTCGGTGAGGGCAGG - Intronic
1141805720 16:86340270-86340292 ACTCTAAGCTTCCGGAGGGCAGG + Intergenic
1141851208 16:86647271-86647293 ACCAGAAGCTCCCTGAAGGCAGG - Intergenic
1142601310 17:1054360-1054382 ACTGTGAGTTCTCTGAGGGCGGG - Intronic
1142832071 17:2556587-2556609 ACTATAAGCTCCATGAGGGCAGG - Intergenic
1143204163 17:5131341-5131363 ATCCTATGATCCCTGAGGGTTGG - Intronic
1143204277 17:5131759-5131781 ATCCTATGATCCCTGAGGGATGG - Intronic
1143331872 17:6143323-6143345 ACCGTAAGCAACCTGAGGGCAGG - Intergenic
1143472877 17:7186894-7186916 ACCCAAAGTTCCCTAAGGACAGG + Intergenic
1143569169 17:7743962-7743984 AGCCTAACCTCCCTGAGGGCAGG - Intronic
1143708071 17:8714237-8714259 ACCGTAAGCTCCATGAGAGCAGG - Intergenic
1143795470 17:9332800-9332822 AATATAAGCTCCCTGAGGGCAGG + Intronic
1143874367 17:9980714-9980736 ACTGTAAGCTCCCTGAGGGTGGG - Intronic
1143877871 17:10006219-10006241 ACTCTAGGTTCCTTGAAGGCAGG + Intronic
1144068744 17:11647692-11647714 ACCGTGGGTTCCTTGAGGGCAGG - Intronic
1144215100 17:13048434-13048456 ACTGTAAGCTACCTGAGGGCAGG + Intergenic
1144956335 17:19020751-19020773 ACCCTTAGAACCCTGAGTGCTGG - Exonic
1145799047 17:27671844-27671866 ATCCTATGATCCCTGAGGGATGG + Intergenic
1146160015 17:30554747-30554769 ATCCTATGATCCCTGAGGGATGG - Intergenic
1146400822 17:32498603-32498625 ACCGTAAATTCCACGAGGGCAGG - Intronic
1146539474 17:33681835-33681857 AACATAAGATCCTTGAGGGCAGG + Intronic
1146642464 17:34551518-34551540 ATTGTAAGTTCCCAGAGGGCAGG - Intergenic
1146662740 17:34675378-34675400 AGCCCAGGTTCACTGAGGGCTGG + Intergenic
1147360347 17:39926301-39926323 ACACTAGGTGCCCTGAGAGCAGG + Exonic
1148155581 17:45423671-45423693 ACAGTAAGCTACCTGAGGGCAGG + Intronic
1148694337 17:49550017-49550039 ACCTCGAGCTCCCTGAGGGCAGG + Intergenic
1148775487 17:50093126-50093148 ACTTTAAGCTCCGTGAGGGCAGG - Intergenic
1149514061 17:57266728-57266750 AATGTAAGCTCCCTGAGGGCAGG + Intronic
1150162737 17:62913082-62913104 TCTCTAAGTTCCTTGAGGTCAGG - Intergenic
1150387268 17:64772333-64772355 ACAGTAAGCTACCTGAGGGCAGG + Intergenic
1151558114 17:74857063-74857085 ACTCTAAGTTCCTGGAGGGCAGG - Intronic
1151714637 17:75825164-75825186 ACCCTCAGGAACCTGAGGGCTGG - Exonic
1151715072 17:75827145-75827167 GCTCAAAGTCCCCTGAGGGCTGG + Intergenic
1151890084 17:76946590-76946612 TCCCAGAGTTCCCTCAGGGCTGG + Intronic
1153009242 18:523053-523075 ACACTAAGATCCTTGAGGGTGGG - Intergenic
1153334817 18:3912508-3912530 ACTGTAAGCTCCCTGAGGGAAGG - Intronic
1153565779 18:6415449-6415471 GCCATAAGTTCCATGAGGGCAGG - Intergenic
1153589955 18:6663145-6663167 ACTCTAAGCTCCCTGAGGACAGG - Intergenic
1153809656 18:8740826-8740848 ACTCTAGGCTTCCTGAGGGCAGG + Intronic
1154131208 18:11738392-11738414 ACACCAAGCTCCCTGAGGGGAGG + Intronic
1155439924 18:25851648-25851670 ACTGTAAGCTCCTTGAGGGCAGG + Intergenic
1155545051 18:26906179-26906201 ACTCTAAGTTATCTGAGGTCAGG - Intergenic
1155575398 18:27240432-27240454 TCTGGAAGTTCCCTGAGGGCTGG - Intergenic
1156136954 18:34052972-34052994 AGCCCAAGATCCCTGAGGGAAGG + Intronic
1156484427 18:37455924-37455946 ACGGGAAGGTCCCTGAGGGCTGG + Intronic
1156801467 18:41119892-41119914 ACTCTAAATTTCCTGAGGGCTGG + Intergenic
1156882565 18:42098482-42098504 ACTGTAAGTTCCCTGAAGGCAGG + Intergenic
1157194165 18:45606931-45606953 TCCCTCAGTTCCTGGAGGGCAGG + Intronic
1157211813 18:45749299-45749321 ACTCTAAGTTCCTTGAGGGTAGG - Intronic
1157283849 18:46363737-46363759 ACTATAAGCTCCTTGAGGGCAGG + Intronic
1157323923 18:46655776-46655798 ACCCTAAACTCCGTGAGGGTGGG - Intronic
1158107925 18:53906130-53906152 ACCCAAAGTTCCCTTGGGGATGG + Intergenic
1158313699 18:56187432-56187454 CCTTTAAGTTCCTTGAGGGCAGG + Intergenic
1158376499 18:56875737-56875759 CCCTTAAGTTCAATGAGGGCAGG + Intronic
1159047354 18:63382085-63382107 ACTGTAAGTTTCTTGAGGGCAGG + Intergenic
1159496059 18:69206859-69206881 ACTGTAAGTGCACTGAGGGCAGG - Intergenic
1159575851 18:70176289-70176311 AAACTAAGTTCCATGAGGCCAGG + Intronic
1160477728 18:79207835-79207857 GCCATAAGCTCCCTGAGGACAGG - Intronic
1161099997 19:2416744-2416766 TCCAGAAGTTCCCTGTGGGCCGG + Exonic
1163122971 19:15229042-15229064 ACTGTCAGCTCCCTGAGGGCAGG - Intronic
1163166348 19:15500675-15500697 ACTCTAAGTTCCTTCAGGGTTGG + Intergenic
1163258137 19:16170213-16170235 CCCCTAACCTCCCTGGGGGCAGG + Intronic
1163353843 19:16796829-16796851 ACTGTAAGTTCCTGGAGGGCAGG - Intronic
1163568134 19:18063956-18063978 ACCCTCAGTGGCCTGCGGGCTGG - Exonic
1164473621 19:28555784-28555806 ACTGCAAGTTCCCTGGGGGCAGG - Intergenic
1164793598 19:31008369-31008391 GCAGTAAGTTCCCTGAAGGCAGG - Intergenic
1165020946 19:32923702-32923724 ACCGTAAGCTCCCTGAGAGCAGG - Intronic
1165206210 19:34189056-34189078 ACTGTAACTTCCCTGAGGGTGGG + Intronic
1165329189 19:35131902-35131924 ACCCTGTGTTCCCTGGGGGGTGG + Intronic
1165700107 19:37930926-37930948 ACTATAAGCTCCCTGTGGGCAGG + Intronic
1165822063 19:38682997-38683019 ACTGTAAGTTGCATGAGGGCAGG + Intronic
1166116874 19:40661742-40661764 ACTCTGAGTTCCCTGAAGGCAGG + Intergenic
1166321008 19:42018885-42018907 ACCCTGAGTCCCACGAGGGCGGG + Intronic
1166326730 19:42055538-42055560 ACTGTAAGTTCCATGAGGGCAGG - Intronic
1166377648 19:42336658-42336680 ACTAGAAGTTCCCTGTGGGCAGG - Intronic
1166644392 19:44520308-44520330 AACATAAGCCCCCTGAGGGCAGG + Intronic
1166929228 19:46291384-46291406 AGTGTAAGTTCCATGAGGGCAGG + Intergenic
1167031919 19:46968016-46968038 ATCCTAAGTTCCTTGAGGGAAGG + Intronic
1167688849 19:50973039-50973061 ACCGTGAGCTCCTTGAGGGCAGG + Intergenic
1167732129 19:51265972-51265994 ACCCTAAGCTCCTTGAGGGGAGG - Intronic
1168150918 19:54448297-54448319 CCCCGAAGGTCCCTGAGGTCAGG - Intergenic
1168430935 19:56279311-56279333 ACTGTAAGTTCCTAGAGGGCAGG + Intronic
1168490770 19:56807009-56807031 ACTCTTGGTTCCATGAGGGCAGG + Intronic
926142208 2:10374507-10374529 ACCGTCAGCTCCCTGAGGGCAGG - Intronic
926529027 2:14018606-14018628 ACCATGAGTTCCTTGAGGGCTGG - Intergenic
926913679 2:17873971-17873993 ACTGTGAGTTCCTTGAGGGCAGG - Intergenic
926950659 2:18239761-18239783 ACAGTAAGTTCCATGAGGGCAGG - Intronic
927099774 2:19779194-19779216 ACTGTAAGCTCCCTGAGAGCAGG - Intergenic
927484598 2:23479816-23479838 ACCCTGAGCTCACTGAGGACAGG + Intronic
927555916 2:24031993-24032015 GCTGTAAGTTCCCTAAGGGCAGG + Intronic
927647220 2:24885634-24885656 ACCCTTACTTCCCACAGGGCTGG + Intronic
927728506 2:25448233-25448255 ACTGTTAGTTCCATGAGGGCAGG + Intronic
927839939 2:26434567-26434589 ATTATAAGTTCCTTGAGGGCAGG - Intronic
927875082 2:26649912-26649934 ACTCTAACCTCCCTGAGGCCAGG - Intergenic
927943199 2:27118661-27118683 CCCCTGTGTACCCTGAGGGCAGG - Intronic
927976712 2:27343960-27343982 AATGTAAGTTCCATGAGGGCAGG - Intronic
928172148 2:29010712-29010734 AACCTGAGCTCCCGGAGGGCGGG + Intronic
928264203 2:29797549-29797571 ACTCTAGGATCCCTGAAGGCAGG + Intronic
929015281 2:37487449-37487471 AATATAAGTTCCCTGAGGGCAGG + Intergenic
929579747 2:43074330-43074352 ACTCCAAGTTCCAAGAGGGCAGG - Intergenic
929584322 2:43104270-43104292 ACTCGAAGCTCCATGAGGGCAGG + Intergenic
929600433 2:43201113-43201135 ACCCTGGGTTTTCTGAGGGCGGG + Intergenic
929645090 2:43618232-43618254 ACCATAACTTCCTTGAAGGCAGG + Intergenic
931078269 2:58740901-58740923 ATGTTAAGTTCCCTTAGGGCAGG - Intergenic
931373011 2:61681719-61681741 AACATAGGTTCCATGAGGGCAGG - Intergenic
931549955 2:63432419-63432441 ACACTAAGATCCTTGAAGGCAGG + Intronic
931618299 2:64183832-64183854 ACCCTAAGCTCCTTGAAGGCAGG + Intergenic
931666295 2:64611820-64611842 AATCTAAGTTCCCTGGGAGCTGG + Intergenic
932073901 2:68645548-68645570 ACCCTATGTTCACTCTGGGCAGG + Intronic
932281505 2:70496820-70496842 GACTTAAGTTCCTTGAGGGCAGG - Intronic
932398503 2:71464150-71464172 ACTGGAAGCTCCCTGAGGGCAGG + Intronic
932607304 2:73173999-73174021 ATGCTGAGCTCCCTGAGGGCAGG - Intergenic
932845194 2:75128031-75128053 ACGGTAAGCTTCCTGAGGGCAGG + Intronic
933425048 2:82100138-82100160 AGCCTAAGTACCGTCAGGGCAGG + Intergenic
933762235 2:85680315-85680337 AAAGTAAGTTCCATGAGGGCAGG + Intergenic
933837195 2:86255619-86255641 ACCAGAAGCTCCATGAGGGCAGG - Intronic
933998598 2:87687993-87688015 TCCCCAGGTTCCCTGAGGGTAGG + Intergenic
935009445 2:99118776-99118798 ACAAAGAGTTCCCTGAGGGCAGG - Intronic
935067663 2:99664803-99664825 ACTGGAAGTTTCCTGAGGGCAGG - Intronic
935815033 2:106839340-106839362 TTCCTAACTCCCCTGAGGGCTGG - Intronic
936160937 2:110083749-110083771 AACCTAAGTTCTCTGAGGGTGGG - Intergenic
936183726 2:110287605-110287627 AACCTAAGTTCTCTGAGGGTGGG + Intergenic
936295250 2:111262877-111262899 TCCCCAGGTTCCCTGAGGGTAGG - Intergenic
936903928 2:117514911-117514933 AACATAAATTCCCTGAGGCCTGG + Intergenic
937042029 2:118829901-118829923 ACCCTGGGTTACCTGAGGGAAGG + Intergenic
937346709 2:121130473-121130495 ACCCCAACCTTCCTGAGGGCAGG - Intergenic
937636692 2:124164209-124164231 ACTGTAAGTTCCATGAAGGCAGG - Intronic
939677262 2:145088039-145088061 ATTCTAAGTTCCCTGTGGACAGG - Intergenic
940013464 2:149079147-149079169 ACTCTAAGCTCTGTGAGGGCGGG + Intronic
940742903 2:157531937-157531959 ACTTTAAAATCCCTGAGGGCAGG + Exonic
941666975 2:168251857-168251879 AATATAAGCTCCCTGAGGGCAGG + Intergenic
941769954 2:169334660-169334682 ACTCTAAGTTCCATGAGGGCAGG + Intronic
941892048 2:170592657-170592679 ACCATAAGGTTCATGAGGGCAGG + Intronic
943626872 2:190211018-190211040 AAAGTAAGTTCCATGAGGGCAGG + Intronic
943736986 2:191366937-191366959 ACTCTAAGCTCCTGGAGGGCAGG + Intronic
944450215 2:199834760-199834782 ACTCTTATTTCCCTGAGGGGAGG + Intronic
944772286 2:202926223-202926245 ACCCTAGGTTCCCTTAAGGGTGG - Intronic
946047410 2:216832822-216832844 AACGTAAGTTACTTGAGGGCAGG - Intergenic
946219753 2:218216635-218216657 ACTGTAAGTTCCACGAGGGCAGG + Intergenic
946883089 2:224195656-224195678 ACTGTAAGTACCATGAGGGCAGG + Intergenic
948486180 2:238282726-238282748 AATGTAAGCTCCCTGAGGGCAGG - Intronic
948509182 2:238451913-238451935 GCCCCAAGTTCCCTCAGAGCAGG - Exonic
948583902 2:239006559-239006581 ACTCTAAGCTCCCTGGGAGCAGG + Intergenic
1168754727 20:308395-308417 ACTTTGAGCTCCCTGAGGGCAGG + Intergenic
1168792083 20:584849-584871 ACAGCAAGCTCCCTGAGGGCAGG + Intergenic
1168897150 20:1331445-1331467 ACCCTAAGTTCCCTGAGGGCAGG + Intronic
1168961011 20:1869930-1869952 ACCATAAGTTCCCTGGGAGACGG - Intergenic
1168974833 20:1956446-1956468 AGCCTAACTTCCCTGTGGGCAGG - Intergenic
1168975557 20:1962944-1962966 ACCCTAAGTCACCTGAGGGCTGG - Intergenic
1169022005 20:2337055-2337077 ACCGTAAACTCCATGAGGGCAGG + Intronic
1169172554 20:3477010-3477032 AATGTAAGTTCCATGAGGGCAGG + Intronic
1169172567 20:3477087-3477109 AATGTAAGTTCCATGAGGGCAGG + Intronic
1169172580 20:3477164-3477186 AATGTAAGTTCCATGAGGGCAGG + Intronic
1169172593 20:3477241-3477263 AATGTAAGTTCCATGAGGGCAGG + Intronic
1169172606 20:3477318-3477340 AATGTAAGTTCCATGAGGGCAGG + Intronic
1169172619 20:3477395-3477417 AATGTAAGTTCCATGAGGGCAGG + Intronic
1169172632 20:3477472-3477494 AATGTAAGTTCCATGAGGGCAGG + Intronic
1169172645 20:3477549-3477571 AATGTAAGTTCCATGAGGGCAGG + Intronic
1169172658 20:3477626-3477648 AATGTAAGTTCCATGAGGGCAGG + Intronic
1169172671 20:3477703-3477725 AATGTAAGTTCCATGAGGGCAGG + Intronic
1169472221 20:5896511-5896533 AGTCTAAGCTCCATGAGGGCAGG - Intergenic
1169712548 20:8581154-8581176 ACTTTAAGTTCTCTGAGGGTAGG + Intronic
1170040239 20:12032692-12032714 ACCATGAGCTCCCTGAAGGCAGG - Intergenic
1170327416 20:15171848-15171870 ACTCTAAGTTCCCTGAAGACTGG + Intronic
1170469566 20:16654956-16654978 TCCATGAATTCCCTGAGGGCTGG + Intergenic
1171399841 20:24865739-24865761 ACTCTGTGTTTCCTGAGGGCAGG - Intergenic
1172053344 20:32136832-32136854 CTCTTAAGTTCCCTGAGGTCAGG - Intronic
1172795985 20:37537970-37537992 ACTGTAAGCTCCATGAGGGCAGG + Intergenic
1173834368 20:46115630-46115652 ACTGTGAGCTCCCTGAGGGCAGG - Intergenic
1173870031 20:46335696-46335718 ACTCGAAGTTCCTTGAGGGCAGG + Intergenic
1174158500 20:48533528-48533550 AGTGTAAGCTCCCTGAGGGCAGG + Intergenic
1174251907 20:49226206-49226228 ACTGTAAGATTCCTGAGGGCAGG + Intronic
1174764790 20:53242924-53242946 ACTGTAAGCTCCCAGAGGGCAGG - Intronic
1174899965 20:54488887-54488909 ACAGTAAGTTCTCTGAGGCCAGG + Intronic
1174901480 20:54505522-54505544 ACTGTAAGCTCCATGAGGGCAGG - Intronic
1175296593 20:57913088-57913110 AGTCTAAGATTCCTGAGGGCAGG - Intergenic
1175383537 20:58579860-58579882 TGCTTAAGCTCCCTGAGGGCAGG - Intergenic
1175424592 20:58855485-58855507 ACCCTAACTGCCCTGGGAGCGGG + Intronic
1175522446 20:59610718-59610740 ATTGTAAGCTCCCTGAGGGCAGG + Intronic
1175830877 20:61965171-61965193 ACCCTAGATGCCCTGAGGTCCGG + Intronic
1175960451 20:62634007-62634029 ACCTGAAGTTCCCAGAAGGCAGG + Intergenic
1177145539 21:17403581-17403603 GGCCTAAGTTCCCTGAAGGAGGG - Intergenic
1178421992 21:32450634-32450656 ACCCTGAGTTCCCTGGGGCAGGG + Intronic
1178640072 21:34338332-34338354 ACCCTACGCTCCTTGAAGGCAGG + Intergenic
1179541090 21:42083656-42083678 AATATAAGTTCCCTGAAGGCTGG + Intronic
1180181826 21:46121545-46121567 TCCCCGAGATCCCTGAGGGCAGG - Exonic
1181184462 22:21092840-21092862 ACTATAAGCTCCTTGAGGGCAGG + Intergenic
1181343164 22:22198886-22198908 TCCCTGAGGTCCCTGAGGGATGG - Intergenic
1181345233 22:22215137-22215159 TCTCTGAGATCCCTGAGGGCCGG - Intergenic
1181775631 22:25158381-25158403 ACTGTAAGCTCCCTGAGGTCAGG - Intronic
1181857196 22:25790520-25790542 GCCCTAAGTTCCATGAGGGTGGG + Intronic
1181928020 22:26375909-26375931 ACCATAACCTCCTTGAGGGCAGG - Intronic
1181970584 22:26686896-26686918 ACTATGAGTTCCTTGAGGGCAGG + Intergenic
1182371461 22:29814235-29814257 ACTCTAAATTCCATGAGCGCAGG + Intronic
1182437732 22:30341396-30341418 GCAGTGAGTTCCCTGAGGGCTGG + Intronic
1182879958 22:33724802-33724824 ACTGTAAACTCCCTGAGGGCAGG - Intronic
1183144746 22:35979982-35980004 AGCCTGAATTCCTTGAGGGCAGG - Intronic
1183462361 22:37959632-37959654 ATCACAAGCTCCCTGAGGGCAGG - Intronic
1183567160 22:38623730-38623752 ACCATGAGTTCCCTGAGAACAGG + Intronic
1183775035 22:39958441-39958463 AATGTAAGCTCCCTGAGGGCAGG + Intronic
1184007826 22:41723659-41723681 ACTATAAGTTTCATGAGGGCAGG - Intronic
1184184304 22:42854161-42854183 ACTATAAGTTCCCTGAGGACAGG + Intronic
1184196142 22:42929999-42930021 GACCTAAGATCCTTGAGGGCAGG + Intronic
1184495580 22:44839273-44839295 CCCCGAGGTGCCCTGAGGGCTGG - Intronic
1184556609 22:45236603-45236625 ACCCTCAGCACCCTGAGGACGGG + Intronic
1184950253 22:47836889-47836911 ACAGTAAGATTCCTGAGGGCAGG + Intergenic
1203289053 22_KI270735v1_random:16910-16932 ACCTTAGGGACCCTGAGGGCTGG - Intergenic
949507675 3:4742221-4742243 ACCCCAAGGTCACTGAAGGCTGG - Intronic
949780275 3:7678981-7679003 GCCTTAAGTTCCATGAAGGCAGG - Intronic
949862515 3:8519120-8519142 ACTGTAAGCTCCATGAGGGCAGG - Intronic
950029237 3:9841004-9841026 GCTCTGAGTTCCCTGGGGGCCGG - Intronic
950055602 3:10021819-10021841 AGAACAAGTTCCCTGAGGGCAGG - Intergenic
950056410 3:10028223-10028245 ACTGTAAATTCCCTGAGGACAGG + Intronic
950138031 3:10596306-10596328 AACCAAAGTTCTATGAGGGCAGG + Intronic
950206013 3:11081694-11081716 ACTTTAAGCTCCCTGAGGGCAGG + Intergenic
950425111 3:12920968-12920990 ACCTCAAGGTCCCGGAGGGCAGG - Intronic
950635154 3:14308913-14308935 ACCAGGAGTTCCTTGAGGGCAGG - Intergenic
951432898 3:22628557-22628579 GCTCTAAGCTCCTTGAGGGCAGG + Intergenic
951569216 3:24044496-24044518 ACTGTAAGCTCCCAGAGGGCAGG - Intergenic
951849798 3:27126498-27126520 ACCATAAGTTCACAGTGGGCAGG + Intronic
952068571 3:29603713-29603735 ACCATAAGTTTCCTCAGGTCTGG - Intronic
952299693 3:32093387-32093409 ACTGTAAGTTCCATGAGGGCAGG + Intergenic
952322994 3:32295623-32295645 ACTGTAAGTTCCTTGGGGGCAGG + Intronic
952399089 3:32947466-32947488 GCCCTAATTGCCCTGAGGCCAGG + Intergenic
952865655 3:37853618-37853640 ACACTAACTTCCCAGAGGCCTGG - Intergenic
952883355 3:37998733-37998755 TCTCTGAGGTCCCTGAGGGCAGG - Intronic
952885901 3:38010779-38010801 ACTCTAAGACCCCTGAGGACAGG + Intronic
953164720 3:40454701-40454723 AGAATAAGTTCCATGAGGGCAGG - Intergenic
953392873 3:42543941-42543963 ACCCTCAGCTCCCAGAGGCCTGG - Intergenic
953918103 3:46933437-46933459 ACCCAAAGGCCCCTGAGGGATGG + Intronic
954222750 3:49164610-49164632 AACCTAGGTTCCTTGAGGACAGG - Intronic
954420742 3:50417810-50417832 CCCACAAGGTCCCTGAGGGCAGG + Intronic
955143959 3:56297727-56297749 ACTGTGAGTTCCCTGTGGGCAGG - Intronic
955147623 3:56335896-56335918 ACCATAAGCTTCCTGAAGGCTGG - Intronic
955341435 3:58128461-58128483 ACAGTAAGCTCCCTGAGGGCAGG - Intronic
955564000 3:60224643-60224665 ACCATAATCTCCATGAGGGCAGG + Intronic
955632239 3:60986951-60986973 ACCATAAGCTCCTTGAGGGAAGG + Intronic
955743624 3:62119070-62119092 ACCAGAAGCTCCCTGAGGGCAGG - Intronic
955770677 3:62381768-62381790 AATGTAAGTTCCATGAGGGCAGG - Intergenic
955917130 3:63917685-63917707 AGAGTAAGTTCCCTGAGGGCAGG + Intronic
955983616 3:64551155-64551177 ATCATAAGAGCCCTGAGGGCAGG + Intronic
956193930 3:66633316-66633338 ACCGTGAGTTCCTTGAAGGCAGG + Intergenic
956384522 3:68702709-68702731 ACTCTAAGCTCCTTGAGGGCAGG - Intergenic
956463005 3:69490737-69490759 ATCATATGTTCCCTGAGGACGGG + Intronic
957325094 3:78681423-78681445 ACATTAAGTTCCATGAAGGCAGG - Intronic
957579355 3:82050761-82050783 GCCATAAGTTCCATGAGGGCAGG - Intergenic
957848550 3:85773732-85773754 ACTTTAAGTTCCGTGAGTGCTGG + Intronic
958116047 3:89219540-89219562 AATCTAAGTTCCTTGAGGGCAGG - Intronic
959632699 3:108526522-108526544 AGCACAAGCTCCCTGAGGGCAGG - Intronic
960925446 3:122791516-122791538 ATCATAAGTACCTTGAGGGCAGG - Intronic
960957789 3:123046492-123046514 ACCATAAGTTCCGTGAGGATGGG - Intergenic
961125732 3:124416033-124416055 ACAGTAAGTACCATGAGGGCAGG - Intronic
961854390 3:129854874-129854896 ACCCTAAGTTCCATGGGGGAAGG + Intronic
961959969 3:130844658-130844680 AACATAAGCTCCATGAGGGCAGG - Intergenic
962259057 3:133891596-133891618 ACTATAAGTTCCAGGAGGGCAGG + Intronic
962686017 3:137848303-137848325 ACCCTACAATCTCTGAGGGCAGG + Intergenic
962731264 3:138285700-138285722 AGCGTAAGTTCCATGAGGGCAGG + Intronic
962848993 3:139293925-139293947 ACTATAAGCTCCCTGAAGGCAGG - Intronic
962892441 3:139684148-139684170 ACCATAAGCTCCTTGAAGGCAGG - Intergenic
964155117 3:153575860-153575882 ACCTTAACTTCCCAAAGGGCTGG - Intergenic
965378671 3:167959902-167959924 AATTCAAGTTCCCTGAGGGCAGG - Intergenic
965612330 3:170557480-170557502 ACTATGAGATCCCTGAGGGCAGG - Intronic
966010252 3:175066405-175066427 ACCGGAAGTTCCATGAGGGCAGG + Intronic
966212301 3:177466053-177466075 ACTGTGAGTTCCTTGAGGGCAGG - Intergenic
966472784 3:180310796-180310818 ACCCTCAGTTCCTTGAAGTCAGG - Intergenic
966675450 3:182582510-182582532 ACTCTAAGTTCCTTGAGAGGAGG + Intergenic
966770845 3:183501895-183501917 ACCGTAAGGCCCCTGATGGCAGG + Intronic
966820130 3:183917620-183917642 AGCTAAAGTTCCCGGAGGGCAGG + Intergenic
966930940 3:184675100-184675122 ACCATAAGTCCTCTGAGGGCAGG - Intronic
967953281 3:194857296-194857318 AACCTAAGTTACCAGAGGACTGG + Intergenic
969050457 4:4369315-4369337 ACCCTAAGCCCACTGAGTGCTGG + Intronic
969059910 4:4426230-4426252 ACCCTGAGCTTCCTGAGGGCGGG + Intronic
969061298 4:4437365-4437387 ACTGTGAGCTCCCTGAGGGCAGG + Intronic
969199431 4:5590844-5590866 ACTATAAGTTTCCTGAGGGCTGG - Intronic
969407135 4:7001006-7001028 ACTCTAAGCTTCCTGAGGGCAGG + Intronic
970163953 4:13216518-13216540 AATGTAAGTTCACTGAGGGCAGG - Intergenic
970664442 4:18320562-18320584 ACAGTGAGTTCCTTGAGGGCAGG + Intergenic
970879982 4:20917489-20917511 GCCATAAGCTTCCTGAGGGCAGG - Intronic
971165355 4:24176939-24176961 ATGGTAAGTTCCTTGAGGGCAGG + Intergenic
971794591 4:31210371-31210393 AACCTAAGTTTCCTGAGTCCTGG - Intergenic
972463398 4:39328337-39328359 ACTTTAAGTTCCATGAGGGCAGG - Intronic
972476649 4:39456888-39456910 GCCTTAAGTTCCTTGAAGGCAGG - Intronic
972690784 4:41395799-41395821 AACCTAAGTTCCCAGAAGGCAGG - Intronic
972866763 4:43242526-43242548 AATATAAGTTCTCTGAGGGCAGG + Intergenic
973318684 4:48787804-48787826 ACCATAAGCTCCATGAGGACAGG - Intergenic
973340290 4:48996405-48996427 ACACTAAGTCCCTTGAGGGCAGG + Intronic
973906261 4:55534634-55534656 AACATAAGCTCCCTGAAGGCAGG + Intronic
974322934 4:60375689-60375711 ACAATAAGATCCTTGAGGGCGGG - Intergenic
974443959 4:61954883-61954905 ACCATAAATTCTCTGAGGCCAGG - Intronic
974882861 4:67780897-67780919 ACTCCAAGTTCACTGAGGGCTGG - Intergenic
975545243 4:75554184-75554206 ACTATAAGTTCCATGAGAGCAGG + Intergenic
975633778 4:76425764-76425786 AACGTAAGTTCCATGAGGGCAGG - Intergenic
975712114 4:77171187-77171209 ACTGTAAGTTCCTCGAGGGCAGG - Intronic
975823945 4:78300426-78300448 ACCGTAAGCTCCATGAGGGCAGG - Intronic
976374336 4:84327053-84327075 ACGGCAAGTTTCCTGAGGGCAGG - Intergenic
976456079 4:85248017-85248039 ATCATAAGTTCCTTGAGAGCAGG + Intergenic
976698956 4:87948376-87948398 ATCCTATGTTCCCTGAGGACTGG + Intergenic
977547627 4:98402855-98402877 ACTATAAGCTCCTTGAGGGCAGG - Intronic
978625467 4:110680259-110680281 ATTGTGAGTTCCCTGAGGGCTGG - Intergenic
978827808 4:113046007-113046029 ACTCTAAGCTCCTTGAGGGCAGG - Intronic
979235107 4:118391037-118391059 ACTCTAAGTACCATGAGAGCAGG - Intergenic
979397442 4:120205523-120205545 AATGTAAGTTTCCTGAGGGCAGG - Intergenic
979408988 4:120351188-120351210 AGCCTGAATTCCCTGATGGCAGG - Intergenic
980106924 4:128596663-128596685 ACCATAAGCTCACTGAAGGCAGG + Intergenic
980801831 4:137761552-137761574 AACATAAGTTCTGTGAGGGCAGG + Intergenic
980893508 4:138839101-138839123 ATCATAAGTTCCTCGAGGGCAGG + Intergenic
981190035 4:141851638-141851660 TCCCTAATTTCCCTGAGGCCAGG - Intergenic
982071539 4:151699581-151699603 AGCATAAGCTCCATGAGGGCAGG - Intronic
982216518 4:153087112-153087134 ACTGTAAGATCCCTGTGGGCAGG - Intergenic
982241991 4:153309077-153309099 ACTGTAAGTTGCTTGAGGGCAGG - Intronic
982366517 4:154585362-154585384 ACTGTAAGTTCCTTGGGGGCAGG - Intronic
983494733 4:168429899-168429921 ATTATAAGTTCCCTGAAGGCTGG + Intronic
983596753 4:169476376-169476398 ACCTTAAGCTCCCTAAGGGGAGG + Intronic
984242295 4:177232282-177232304 CCTCAAAGTTCCCTGAGGACTGG - Intergenic
984469872 4:180154863-180154885 ACACTAAGTTGCTTGAGGGTGGG - Intergenic
984747687 4:183238857-183238879 TCTGTAAGATCCCTGAGGGCAGG + Intronic
984947828 4:184983602-184983624 ACCCTGAGTTCCTAAAGGGCAGG + Intergenic
987168399 5:15225358-15225380 ACCATAAGTTCCATGAGCACAGG + Intergenic
988925863 5:35990778-35990800 ACCCTAAGCTCCATGGGGCCGGG - Intronic
988994393 5:36700837-36700859 ACTCTGAATTTCCTGAGGGCAGG - Intergenic
990316849 5:54590830-54590852 ATCCTGAGCTCCATGAGGGCAGG + Intergenic
991024491 5:62015177-62015199 ACTGTAAGTTCTCTGAGTGCTGG - Intergenic
991554652 5:67881798-67881820 ACTCTAAGTTCTTTGAGGGCAGG - Intergenic
992177883 5:74168641-74168663 AACCTAAATTCCCTGGGGGCTGG + Intergenic
992273005 5:75085254-75085276 ACCATAAGCTCCTTGAGGACAGG + Intronic
992484028 5:77178869-77178891 ACCCTCAGTTCCCTGCCGGGTGG + Intergenic
992625465 5:78632704-78632726 ACTGTAAGCTCCCTGAGGGCAGG - Intronic
993648349 5:90486830-90486852 AATGTAAGTTCCCTGTGGGCAGG + Intronic
993771445 5:91932816-91932838 ACTCTTAGCTCCATGAGGGCAGG + Intergenic
993857963 5:93098830-93098852 AACATAAGCTCCATGAGGGCAGG + Intergenic
994059203 5:95455534-95455556 ACTATAAATTCCCTGAAGGCAGG - Intergenic
994093396 5:95827673-95827695 ACAGTGAGTTCCTTGAGGGCAGG + Intergenic
994365259 5:98908446-98908468 ACCTTATGTTCCTTGAGCGCTGG + Intronic
994699263 5:103112884-103112906 ACCATAAGCTCCGTGAGGACAGG - Intronic
995526807 5:113056855-113056877 AATATGAGTTCCCTGAGGGCAGG - Intronic
997592860 5:135086352-135086374 ACTGTGAGCTCCCTGAGGGCAGG - Intronic
997604465 5:135164134-135164156 AATGTAAGTTCCCTGAGGACAGG - Intronic
997633205 5:135385551-135385573 ACCCTAAGCTGCTTGAAGGCTGG + Intronic
997699490 5:135886772-135886794 ATACTAAGCTCCCTGAGGGCAGG - Intronic
997751323 5:136348569-136348591 ACAATAAGGTCCTTGAGGGCAGG + Intronic
997782563 5:136674993-136675015 ACCGTGAGCTCCATGAGGGCAGG - Intergenic
998182701 5:139956458-139956480 ACTCTAAGGTCCTTGAGGGAAGG + Intronic
998496632 5:142595824-142595846 ACTGTAAGTACCTTGAGGGCAGG + Intronic
998819590 5:146046644-146046666 ACTGTAAATTCCATGAGGGCAGG - Intronic
998888800 5:146723972-146723994 ACTGTAAGTTCCTTGAAGGCAGG + Intronic
999474407 5:151885319-151885341 ACTGTAAGTTCCTTGGGGGCTGG - Intronic
1000197440 5:158973136-158973158 AACGTAAGCTCCATGAGGGCAGG + Intronic
1000353562 5:160371886-160371908 ACTCTAAGTTTCATGAGGGTAGG - Intergenic
1000779090 5:165457095-165457117 ACTTTAAGTTCCATGAGGGCAGG + Intergenic
1000987216 5:167874253-167874275 ACTATAAGCTCTCTGAGGGCAGG + Intronic
1001403097 5:171457982-171458004 AAGTGAAGTTCCCTGAGGGCTGG - Intergenic
1001788802 5:174437026-174437048 ACACTAAATTCCCTGGGGGTGGG + Intergenic
1002100772 5:176856506-176856528 ACCATAAACTCCCTGGGGGCAGG - Intronic
1002109163 5:176896503-176896525 ACTGTGAGGTCCCTGAGGGCAGG - Intronic
1002311926 5:178320212-178320234 AACATCAGCTCCCTGAGGGCAGG + Intronic
1002424374 5:179166764-179166786 AGCCTAAGCTCCTTGAGGGCCGG + Intronic
1003181097 6:3792377-3792399 ACAATAAGTTCCATGAGGGTAGG - Intergenic
1003248727 6:4405870-4405892 ACACTAAGCTCCCTGAGCGGGGG + Intergenic
1003424480 6:5988833-5988855 ACCATACGTTCCTTGAGGTCAGG - Intergenic
1003466893 6:6389244-6389266 ACTATATGTTCCATGAGGGCAGG + Intergenic
1003685435 6:8297717-8297739 ACTCTGAGCTCCTTGAGGGCAGG + Intergenic
1004185257 6:13415919-13415941 ACCCTAAATTCCTCGAGGGATGG - Intronic
1004264211 6:14134725-14134747 ACTGTAAGCTCCTTGAGGGCAGG - Intronic
1004285661 6:14318381-14318403 ACCCAATGCTCCCTGAGGTCTGG + Intergenic
1004558195 6:16720368-16720390 AACATAAGCTCTCTGAGGGCAGG + Intronic
1004599117 6:17130411-17130433 ACTCCAAGCTCCATGAGGGCAGG + Intronic
1004679317 6:17876961-17876983 AGACTAAGTTCCCTGAAAGCAGG + Intronic
1005212512 6:23483249-23483271 ACCTAAAGTTTCATGAGGGCAGG + Intergenic
1005841671 6:29748160-29748182 ACCCAAGGTGCCCTGAGGGCAGG + Intergenic
1006305890 6:33218362-33218384 AATGTAAGCTCCCTGAGGGCAGG + Intergenic
1006434710 6:34020170-34020192 ACTGGAAGCTCCCTGAGGGCAGG + Intronic
1006599548 6:35216325-35216347 ACTCTAAGTTCCTTGAGGGCAGG - Intronic
1006955236 6:37863839-37863861 ACGCTAAGCTCCATGAGGGCAGG + Intronic
1007319829 6:41019804-41019826 ACCCTGACTACCCTGAGGACTGG + Intergenic
1007337063 6:41161700-41161722 AACCTAAGCTCCTTCAGGGCAGG - Intronic
1007416112 6:41692217-41692239 ATGCAAACTTCCCTGAGGGCAGG + Intronic
1007509510 6:42364427-42364449 ACTGTAAATTCCCTGAGAGCAGG + Intronic
1007696302 6:43736305-43736327 ACAGTAAGCTCCCTGAGGGCAGG - Intergenic
1007821601 6:44564486-44564508 AGTCTAAGTTCCTTCAGGGCCGG - Intergenic
1008044686 6:46839406-46839428 ACTGTAAGCTCCATGAGGGCAGG + Exonic
1008493693 6:52111633-52111655 ACTGTAAGCTTCCTGAGGGCAGG - Intergenic
1009865382 6:69391625-69391647 ACTCTAAGTGCCTGGAGGGCAGG + Intergenic
1009906455 6:69875027-69875049 ATTCTAAGTTCCATGAGAGCAGG - Intronic
1010114056 6:72280245-72280267 ACTTTAAGTTCCCTGTGGTCAGG - Intronic
1010287999 6:74101783-74101805 ACTGTAAGTTTCATGAGGGCAGG - Intergenic
1010433482 6:75804523-75804545 AATTTAAGATCCCTGAGGGCAGG + Intronic
1011262184 6:85481190-85481212 ACATTTAGTTCCATGAGGGCAGG - Intronic
1011406988 6:87025927-87025949 ACCATATGTTCCTTAAGGGCTGG - Intergenic
1011740058 6:90350520-90350542 ATTGTAAGTTCCTTGAGGGCAGG + Intergenic
1012233864 6:96790280-96790302 ATGCTAAGCTCCCTGAGGGCAGG - Intergenic
1013042285 6:106447791-106447813 ACCTTAATATCCTTGAGGGCAGG + Intergenic
1013118849 6:107123745-107123767 ACTCTAGCATCCCTGAGGGCAGG + Intergenic
1013259308 6:108424536-108424558 ATCCTAATTTCCCTGATGGCAGG - Intronic
1013440385 6:110159054-110159076 ACCATAAGCTCCCTGAAGACAGG + Intronic
1013628425 6:111960217-111960239 AGGCTAAATTCCTTGAGGGCAGG + Intergenic
1013817821 6:114119839-114119861 ACTGTAAATTTCCTGAGGGCAGG - Intronic
1014596155 6:123342462-123342484 ACTGTAATTTCCTTGAGGGCAGG + Intronic
1015371274 6:132456402-132456424 AACATAAACTCCCTGAGGGCAGG + Exonic
1015555863 6:134460776-134460798 AACGTAAGTTCCATGAGGACAGG - Intergenic
1015709924 6:136128673-136128695 ACTGTTAGTTCCTTGAGGGCAGG - Intronic
1015817043 6:137221362-137221384 ACAGTAAGCTCCGTGAGGGCAGG - Intergenic
1015821490 6:137266062-137266084 ACCATAAGCTCCCTTAGGGCAGG - Intergenic
1015878038 6:137844076-137844098 AATGTAAGTTCCATGAGGGCTGG - Intergenic
1016988578 6:149913192-149913214 ACTCTAAGTTCCTGGAGGACTGG - Intergenic
1017113994 6:150959878-150959900 ACCGTAAGTGCCATGACGGCAGG - Intronic
1017164762 6:151397395-151397417 ACTGTAAGCTCCCTGAGGGCAGG + Intergenic
1017429913 6:154360882-154360904 AAAAGAAGTTCCCTGAGGGCAGG - Intronic
1017734369 6:157347799-157347821 ACCAAGAGTTCCTTGAGGGCAGG + Intergenic
1017965194 6:159258252-159258274 ACTGTAAGCTCCTTGAGGGCAGG - Intronic
1017978458 6:159377708-159377730 ACCGGAAGTGCCCTGAGGACAGG - Intergenic
1018039633 6:159910544-159910566 ACTATAAGCTCCTTGAGGGCAGG + Exonic
1018205036 6:161429316-161429338 ACTATAAGCTCCCTGAGGGCAGG - Intronic
1018615671 6:165684219-165684241 TCGCTAAGATCCCAGAGGGCAGG + Intronic
1018727235 6:166622891-166622913 ACATTAAGCTCACTGAGGGCAGG + Intronic
1019825496 7:3280926-3280948 GCCGTAAGTTCTCTGAGGACAGG + Intergenic
1019924914 7:4185720-4185742 TCTCTGAGTTCCATGAGGGCAGG + Intronic
1020789594 7:12610444-12610466 ATGCTAAGTTCCTTGAGGGCAGG + Intronic
1021081351 7:16369562-16369584 AACCTCAGTTCTGTGAGGGCAGG - Intronic
1021783120 7:24125946-24125968 ACTGAAAGATCCCTGAGGGCTGG - Intergenic
1021876092 7:25050799-25050821 ACTGTGAGTTCCCTGAGAGCAGG + Intergenic
1021970527 7:25961197-25961219 ACTGTAAGCTCCCTGAGGGCAGG + Intergenic
1022291432 7:29007914-29007936 ATGCTAAGTTCCTTGAGGACAGG - Intronic
1022443879 7:30454408-30454430 ACTTGAAGCTCCCTGAGGGCAGG + Intronic
1022778336 7:33551663-33551685 ATAATAAATTCCCTGAGGGCAGG - Intronic
1023098510 7:36688688-36688710 ACCATATGTTCCTTAAGGGCAGG + Intronic
1023631217 7:42166246-42166268 ACTATAAGATCCTTGAGGGCAGG + Intronic
1023759623 7:43452622-43452644 ACTGTAAGCTCCATGAGGGCAGG - Intronic
1024465346 7:49706320-49706342 TCTCTAAGTCACCTGAGGGCAGG - Intergenic
1026444910 7:70475689-70475711 ACTATACATTCCCTGAGGGCAGG - Intronic
1026617829 7:71922059-71922081 ACAGTAAGCTCCCTGAGGGCAGG - Intronic
1027226180 7:76244958-76244980 GCCTGGAGTTCCCTGAGGGCAGG - Intronic
1027579134 7:79971196-79971218 AGCCTGAGTTCCTTGAGGGCAGG + Intergenic
1029669226 7:102017469-102017491 TCGCTAAGCTCCCTGAGGGCAGG + Intronic
1030031227 7:105371500-105371522 ACCCTAACCTCCCAGAGTGCTGG - Intronic
1030071175 7:105698785-105698807 GACTGAAGTTCCCTGAGGGCAGG + Intronic
1030444419 7:109631426-109631448 AATGTAAGTTCCTTGAGGGCAGG - Intergenic
1030538747 7:110802918-110802940 ACTGTTAGCTCCCTGAGGGCAGG - Intronic
1032389877 7:131549032-131549054 ACTGTAAGTTCCATGAGGGCAGG - Intronic
1033411760 7:141124525-141124547 ACTGTAAGCTCTCTGAGGGCGGG + Intronic
1033518748 7:142138180-142138202 CCTCTAAGCTCTCTGAGGGCAGG + Intronic
1033991136 7:147288289-147288311 AATATAAGCTCCCTGAGGGCAGG + Intronic
1034228384 7:149500079-149500101 ATTATAAGTTCCCTGAGAGCAGG + Intergenic
1034373976 7:150627390-150627412 AACCAAAGTTTCTTGAGGGCAGG - Exonic
1034458609 7:151185989-151186011 ACAGTAAGCTCCCTGAGGGCAGG + Intronic
1034466296 7:151232031-151232053 ACTTTCAGTTCCCTGAGAGCAGG + Intergenic
1034771730 7:153785306-153785328 ACTGTAAGCTCCATGAGGGCAGG + Intergenic
1034897879 7:154889145-154889167 ACACTAAGTTCCCGGAGAACCGG - Intronic
1034936194 7:155202553-155202575 ACCATGAGGTCCCGGAGGGCAGG - Intergenic
1036088714 8:5641127-5641149 ACTGTAAGTTCCCCGAGGACAGG + Intergenic
1036220157 8:6914707-6914729 AATGTAAGCTCCCTGAGGGCAGG + Intergenic
1036611684 8:10355806-10355828 AACCTCAGTCCCCTGAGGGCTGG - Intronic
1036663264 8:10721934-10721956 TCCCTAAGGTCCCTCAGCGCCGG - Intergenic
1036702412 8:11021812-11021834 CCCTAAAGTTCCTTGAGGGCAGG - Intronic
1036810214 8:11862791-11862813 GCCCTAAGAGCCCGGAGGGCCGG - Intronic
1037162838 8:15793671-15793693 AATATAAGTTCCATGAGGGCAGG + Intergenic
1037262701 8:17026803-17026825 ACCTTGAGTTTCCTGAGGTCAGG + Intergenic
1037440757 8:18913686-18913708 ACCCTGGGTTCACTGGGGGCAGG - Intronic
1037457792 8:19081351-19081373 ACCCTACATTTCCTGAGGCCTGG - Intronic
1037582798 8:20255561-20255583 ACCCTAAGTTCCAGGAATGCAGG - Intronic
1037658323 8:20906290-20906312 AGCCTCAGTTACCTGAGGCCAGG - Intergenic
1037678909 8:21076728-21076750 TCCCCAAGTTCCTTGAGGGCAGG + Intergenic
1038697728 8:29820952-29820974 GCTATAAGCTCCCTGAGGGCTGG + Intergenic
1038776502 8:30536084-30536106 ACTATAAGGTCCCTGAGTGCAGG - Intronic
1038826522 8:31008633-31008655 ACTCTAGGTTCTGTGAGGGCAGG + Intronic
1038972580 8:32653243-32653265 AACATAAGCTCCCTGAGGGCAGG - Intronic
1039109948 8:34030907-34030929 ACAATAAGTTCTTTGAGGGCAGG + Intergenic
1039411463 8:37358585-37358607 ACTCTAAGTACCCTGAAGGCAGG + Intergenic
1039544420 8:38398579-38398601 ACTAAAAGTTCCATGAGGGCAGG + Intronic
1040866013 8:52049715-52049737 ACTCTAATCTGCCTGAGGGCAGG - Intergenic
1041260841 8:56019406-56019428 GGCGTAAGTTCCCTGAGGGCAGG + Intergenic
1041495506 8:58481525-58481547 ACTCTGAGTGCCTTGAGGGCAGG + Intergenic
1041664191 8:60426498-60426520 ACTGTAAGCTCCCTTAGGGCGGG - Intergenic
1042005701 8:64177733-64177755 ACCTTTAGTTCCCTAGGGGCAGG - Intergenic
1042145158 8:65720721-65720743 AACATAAGCTCCTTGAGGGCAGG - Intronic
1042250951 8:66755725-66755747 ACCCTAAGAGCCATGAGGGCAGG - Intronic
1042467790 8:69148052-69148074 ATCTAAAATTCCCTGAGGGCTGG - Intergenic
1042786966 8:72558704-72558726 ATTCTAAGTTCCTGGAGGGCAGG - Intronic
1042808972 8:72803373-72803395 TCCCAAACTTCCCTGATGGCAGG + Intronic
1042809536 8:72808979-72809001 ACCATAAGATCCTTGAGGACAGG + Intronic
1042964245 8:74334102-74334124 ACTGTAAATTCCCTGAGGGCAGG - Intronic
1043057554 8:75458590-75458612 CCCCTAAGTTTCTTGAAGGCAGG + Intronic
1043401057 8:79884859-79884881 AATGTAAGTTCCATGAGGGCAGG - Intergenic
1043516539 8:81000156-81000178 AATCTAATTTCCTTGAGGGCAGG + Intronic
1045218497 8:100173702-100173724 ACTGTAAATTCCTTGAGGGCAGG - Intronic
1045729737 8:105223400-105223422 AATGTAAGTTCCCTGAGGCCAGG - Intronic
1045853995 8:106741770-106741792 ACAGTAAATTCCATGAGGGCAGG - Intronic
1046378077 8:113413557-113413579 ACCCTGAGTTCTGTGAGGGTGGG - Intronic
1047018895 8:120753564-120753586 ATGGGAAGTTCCCTGAGGGCAGG + Intronic
1047043385 8:121024007-121024029 ACTCTAGGTTCCATGTGGGCTGG + Intergenic
1047123967 8:121939280-121939302 ACACTAAGTTCTATGATGGCAGG - Intergenic
1047213219 8:122856641-122856663 AGCCAGAGTTCCCTGAGGCCTGG + Intronic
1047218506 8:122899156-122899178 ATTCCAAGTTTCCTGAGGGCTGG + Intronic
1047280560 8:123441766-123441788 ATTGTAAGTTCCTTGAGGGCAGG + Exonic
1047785918 8:128153737-128153759 ACTGCAAGTTCCCTGAGGACAGG - Intergenic
1047907561 8:129488893-129488915 ACCATAAGTTCCATGAGAGCAGG - Intergenic
1048255315 8:132901120-132901142 ACTCTAAGCTGCTTGAGGGCAGG + Intronic
1048544100 8:135369974-135369996 ATCAGAAGCTCCCTGAGGGCAGG - Intergenic
1049174749 8:141184961-141184983 ACTCTGAGCTCCCAGAGGGCAGG + Intronic
1049426133 8:142538657-142538679 GTCCTGAGCTCCCTGAGGGCGGG + Intronic
1049917905 9:336330-336352 ACCCTAATTTCCATGTGGGAGGG + Intronic
1050585243 9:7103991-7104013 ACCGTGAGTTCCTTGAGGGCAGG + Intergenic
1050692454 9:8243125-8243147 ACTATAAGCTCCGTGAGGGCAGG - Intergenic
1051374626 9:16390500-16390522 ACCATAAGTTGCCTGAAGTCTGG - Intergenic
1051393106 9:16587990-16588012 AATTTAAGTTCCATGAGGGCAGG + Intronic
1051806563 9:20999821-20999843 ACTGTAAGTTCCATGAGAGCAGG - Exonic
1052166130 9:25330672-25330694 AACCTAAGTTCCAAGAGGACAGG + Intergenic
1053161151 9:35814402-35814424 ACCCGAAGTTCCCTGGGGCTAGG - Intronic
1053289952 9:36873268-36873290 ACTGTGAGCTCCCTGAGGGCAGG + Intronic
1053381501 9:37652790-37652812 AACCTAAGCTCCTTGAGGGTAGG - Intronic
1053454767 9:38225607-38225629 ACCATGACTTCCCTGAGGACAGG + Intergenic
1053512436 9:38699813-38699835 ACTCTAAATTCCTTGAGGACAGG - Intergenic
1054913769 9:70477556-70477578 ACTATAATTTCCTTGAGGGCAGG + Intergenic
1056498853 9:87188434-87188456 ACTGTAAGTTCCCTGAGACCAGG - Intergenic
1057245964 9:93453703-93453725 ACCCGAACTTCCCTGAGGAATGG - Intronic
1057513119 9:95697510-95697532 ACCAGAAGTTCCTTGAGGGCAGG - Intergenic
1057851575 9:98570680-98570702 ACCCTTAGGTCTCTGAGGACAGG + Intronic
1058847276 9:108973469-108973491 ATTCTAACCTCCCTGAGGGCAGG - Intronic
1058977994 9:110142480-110142502 CCATTAAGTTCCCTGAGAGCAGG - Intronic
1059155505 9:111985281-111985303 ACCATGAGCTCCCTGAGAGCTGG - Intergenic
1059407824 9:114112819-114112841 ACTCTAAGCTCTCTGAAGGCAGG + Intergenic
1059413703 9:114150125-114150147 ACCTTACATTCCCTGAGGGCAGG - Intergenic
1059663563 9:116425084-116425106 GCAATAAGTTCCCTGAGGGAAGG + Intergenic
1059682931 9:116604109-116604131 ACTGCAAGTTCCATGAGGGCAGG + Intronic
1060000849 9:119957315-119957337 ACTCTAAGTCCCCTGAGGGCAGG + Intergenic
1060279628 9:122207051-122207073 GCCACAAGCTCCCTGAGGGCAGG + Intronic
1060356837 9:122916310-122916332 ACTATAAGCTCCATGAGGGCAGG + Exonic
1060360702 9:122953944-122953966 AACCTAAGGTTCATGAGGGCAGG - Intronic
1060375653 9:123113582-123113604 AACCTAAGTTCCATATGGGCAGG + Intronic
1060636165 9:125201022-125201044 AGACTAAGTTCCTAGAGGGCTGG - Intronic
1060804451 9:126565678-126565700 AACATGAGTTCCATGAGGGCAGG - Intergenic
1061210240 9:129187546-129187568 ACTGTAAATTCCCTGAGGACAGG + Intergenic
1061258891 9:129468217-129468239 ACAGGAAGCTCCCTGAGGGCAGG + Intergenic
1061936908 9:133862959-133862981 ACCCCAGCTTCCCTGAGCGCCGG - Intronic
1062426194 9:136507303-136507325 ACCCTGAGTGCCCCGTGGGCAGG + Exonic
1062431347 9:136528164-136528186 ACCATAAACTCCTTGAGGGCAGG - Intronic
1186068226 X:5789495-5789517 ACTGTAAGTTCCCTGAGGGCTGG - Intergenic
1186720588 X:12299732-12299754 ACTAAAAGTTCCCAGAGGGCAGG - Intronic
1187839449 X:23471688-23471710 ACCATAATTTCCAGGAGGGCAGG - Intergenic
1188345154 X:29054818-29054840 AACGTAAGTTCCATGAGAGCAGG + Intronic
1189008744 X:37023096-37023118 ACCCTAAGTGCCCTCAGGTGAGG - Intergenic
1189195799 X:39151430-39151452 AACTAAAGCTCCCTGAGGGCAGG - Intergenic
1190874582 X:54450531-54450553 ACCATGAGCTCCTTGAGGGCAGG - Intronic
1192226550 X:69232129-69232151 AACATGAGCTCCCTGAGGGCAGG - Intergenic
1192794373 X:74413859-74413881 AACTTAAGCTCCTTGAGGGCAGG - Intergenic
1193780811 X:85699089-85699111 ACGCTAAGCTCCCTGAGTGGGGG - Intergenic
1194777313 X:97981073-97981095 TCTGTAAGCTCCCTGAGGGCAGG - Intergenic
1195772109 X:108362517-108362539 ACCCAAGGGTCCATGAGGGCTGG + Intronic
1196659605 X:118256116-118256138 ACTATAAGTTCCATCAGGGCAGG - Intergenic
1196811678 X:119634011-119634033 ACCATGAGTTCCTTGATGGCAGG - Intronic
1197238296 X:124093426-124093448 ACTGTAAGCTCCTTGAGGGCAGG + Intronic
1197271601 X:124430201-124430223 ACTCCAAGTTCCATGAAGGCAGG - Intronic
1197610149 X:128629294-128629316 AATCTAAGTTTCCTAAGGGCAGG - Intergenic
1197849635 X:130843906-130843928 ACTATAAGTTCCTTGAGGTCAGG + Intronic
1198051943 X:132958604-132958626 ACCCTGAGTTGCCTGAAGGGGGG - Exonic
1198102668 X:133435747-133435769 AGTCTAAGTTCCTTGAGGGGAGG - Intergenic
1198114832 X:133535038-133535060 ACCTTCAGTTCCATGAGAGCAGG + Intergenic
1198209718 X:134505785-134505807 ACCTTAAGCCCCCTGAGGGCAGG - Intronic
1198223729 X:134626299-134626321 ACAGTAAGCTCCCTGAGGGCAGG + Intronic
1198523202 X:137473564-137473586 AATGTAAGCTCCCTGAGGGCAGG - Intergenic
1200293828 X:154897432-154897454 ACTGTAAGTTCCATGAGGGCAGG - Intronic