ID: 1168900046

View in Genome Browser
Species Human (GRCh38)
Location 20:1355541-1355563
Sequence GAAGAGAGCACAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 1, 2: 14, 3: 76, 4: 340}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168900046 Original CRISPR GAAGAGAGCACAGTGATTGT GGG (reversed) Intronic
902375478 1:16028265-16028287 GAAGGGGGGACAGTGACTGTGGG - Intronic
902977185 1:20097553-20097575 GCAGACAATACAGTGATTGTGGG + Intergenic
905605247 1:39292421-39292443 GAAGATAGAACAGTGACTGAAGG - Intronic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906946861 1:50301720-50301742 GGAGAGCGCAGAGTGTTTGTGGG - Intergenic
907911904 1:58834346-58834368 GAGGGAAGCACAGGGATTGTGGG + Intergenic
908022732 1:59915127-59915149 CAGGAGAGCAGAGTGATAGTGGG - Intronic
908175705 1:61553152-61553174 AGTGAGAGCACACTGATTGTGGG - Intergenic
908438115 1:64126812-64126834 GAAGTGAGAACAGTCCTTGTTGG + Intronic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
910468060 1:87521842-87521864 CAAAAGAGCACATTGATTTTGGG + Intergenic
910515489 1:88055094-88055116 AAGGAGAGCACCGTGATTGTGGG - Intergenic
910560149 1:88581621-88581643 GGAGATTGCCCAGTGATTGTGGG + Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911019729 1:93374634-93374656 GGGGAGAGCACAGTTATTATGGG + Intergenic
911239520 1:95449694-95449716 AAAGAGAGCACAGTGCTTGTGGG - Intergenic
912583924 1:110744605-110744627 GAAGAGAGAAAAGTGGTTGTGGG + Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
912880202 1:113404635-113404657 GAACATATCACACTGATTGTGGG + Intronic
915005229 1:152629471-152629493 AAAGAGAGTGCAGTGATTGTGGG + Intergenic
916345630 1:163788149-163788171 GAGGAGAGCACAGTCAATGCAGG - Intergenic
916350135 1:163839833-163839855 GAATAAAACACAGTGATGGTAGG + Intergenic
916628134 1:166582030-166582052 GAAGAGACCACAGAGATTAAGGG - Intergenic
916895257 1:169155857-169155879 GGAGAGTGCACAGTGTTTTTTGG + Intronic
917275878 1:173331555-173331577 GAAAAGAGCAAAGTGATTAATGG + Intergenic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
918125839 1:181582756-181582778 GAAGAGAGCACTATGATAGCAGG - Intronic
918907623 1:190518369-190518391 GAAGAGAGAAAAGTGATTTTTGG - Intergenic
919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG + Intergenic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
921774344 1:219079729-219079751 GAAGAGATAAGAATGATTGTGGG - Intergenic
921774669 1:219082784-219082806 AGAGACAGCTCAGTGATTGTGGG - Intergenic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
924108224 1:240671019-240671041 GAAAAGGGAACAGTGATGGTGGG - Intergenic
1064288683 10:14014046-14014068 GAAGACAGCGCAGTGAGTATCGG + Intronic
1067324464 10:45253729-45253751 GAGGAGAGCACAGTGATTGGAGG + Intergenic
1067722363 10:48738450-48738472 GAAGATAGCACATTGAGTGCAGG - Intronic
1068034598 10:51743569-51743591 GAAGAGAGAAAAATGATTTTTGG - Intronic
1070505818 10:77111792-77111814 TTAGAGAGCACAGCCATTGTGGG - Intronic
1071185544 10:83039883-83039905 AAAGAGAGCAAATAGATTGTAGG + Intergenic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1071997331 10:91161993-91162015 GAAGACTGCACAGAGATGGTAGG + Intergenic
1072560346 10:96567489-96567511 CAAGAGAGCACAGGGTGTGTGGG - Intronic
1073870918 10:107863245-107863267 ACAGAGACCACAGTGAGTGTGGG + Intergenic
1074020513 10:109577784-109577806 GAAGACAGCAAAGTGATGATGGG - Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075105928 10:119539990-119540012 GAAGACAGCCAAGTGATTTTTGG - Intronic
1076376709 10:129993146-129993168 AAGGAAAGCACGGTGATTGTGGG + Intergenic
1077632284 11:3818828-3818850 AAAAAGAGTACAGTGACTGTGGG + Intronic
1077646754 11:3932157-3932179 GAAGAGAGTCCAGTGGTGGTGGG - Intronic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1078475226 11:11623413-11623435 GAAGAGAGAACAGTGGGTGTGGG + Intergenic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1079624420 11:22598739-22598761 GAAGAAACCACAGTTATTCTTGG - Intergenic
1079818885 11:25098736-25098758 GAAGGGAGCAGAGTAATTTTGGG + Intergenic
1080396810 11:31897809-31897831 GAGGAGAGCTCAGTTAGTGTGGG - Intronic
1080600522 11:33817646-33817668 GCATAGAGCACAGTCATTGTGGG + Intergenic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1082793500 11:57363808-57363830 GAACAGAGCTCAGGGAGTGTGGG - Intronic
1083187734 11:61027183-61027205 GAAGAGGAGGCAGTGATTGTGGG - Intergenic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1086217933 11:84406217-84406239 GAAGAGAGACCTGTGTTTGTGGG - Intronic
1086435039 11:86771808-86771830 GAAGGGAGCAGAGTGGTAGTTGG + Intergenic
1086799125 11:91149670-91149692 GCAGAGTGCAGAGTGTTTGTAGG - Intergenic
1087473098 11:98601647-98601669 AAGGAAAGCACAATGATTGTAGG - Intergenic
1088685553 11:112281749-112281771 GAAGGGACCACAGTGAGTGAGGG - Intergenic
1088803960 11:113333798-113333820 AAAGAGAGAACAATAATTGTTGG - Intronic
1088915206 11:114222440-114222462 GGAGTGAGCAAAGTGATTCTGGG + Intronic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1091013779 11:132030783-132030805 GATGAGAGCAGAGAGATAGTGGG + Intronic
1091239179 11:134041091-134041113 GAACAGAGCACAGGGTGTGTGGG + Intergenic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1094258372 12:28463228-28463250 GAAATGAGCACAGTGTTTGGTGG + Intronic
1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG + Intergenic
1095196362 12:39323266-39323288 CAGGAGAGCACAGTAAATGTTGG - Intronic
1095611614 12:44135101-44135123 GAAAATAACCCAGTGATTGTTGG - Intronic
1095625001 12:44304194-44304216 GAGGAGAGCACAGTGACTATGGG + Intronic
1095874798 12:47068623-47068645 GATGAGAGCACAGGGAGTGTGGG + Intergenic
1097349265 12:58530107-58530129 GAAGAGAGCAAAGTGGCTATTGG - Intergenic
1097426140 12:59446707-59446729 AGACAGAGCACAGTGATTCTGGG - Intergenic
1097932625 12:65206137-65206159 GAAGAAAGCAAAGGGGTTGTGGG - Intronic
1098085256 12:66835715-66835737 GTAAAAAGAACAGTGATTGTTGG + Intergenic
1098100201 12:67007127-67007149 GAGGAGAGCACAGTGGTGATGGG + Intergenic
1098811228 12:75095655-75095677 GAAGAGACCAGAGTTAATGTGGG - Intronic
1101176059 12:102153061-102153083 GCAGATAGCACCGTTATTGTAGG + Intronic
1101347081 12:103896007-103896029 GAACTGAGCACAGAGATGGTAGG - Intergenic
1103387907 12:120548393-120548415 GAAGAGAGCACAGTCAGGGCGGG + Intronic
1104387235 12:128361554-128361576 AAAGAGTACACAGTGATTGCTGG + Intronic
1104914384 12:132257367-132257389 GCAGAGACCACGGTGAGTGTCGG - Intronic
1106532615 13:30608021-30608043 GAATACAGCACAGTGACAGTAGG + Intronic
1107215324 13:37911090-37911112 AAAGAGAGCACAGTGTTACTTGG + Intergenic
1107616787 13:42177210-42177232 GAAGTCAGCACAGTGATTATTGG - Intronic
1108228283 13:48313076-48313098 GAAGAGAACACAGGCATTGGGGG - Intronic
1108972926 13:56400619-56400641 AAGGAGATCACAATGATTGTGGG + Intergenic
1109948748 13:69473242-69473264 GAAGAGAGCAAAGGGAGTATTGG + Intergenic
1110092541 13:71471142-71471164 GATGGGAGCACAGAGATTGGAGG + Intronic
1110281236 13:73696563-73696585 GAAGAGAGATCAGTTTTTGTGGG - Intronic
1110379043 13:74828507-74828529 GAACAGAGCACAGAGGTGGTAGG - Intergenic
1110817641 13:79879732-79879754 GGAGAGAGAAAAGTGATTCTTGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1111817313 13:93169780-93169802 GAAGAGAGGTCAGTAATTGAGGG + Intergenic
1111818633 13:93186661-93186683 GAAGAAAACACAGTGACTGCTGG + Intergenic
1114303037 14:21395306-21395328 GAGGAGATCTCAGTGATTGATGG - Exonic
1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG + Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116583586 14:46674299-46674321 GAGGGAAGCACAGTGATTGAAGG + Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117607108 14:57440959-57440981 AGAGAAAGAACAGTGATTGTGGG - Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1120344522 14:83268772-83268794 AAAGAAAGAACAGTGAGTGTGGG - Intergenic
1120426066 14:84350292-84350314 AGAGAGAGCCGAGTGATTGTAGG + Intergenic
1121351443 14:93176490-93176512 AAAGAGAGCACAGATTTTGTAGG + Intergenic
1124344165 15:28910369-28910391 GAAAAGTGCTCAGTGATTGGTGG + Intronic
1124962067 15:34406166-34406188 GAAAAGTGCTCAGTGATTGGTGG + Intronic
1124978690 15:34552387-34552409 GAAAAGTGCTCAGTGATTGGTGG + Intronic
1125271505 15:37943737-37943759 GGAAAGAGTACTGTGATTGTAGG - Intronic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1128966136 15:72060532-72060554 AGAGATAGCACAGAGATTGTGGG + Intronic
1129642266 15:77392965-77392987 AAAGAGAGCACACCGCTTGTGGG + Intronic
1130878598 15:88035292-88035314 GAAGGGAGCAAGGTGATAGTGGG - Intronic
1130897442 15:88182328-88182350 GAAGAGATCACAGTGAATCCTGG - Intronic
1130963065 15:88677487-88677509 GATGAGAGCAGAGTGAATGCAGG - Intergenic
1135423243 16:22318440-22318462 GAGCAGAGCACAGTGATTGAGGG + Intronic
1136061415 16:27729218-27729240 GAAGAGAGCTAAGTGATGGAGGG - Intronic
1138000266 16:53271146-53271168 GGATGGAGCATAGTGATTGTGGG - Intronic
1138806933 16:60100906-60100928 AGAGCGAGCACAGTGACTGTGGG - Intergenic
1139702795 16:68719411-68719433 GAAAAGGGCCCAGTGGTTGTCGG + Intronic
1143164253 17:4890009-4890031 GAAGAGGGCACAGGGAATGAGGG - Intronic
1143238972 17:5427802-5427824 GAAGAACGCTCAGAGATTGTAGG - Intronic
1144517612 17:15929506-15929528 GAGGAGAGCACAGTGCTCCTTGG - Intergenic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1145722168 17:27083384-27083406 GAGGAGACCCCAGTCATTGTAGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1147671506 17:42179558-42179580 GAAGAAAGCCAAGTGAATGTGGG - Intronic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149930227 17:60744755-60744777 GAAGAATGGACAGTGAATGTGGG + Intronic
1149985046 17:61340877-61340899 GAAGAGACAACAGTCAGTGTGGG + Intronic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1151181150 17:72329622-72329644 GAAGAGAGTCCAGTGGTGGTGGG - Intergenic
1152104145 17:78319054-78319076 GAAGAGAGCAGAGAGAGTGATGG - Intergenic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1156083721 18:33374029-33374051 GCAGAGAGCTTGGTGATTGTGGG - Intronic
1156515780 18:37679004-37679026 GAAGAGAGAACTGTTCTTGTTGG + Intergenic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1158932696 18:62336508-62336530 GAAGTGACCACAGGGCTTGTTGG + Intronic
1158967788 18:62637661-62637683 GAAGAAAACACAGTTCTTGTTGG - Intergenic
1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159647960 18:70942470-70942492 GGACAGAGCGGAGTGATTGTGGG + Intergenic
1163185550 19:15636616-15636638 GGAGAGAGCACAGTGATCATGGG - Intronic
1163628239 19:18403223-18403245 CAAGAGAGCAGGGTGATAGTGGG - Intergenic
1164823553 19:31267859-31267881 GGAGAGAGCAGAGTGAAGGTTGG + Intergenic
1164919881 19:32081361-32081383 GAAGAGAGAACAGTGAGTTCTGG - Intergenic
1165187591 19:34035445-34035467 GAAGAAAGCACAGAGATGTTAGG + Intergenic
1166407100 19:42529039-42529061 GAAGAGAGGACTGTGATAGAGGG + Intronic
1167212471 19:48141954-48141976 GATGAGAGCATAGTGAATGAAGG + Intronic
925506439 2:4569891-4569913 AGAGAAAACACAGTGATTGTGGG - Intergenic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
927002771 2:18816082-18816104 GTAGTGAGCACAGTGGTTCTTGG - Intergenic
927238246 2:20897897-20897919 GAAAAGAACAGAGTGATTTTAGG - Intergenic
927573616 2:24182032-24182054 GAAGTCAGCACAGGGATTATGGG + Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928574055 2:32636919-32636941 GAGGACAGCATAGTGTTTGTGGG + Intronic
928982085 2:37146481-37146503 AAAGAGATGAAAGTGATTGTAGG - Intronic
929831634 2:45351476-45351498 GAAGAGAGCATTGGGATTTTAGG - Intergenic
930207368 2:48601683-48601705 AAAGAGATCAGAGAGATTGTGGG + Intronic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
934197166 2:89848189-89848211 GGAGAGAGCACAGGGAATGTAGG - Intergenic
934607736 2:95710270-95710292 GGAGAGAGCACACTGACTGAGGG + Intergenic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935177954 2:100665601-100665623 GCACAGAACTCAGTGATTGTTGG - Intergenic
936462933 2:112725211-112725233 GTAGACAGCACAGTGCTGGTGGG - Exonic
936541077 2:113352150-113352172 GGAGAGAGCACACTGACTGAGGG + Intergenic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941169569 2:162120199-162120221 GAAAAGAGCAGAGTGTTGGTTGG - Intergenic
941656323 2:168148592-168148614 GAAGCCAGCTCAGTGAGTGTGGG - Intronic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942153324 2:173100900-173100922 GAAAAGAGCAGAGTGATGGATGG - Intronic
942972378 2:181971868-181971890 AAGGAGAGCAAAGGGATTGTGGG - Intronic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
944753546 2:202736316-202736338 GATGAGAGGACAGTGATTGCTGG + Intronic
945556272 2:211280343-211280365 TAAAAGAGCTCAGTGATTCTAGG + Intergenic
945784126 2:214212419-214212441 GAAGAAAGCAAAGAGATTGATGG - Intronic
946897721 2:224341345-224341367 CATGAGAACACAGAGATTGTGGG - Intergenic
947009273 2:225547616-225547638 AAGGAGAGTATAGTGATTGTGGG - Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948293841 2:236846693-236846715 GAAGAGAGGAAAGTCATGGTGGG + Intergenic
948475616 2:238217116-238217138 GGAGAGAACACAGTGATTGTGGG - Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168900046 20:1355541-1355563 GAAGAGAGCACAGTGATTGTGGG - Intronic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170708583 20:18768258-18768280 GAAAAGAACACAGTGATCATTGG - Intergenic
1171036407 20:21715531-21715553 GTAGGGAGCACAGGGGTTGTTGG + Exonic
1174495343 20:50937532-50937554 GGAGGGAGCACTGGGATTGTGGG + Intronic
1175092798 20:56518816-56518838 GAAGATAGCAGAGTCATAGTTGG + Exonic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1176448423 21:6841272-6841294 GAAGGGAGCACAGAGAGGGTGGG + Intergenic
1176826593 21:13706294-13706316 GAAGGGAGCACAGAGAGGGTGGG + Intergenic
1177097981 21:16862236-16862258 GAAGACAGAACAGTGAATTTGGG + Intergenic
1178349725 21:31864113-31864135 GAAGGAAGCACAGTGCTGGTAGG + Intergenic
1178766758 21:35460793-35460815 CAAGAGACAACAGTGCTTGTAGG - Intronic
1179049817 21:37879588-37879610 GAAGAGAGCAATGTTATTTTGGG - Intronic
1182389373 22:29978957-29978979 GGAGAGAGCACAGAGTTTGTGGG + Exonic
1182734214 22:32519675-32519697 GGAGAGTGCACCTTGATTGTTGG - Intronic
1185219995 22:49624415-49624437 GGGGAGAGCACAGTGATGCTCGG + Exonic
949943385 3:9171852-9171874 GAAGAGGACACGGTGCTTGTCGG + Intronic
949978377 3:9481605-9481627 GAGGAGAGCATAGTCATTGAAGG + Intergenic
950777763 3:15365174-15365196 GAAGAGAGCCCAGTGGTGGTGGG + Intergenic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951398612 3:22202749-22202771 AAAGACAGCACATTGAATGTGGG + Intronic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952595136 3:35008477-35008499 GAAAAGAGCACAGTTGGTGTGGG - Intergenic
952683366 3:36121723-36121745 AAGGAGAGCAAAGTGAGTGTGGG + Intergenic
953744633 3:45564902-45564924 GGAGACAGCAAAGTGATTGAAGG + Intronic
954030925 3:47819417-47819439 GAAGAGAGCACAGCACTTGTGGG - Intronic
954436542 3:50499245-50499267 GAAAAGAGCACAGTCATGGCAGG + Intronic
955521172 3:59777020-59777042 GACGAGAGCACAGTGAGCATGGG - Intronic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
956380005 3:68655092-68655114 GAAGAGAGTCCAGTGACAGTGGG - Intergenic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
956953569 3:74310976-74310998 GGAGAGAGGACAGTGAGTTTAGG + Intronic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957690594 3:83561369-83561391 GAAGAGTGTACAGTTTTTGTTGG - Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958137650 3:89517432-89517454 GAAGAGAAGAAAGTGATTCTTGG - Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960052124 3:113249088-113249110 GAGGAGAGCAGGGTGATTGCAGG + Intronic
960298188 3:115968999-115969021 AAGGTGAGCTCAGTGATTGTAGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
961100532 3:124194945-124194967 GAAGAGAAGGCAGTGATGGTAGG + Intronic
961644302 3:128384441-128384463 GACCAGAGCAGAGTGAGTGTGGG + Intronic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964494919 3:157278405-157278427 AAAGAGAGCAGAGGGAATGTGGG + Intronic
965256984 3:166425751-166425773 AAGGAGAGCACAGTGACAGTGGG + Intergenic
966328905 3:178789597-178789619 GAGAAGAGCACAGTGATTGTGGG + Intronic
967642392 3:191881393-191881415 GAAGAGAGCATTGTGAGTGAAGG - Intergenic
967677360 3:192316458-192316480 AAGGAGAGTACAGTGGTTGTGGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
970363688 4:15336788-15336810 GAGGAGAGGACATTGATTCTTGG - Intergenic
970566110 4:17334130-17334152 GAAGAGAGCACGGTGCAGGTCGG - Intergenic
971268270 4:25113538-25113560 GAAAAGAGCAGAGTGAATTTGGG - Intergenic
971706503 4:30049963-30049985 GAAAAGAGAACATTGCTTGTGGG + Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972301400 4:37788582-37788604 GAAGAGAGCATAGAGAGAGTAGG - Intergenic
972380264 4:38512823-38512845 GAGGAAAGCACAGTGAGTTTGGG - Intergenic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
974663849 4:64932097-64932119 GAAGAGGGCATAGTGCTTTTTGG + Intergenic
974845079 4:67342175-67342197 GAAAACAGCTCATTGATTGTTGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
976082940 4:81376033-81376055 GGGGAGGGCACAGCGATTGTGGG - Intergenic
977212525 4:94236179-94236201 GAAGAGAGCACTTTGATTTGAGG + Intronic
978352835 4:107838257-107838279 GATGAGAACACAATGTTTGTTGG + Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
980874626 4:138648512-138648534 GAAGAGAGAAGAGTGAGTGAAGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981530910 4:145752945-145752967 AGTGAGAGCACAGCGATTGTGGG - Intronic
982690019 4:158538051-158538073 CAAGAGAGAACAGTGTTTGTAGG + Intronic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
983039600 4:162909864-162909886 GAAGAGAGCACCAGGATTGAGGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983665697 4:170179861-170179883 ACAGAGAGCAAAGTGAATGTTGG - Intergenic
985208529 4:187567627-187567649 GCAGAGAGCCCAGGCATTGTAGG + Intergenic
985674917 5:1225956-1225978 GAAGAGCGCTCACTGTTTGTAGG - Intronic
987937532 5:24486268-24486290 GTAGAGAGCACACTGATCTTTGG + Intergenic
988013592 5:25523469-25523491 GAAGAAAGTATAGTAATTGTAGG + Intergenic
988265427 5:28942666-28942688 TGGGAGAGCACAGTTATTGTGGG - Intergenic
988384075 5:30539155-30539177 GAGAAGAGTACAGTGATTGCAGG + Intergenic
989519264 5:42381837-42381859 GAAGAAAGCACAGGGCTTGGTGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
995147001 5:108797540-108797562 AAAGAGAGCACTGTGATTGTGGG - Intronic
995441379 5:112196148-112196170 TAAGAGAGCAAAGTGTTTGGAGG - Intronic
998098768 5:139414478-139414500 TAAGAGAGCACAGATACTGTTGG - Intronic
998889946 5:146735331-146735353 GAAGAGAGTAGAAGGATTGTGGG - Intronic
999268052 5:150279771-150279793 GGAGAGGGCACAGTGACAGTGGG + Intronic
1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG + Intergenic
1001327693 5:170741277-170741299 AAAGAGACCACAGTGATTCAAGG + Intergenic
1001412632 5:171521655-171521677 GAACAGAGCTCGGTGATTGCAGG + Intergenic
1002669989 5:180858952-180858974 GAAGAGTGCCCAGAGGTTGTTGG - Intronic
1006467080 6:34202397-34202419 GAAGAGGGCAGAGTGATGGCAGG - Intergenic
1006867586 6:37222051-37222073 GAAGAGAGCAGAGAGATGATAGG - Intronic
1007013955 6:38444002-38444024 GAAGAGAGCACAGTGACCAAAGG - Intronic
1007172432 6:39873207-39873229 GAAGAGGGCACAGTGATCAGTGG - Intronic
1007533880 6:42567055-42567077 GTAGAGAAAACAGTGATTGTAGG + Intronic
1009373629 6:62939374-62939396 AAGGAGAGCACAGTGATGGCAGG - Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009847456 6:69151400-69151422 TGGGGGAGCACAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010425181 6:75721795-75721817 GAAGACAGGATAGTGCTTGTAGG + Intergenic
1012059769 6:94463420-94463442 AAGGAAAGCTCAGTGATTGTGGG - Intergenic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1013410283 6:109877491-109877513 GCAGAGAATACAGTGATAGTTGG - Intergenic
1013837723 6:114352157-114352179 GAAGAGAGGAAAGTGAATGGTGG + Intergenic
1013985686 6:116190576-116190598 GAAAAGATGACAGTGGTTGTGGG + Intronic
1014430536 6:121365379-121365401 GGAGAGAGCACAGCAATTGTGGG + Intergenic
1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG + Intronic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1017526353 6:155244504-155244526 GAAGACAGCACATTCATTATGGG - Intronic
1017717066 6:157220099-157220121 GAAAAGAACACAGCCATTGTGGG - Intergenic
1019722628 7:2582454-2582476 GAAGAGAGCACAGCGCTGGAGGG + Intronic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021249939 7:18312047-18312069 GGAGAGGACAAAGTGATTGTAGG + Intronic
1022223700 7:28340921-28340943 AGAGACAGCACAGTGATTATGGG - Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023623966 7:42098155-42098177 GAAGAGTGCTCAGTGGCTGTGGG + Intronic
1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG + Intergenic
1024051127 7:45624124-45624146 GAAGAGGGCACCCTGATTGGGGG + Intronic
1024568985 7:50708997-50709019 GTAGAGAGCATAGTGATTAAGGG - Intronic
1024579027 7:50787162-50787184 GAAGAGACAAGAGTGAGTGTAGG + Intronic
1024700099 7:51897599-51897621 AGAGAGAGCAAAGTAATTGTCGG - Intergenic
1024981315 7:55159596-55159618 GTGAAGAGCACAGTGAGTGTGGG - Intronic
1027515864 7:79140612-79140634 CAAAATAGCACAATGATTGTAGG + Intronic
1027604764 7:80287304-80287326 GTGGAGAGAACAGTGATTGTAGG + Intergenic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028284715 7:88981787-88981809 GAGGAGAGCACAGTGATCTTGGG - Intronic
1028747432 7:94343471-94343493 GAAGAGAGGAAAGGGAGTGTTGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029371494 7:100153806-100153828 GAAGGGAGCACAGAGTTAGTGGG - Intronic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1032062313 7:128735384-128735406 GAAAGGAGAACAGTGAGTGTTGG - Intergenic
1033627419 7:143123739-143123761 GAACAGATAACAGTGATTTTAGG - Intergenic
1033814120 7:145051648-145051670 AGAGAAAGCACGGTGATTGTGGG - Intergenic
1034040373 7:147871071-147871093 GAAGGGAGGCCAGTGATGGTTGG - Intronic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1035285039 7:157800297-157800319 GAAGAGGGCACAGTGATGGAAGG - Intronic
1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG + Intronic
1035822007 8:2603314-2603336 TAAGATTGCACAGAGATTGTGGG - Intergenic
1037576779 8:20213285-20213307 GAAGAGAGTACTGTGAGAGTAGG - Intronic
1040290280 8:46120655-46120677 AATGAGACCACAGCGATTGTTGG - Intergenic
1040315943 8:46260976-46260998 GACGAGAGCACAGGGAATGCTGG + Intergenic
1040317758 8:46273974-46273996 GATGAGACCACAGTGATTGCTGG + Intergenic
1040843580 8:51810658-51810680 GCCAAGAGCATAGTGATTGTTGG - Intergenic
1041276182 8:56159943-56159965 GAAAAGAGCACGGTGCTTGATGG - Intergenic
1042652790 8:71061438-71061460 TAAGAGAGCACAGAGATGATGGG - Intergenic
1042754390 8:72194308-72194330 GGAGAGAGCAAAGTAATTGAGGG - Intergenic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1043567203 8:81561639-81561661 AAGGAGGGCACGGTGATTGTGGG + Intergenic
1043585233 8:81760899-81760921 AAAGAGAGCAAAGTGGTGGTGGG + Intergenic
1043785981 8:84400479-84400501 GAAGAGGGCACATTAATTGAAGG + Intronic
1044091923 8:88012412-88012434 GAAGAGAACACACTTATAGTTGG - Intergenic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1044847606 8:96397646-96397668 GAAGAGTGCAGAGAGATTATAGG + Intergenic
1046153597 8:110258642-110258664 GAACACAGAACAGTGGTTGTTGG - Intergenic
1046463480 8:114571782-114571804 GGAGAGGGCAAAGTGTTTGTGGG - Intergenic
1046719591 8:117604363-117604385 GAAGAGAGGACAGAGAAGGTAGG + Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1049501342 8:142968904-142968926 CAAGAGAACAGAGTGATGGTGGG + Intergenic
1050067624 9:1777184-1777206 CCAGAGAGCACAGTAATGGTGGG + Intergenic
1051079656 9:13279490-13279512 GAAGAGAAGACAGTGAGCGTGGG - Exonic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051376142 9:16404829-16404851 GAAGTGAGCACAGTGACAGTAGG - Intergenic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052776348 9:32737096-32737118 GAAGAGAGCACAGTTCCTGCAGG + Intergenic
1052867759 9:33475660-33475682 GAAGTCAGAATAGTGATTGTTGG - Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060126612 9:121053729-121053751 AGAGAGAGCAAAGTGAGTGTGGG + Intergenic
1203520768 Un_GL000213v1:43246-43268 GAAGGGAGCACAGAGAGGGTGGG - Intergenic
1187683963 X:21798026-21798048 GAAGACAGCACAGTGGTTAGGGG + Intergenic
1187723890 X:22182388-22182410 AAGGAGAGTACGGTGATTGTGGG - Intronic
1187984312 X:24793885-24793907 GAAGAGAGCCTCTTGATTGTGGG + Intronic
1188711338 X:33404296-33404318 AAAGAAAGCACAGTGCTTTTTGG + Intergenic
1188716548 X:33465465-33465487 AAAGAGAGCACAATGATTGTGGG - Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188951930 X:36387015-36387037 GAAGAGAGCACAGGAAATTTAGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1189580580 X:42402147-42402169 GCAGACAGCACAGTGAGTGAGGG + Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1190498451 X:51051566-51051588 AAAGAGAGTAAAGTGATTATGGG + Intergenic
1190521508 X:51282852-51282874 AAAGAGAGTAGAGAGATTGTGGG + Intergenic
1190620940 X:52286246-52286268 GAAAAGAGCTCAGTGAATGATGG + Intergenic
1191812497 X:65204037-65204059 AGAGAGAACACAATGATTGTGGG - Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192858609 X:75040694-75040716 AGAGAGAGAACAGTGATAGTGGG - Intergenic
1192958903 X:76104971-76104993 GGAGACAGCACAGTGATTATGGG - Intergenic
1193092432 X:77509625-77509647 GAAAAGAGTACAGTGATTATGGG + Intronic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193738353 X:85186634-85186656 AAAGAGACCACAGTGACTGTGGG - Intergenic
1193931694 X:87561371-87561393 GGGGAAAGCAAAGTGATTGTAGG + Intronic
1194068119 X:89286844-89286866 GAAGAGAGAAGAGTGAGTGAAGG - Intergenic
1194196733 X:90903554-90903576 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1194693043 X:97010244-97010266 AGAGAGAGCACAATGATTGTGGG - Intronic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195048412 X:101075886-101075908 GAAGAGGCCAGAGTGATTGATGG + Intergenic
1195230901 X:102845813-102845835 TAAGAAAGCACAGTGATTGCTGG + Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195300339 X:103524160-103524182 TAAGAAAGCACAGTGATTGCTGG - Intergenic
1195303333 X:103554330-103554352 CAAGAAAGCACAGTGATTGCTGG - Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG + Intergenic
1197053802 X:122093477-122093499 GGGAAGAGCACAGCGATTGTGGG + Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1198541536 X:137645040-137645062 GAAGGGAGCTCAGGGACTGTGGG - Intergenic
1198697362 X:139355765-139355787 GAGAAAAGCACAGTGATTGTGGG - Intergenic
1198728624 X:139703240-139703262 GAAGAGAGAGGAGTGAGTGTAGG + Intronic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199893930 X:152114820-152114842 GGAGGGAGCACAGTGTCTGTGGG - Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1200542579 Y:4477755-4477777 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1200722265 Y:6621005-6621027 GAAGAGAGAAGAGTGAGTGAAGG - Intergenic