ID: 1168900129

View in Genome Browser
Species Human (GRCh38)
Location 20:1356771-1356793
Sequence GGATGGACACAATGGCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 272}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168900129 Original CRISPR GGATGGACACAATGGCAGAG TGG (reversed) Intronic
900605019 1:3520012-3520034 GGATGGACACTGTTGGAGAGGGG - Intronic
900623510 1:3597974-3597996 GGATGGAGACAGAGGCAGAGAGG + Intronic
900789838 1:4672653-4672675 GGATGCACACACTGGGAGGGCGG - Intronic
901439960 1:9271933-9271955 GCAGGGACCCCATGGCAGAGGGG + Intergenic
902684516 1:18067224-18067246 GGATGAAGACAAAGGGAGAGAGG + Intergenic
902980397 1:20118510-20118532 GGATGGACACAGTGGGTGGGAGG + Intronic
905851963 1:41281352-41281374 AGATGGTCACAAAGGCTGAGGGG + Intergenic
905867702 1:41385219-41385241 GGAGGGACCCACTGGCTGAGAGG + Intergenic
905941379 1:41866198-41866220 GGATGGACACATCTGCAGGGAGG + Intronic
907780568 1:57562473-57562495 GGATTGACAGAATGGCAGAATGG + Intronic
908103942 1:60821136-60821158 GTATGGACATAATAGCAGAGTGG + Intergenic
911225400 1:95299377-95299399 GGAAAGACAGAATTGCAGAGAGG - Intergenic
911365534 1:96933088-96933110 GGATGGAAAATATGGCAGAATGG - Intergenic
911746246 1:101444927-101444949 GAATAGACACGATTGCAGAGTGG - Intergenic
912365022 1:109126275-109126297 GGATGGACAGAAGGCCAGTGTGG + Intronic
912389219 1:109290342-109290364 CCATGTACACAATGGCAAAGAGG - Intergenic
920439868 1:205972725-205972747 GTACGGACACCATGGCTGAGGGG - Intergenic
921772430 1:219057380-219057402 GGATATACACCATGGCCGAGTGG + Intergenic
922537476 1:226391743-226391765 GGATGGACACACAGGTAGAAGGG - Intronic
923268412 1:232334138-232334160 AGATGGAAAAAATGGGAGAGTGG + Intergenic
923633780 1:235674241-235674263 GGATGAAAACAAGGGCAGACAGG - Intronic
923724424 1:236494234-236494256 GGGTGTAGACAAGGGCAGAGGGG - Intergenic
924500387 1:244632474-244632496 GGATGAAAACAATGGCACAAAGG + Intronic
1062964470 10:1596624-1596646 GGATGGACCCGCTGGCTGAGTGG + Intronic
1063519044 10:6724330-6724352 GCATGGAGAGAGTGGCAGAGTGG + Intergenic
1064533262 10:16331881-16331903 GGAAGGCCAACATGGCAGAGTGG + Intergenic
1064936631 10:20685770-20685792 GGATGGAGACGATGTGAGAGCGG - Intergenic
1067241503 10:44498825-44498847 GGATGGATTCAATGGTAGAGTGG + Intergenic
1068726235 10:60306247-60306269 TGATGGACACAAAGGCATAAGGG - Intronic
1072301957 10:94070424-94070446 GGATGGAGCCATTAGCAGAGAGG - Intronic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1072849230 10:98869802-98869824 GGAAGGAAACTATGGCTGAGAGG - Intronic
1072894836 10:99357975-99357997 GGACAGAAACAAGGGCAGAGAGG - Intronic
1075830995 10:125410869-125410891 GGATGGAGACTAGAGCAGAGGGG + Intergenic
1077061656 11:620238-620260 GGATGGAGACAGGGACAGAGGGG + Intronic
1077521970 11:3041771-3041793 GGATGGACAAAACGGCAAACTGG - Intronic
1077801419 11:5542303-5542325 GGATAGAAACAAGGCCAGAGCGG - Intronic
1078148086 11:8735794-8735816 GGAGGGACACAATGGGAGCCAGG + Intronic
1078438985 11:11348490-11348512 GGATGAAGACAATGTCAGTGTGG + Intronic
1079607208 11:22384995-22385017 GGATAGACATTATGGGAGAGAGG + Intergenic
1080098695 11:28434474-28434496 AGATGGAAAGAATAGCAGAGAGG - Intergenic
1080332198 11:31152713-31152735 GGATGGCCACAGGTGCAGAGTGG - Intronic
1080501540 11:32876159-32876181 GGATAGACAGAATAGCATAGTGG - Intergenic
1081595307 11:44454676-44454698 AGGAGGACACCATGGCAGAGAGG - Intergenic
1081668910 11:44932600-44932622 GGAAGGAGGCAGTGGCAGAGGGG - Exonic
1083736003 11:64681852-64681874 GGGTGTACACCATGCCAGAGAGG + Intronic
1083820747 11:65170100-65170122 GACTGGACTCACTGGCAGAGAGG + Intergenic
1084562071 11:69910795-69910817 GGAGGGAGACAGTGGCAGAGAGG - Intergenic
1084754428 11:71226184-71226206 GGATGGACTCAACAGCAGAATGG + Intronic
1086170778 11:83834091-83834113 GGATGCACACAAAAGCAGGGAGG + Intronic
1087665461 11:101041423-101041445 GGATGTTCACCATAGCAGAGGGG - Intronic
1087859151 11:103132262-103132284 GGATGGACTCAATAGCAGAGTGG - Intronic
1088510835 11:110573090-110573112 GTATGGGCTCAATAGCAGAGTGG - Intergenic
1088748524 11:112824413-112824435 AGATGAACAGAAGGGCAGAGTGG + Intergenic
1089712829 11:120328561-120328583 GGAAGGACACAGTGGGAGAGCGG - Intronic
1090258862 11:125304396-125304418 GGATGGAACATATGGCAGAGGGG + Intronic
1090643715 11:128750327-128750349 GGAAGGACACAATGGGACATTGG + Intronic
1090991618 11:131822187-131822209 AGATGGAAACAAAGACAGAGGGG - Intronic
1092098873 12:5866637-5866659 GGATGAACACAGGTGCAGAGAGG + Intronic
1092203326 12:6600713-6600735 GGAAGGACAGAGTGGCAGAGAGG + Intronic
1093381083 12:18493936-18493958 GGATGGACCAAGTGGGAGAGTGG + Intronic
1094368302 12:29707397-29707419 GGATGGACACAAGGGTTGAAGGG - Intronic
1096035648 12:48467637-48467659 GGAGGGTCAGAATGGCAGAGAGG + Intergenic
1096546093 12:52341253-52341275 GCTTGGGCACAGTGGCAGAGCGG - Intergenic
1096616613 12:52836640-52836662 GGCAGGACACAAAAGCAGAGGGG + Intergenic
1097848370 12:64388879-64388901 GAATGGAAACAATGGTAGTGAGG + Intronic
1097868907 12:64583697-64583719 GGATGGAAACCGAGGCAGAGAGG - Intergenic
1102012460 12:109627059-109627081 GGATGGACAGAATAGATGAGTGG + Intergenic
1102086001 12:110140411-110140433 GGAGGGACAGAAAGGCAGAAGGG - Intronic
1102739959 12:115198351-115198373 AGATGGACAAAATGGAAGAGGGG + Intergenic
1104571579 12:129930462-129930484 GCATGGAGATGATGGCAGAGAGG - Intergenic
1104599945 12:130146032-130146054 GGATGGACAAATTGGCAAGGGGG - Intergenic
1109335848 13:60992430-60992452 GGATGGAAACAATGGGAATGAGG + Intergenic
1110708964 13:78628746-78628768 GGACGGACAAAATGGAAGAAGGG + Intronic
1111428289 13:88118960-88118982 GGATGGACACAAGGACACAGCGG - Intergenic
1113448970 13:110392512-110392534 GAGTGGACACACAGGCAGAGGGG - Intronic
1113866309 13:113527924-113527946 GGATGGGCTAAGTGGCAGAGTGG - Intronic
1114483173 14:23047848-23047870 GGAGGGACACAAGGACAGGGAGG + Exonic
1117344218 14:54817083-54817105 GAATGGAAACAGTGGTAGAGGGG + Intergenic
1121945444 14:98116751-98116773 GAATCCACACAATGGCACAGTGG + Intergenic
1122326513 14:100883873-100883895 CGATGTACTCAGTGGCAGAGCGG + Exonic
1122884947 14:104706822-104706844 GGCTGGACACCCTGGCAGACAGG + Intronic
1122936151 14:104957244-104957266 GGAGGGACCCAAGGGCACAGAGG + Intronic
1124159202 15:27253614-27253636 AGCTGGACACAGGGGCAGAGCGG + Intronic
1124623254 15:31291974-31291996 GGATGGACTCAATAACAGAATGG - Intergenic
1125522616 15:40356641-40356663 GGATGTACAGGATGGCATAGAGG - Intergenic
1125929236 15:43588645-43588667 GGAAGGACTCAATGGAAGAAAGG - Intronic
1125942403 15:43688477-43688499 GGAAGGACTCAATGGAAGAAAGG - Intergenic
1127234439 15:57033049-57033071 GGATGGACTCAATAACAGAATGG + Intronic
1127390801 15:58503674-58503696 GGGTGGCCCCAAAGGCAGAGGGG + Intronic
1128081067 15:64857154-64857176 TTAAGGACAAAATGGCAGAGAGG - Intronic
1128877516 15:71214635-71214657 GGATGGACACTGTGGTTGAGAGG - Intronic
1129174052 15:73827126-73827148 GGACAGACAGAGTGGCAGAGGGG + Intergenic
1129821342 15:78604050-78604072 GGATCAACAAAATGTCAGAGCGG + Intronic
1130721292 15:86387802-86387824 GGATTCATACATTGGCAGAGCGG - Intronic
1131420312 15:92299400-92299422 GGAGGGAGACAGAGGCAGAGAGG + Intergenic
1133204629 16:4225934-4225956 GGCTGGACACAGTGGACGAGGGG - Intronic
1133733607 16:8596940-8596962 GGATGGTCATAGTGGCAGTGTGG - Intergenic
1134745413 16:16584328-16584350 GAATGGGAACAATGGCATAGAGG + Intergenic
1135000058 16:18769435-18769457 GAATGGGAACAATGGCACAGAGG - Intergenic
1135056427 16:19235810-19235832 GGATGAACTCAATAGCAGAATGG + Intronic
1136222179 16:28835801-28835823 GGATGGTCCCCATGGCAGACGGG - Intronic
1142128763 16:88422798-88422820 GGATGGACAGATGGGCAGATGGG + Intergenic
1143273066 17:5689840-5689862 GGATGGAAACAGATGCAGAGAGG - Intergenic
1147652230 17:42069233-42069255 TGATGGACACACAGGCAGACAGG - Intergenic
1148970947 17:51480890-51480912 CGATGGCCTCAATGGCAGAATGG - Intergenic
1152426854 17:80222729-80222751 GGAGGGACATAATGGCGGTGGGG - Exonic
1152470659 17:80488864-80488886 GGATGGACACAGTGGAGGGGAGG + Intergenic
1152470742 17:80489153-80489175 GGATGGACACAGTGGAGGGGAGG + Intergenic
1152470787 17:80489298-80489320 GGATGGACACAGTGGAGGGGAGG + Intergenic
1152470820 17:80489402-80489424 GGATGGACACAGTGGAGGGGAGG + Intergenic
1152470864 17:80489547-80489569 GGATGGACACAGTGGAGGGGAGG + Intergenic
1152470897 17:80489651-80489673 GGATGGACACAGTGGAGGGGAGG + Intergenic
1152470907 17:80489687-80489709 GGATGGACACAGTGGAGGGGAGG + Intergenic
1152470941 17:80489796-80489818 GGATGGACACAGTGGAGGGGAGG + Intergenic
1152470974 17:80489900-80489922 GGATGGACACAGTGGAGGGGAGG + Intergenic
1153277876 18:3385676-3385698 AGATGGACTCAATAGCAGAATGG + Intergenic
1153897354 18:9578145-9578167 GGATGGACACAATCGGACAAAGG + Intronic
1153927175 18:9844250-9844272 GAATGGAGAGAATGTCAGAGAGG - Intronic
1154356152 18:13624497-13624519 AGATGGAGAGAATGGCAGCGGGG - Intronic
1155582519 18:27325293-27325315 GGATGGGCTCAATAGCAGAATGG + Intergenic
1155857989 18:30858879-30858901 GGAAGGACACAAACCCAGAGAGG + Intergenic
1156154193 18:34281976-34281998 AGAGGGACACAATGGCAGAACGG + Intergenic
1156621660 18:38858665-38858687 GGATTGACTCAATAGCAGAATGG + Intergenic
1157764023 18:50284216-50284238 GGATGGACACACGGGCAGGTGGG + Intronic
1157995587 18:52551174-52551196 TGATGGAGATCATGGCAGAGCGG + Intronic
1158842586 18:61404055-61404077 GGAAGAACACACTGTCAGAGTGG + Intronic
1160106614 18:75983874-75983896 GAATGGACACAGTGGCCGATGGG - Intergenic
1161581191 19:5082019-5082041 GGCTGGACACAATGCCCGTGGGG - Intronic
1162229757 19:9256311-9256333 GGGTGTACACAATGTCACAGGGG + Intergenic
1165359353 19:35326163-35326185 GGATGGGCTCAATAGCAGAATGG - Intronic
1166302536 19:41920762-41920784 AGAGGGACAGAATGGCAGACAGG + Intronic
1167815498 19:51877129-51877151 GGATGGACACAGATGCAGAAAGG + Intronic
1168433851 19:56302496-56302518 GGAAGGAAAGAAGGGCAGAGAGG - Intronic
925002573 2:417591-417613 AGATGGACACAAGGCAAGAGAGG + Intergenic
927140398 2:20126327-20126349 GGCTGGAGACGAAGGCAGAGGGG + Intergenic
927553837 2:24019177-24019199 AGATTTACACAAAGGCAGAGAGG + Intronic
927716451 2:25356228-25356250 GGAGGGACAGAAGGACAGAGAGG + Intergenic
930005730 2:46895158-46895180 GGATAGGCTCAATGGCAGAATGG - Intergenic
930480991 2:51947979-51948001 GGATTCACAGAATGGCAGAATGG - Intergenic
933498002 2:83075735-83075757 AGATGGACACAAATGCAGATAGG - Intergenic
936302289 2:111313171-111313193 GGATGGAGACAAGGCCAGTGTGG - Intergenic
937060633 2:118977996-118978018 GAATAGACCCAATGGCACAGAGG - Intronic
939597963 2:144150998-144151020 GGTTGGAGCCAATGGGAGAGTGG + Intronic
940391790 2:153141016-153141038 GGATGGACAGAGTGGTAGAATGG - Intergenic
940581423 2:155584869-155584891 CTATGGTGACAATGGCAGAGGGG - Intergenic
940653506 2:156460928-156460950 AAAAGGACACAATGGGAGAGGGG - Intronic
941014052 2:160334456-160334478 GGAAGGAAACTAAGGCAGAGGGG + Intronic
941310751 2:163927873-163927895 GGATGTACTTAAGGGCAGAGTGG + Intergenic
942527724 2:176873083-176873105 GGATGGACTGAATAGCAGAATGG - Intergenic
945904437 2:215575334-215575356 GGATGGATTGAATGGCAAAGAGG - Intergenic
946491747 2:220155568-220155590 GGAAGTACAATATGGCAGAGGGG + Intergenic
947670548 2:231932928-231932950 GGATGGATAGAAAGGCAAAGGGG + Intergenic
948001882 2:234574599-234574621 GGATGGGCTCAATAGTAGAGTGG + Intergenic
948135369 2:235632394-235632416 GGAGGAACACACAGGCAGAGGGG - Intronic
948177743 2:235957462-235957484 AGAGGTACACAATGTCAGAGGGG - Intronic
1168900129 20:1356771-1356793 GGATGGACACAATGGCAGAGTGG - Intronic
1169321319 20:4635387-4635409 GGCTGGACACAGTGACAAAGGGG - Intergenic
1170305771 20:14936161-14936183 GCATGGAGACAATTGCAGGGAGG + Intronic
1170885518 20:20337255-20337277 GGATGGACAGAATGGGTGGGTGG + Intronic
1172114451 20:32565228-32565250 GGATGGACACACAGGCCGAGTGG + Intronic
1172601061 20:36183267-36183289 GGAGGGACCCAATGGGAGAGAGG - Intronic
1173403546 20:42745477-42745499 GGATTGTCACGATGGGAGAGGGG - Intronic
1174191639 20:48744710-48744732 TGATGGTCACTGTGGCAGAGGGG + Intronic
1174745176 20:53054861-53054883 AGATAGACACTATGGCAAAGTGG + Intronic
1175141727 20:56865594-56865616 GGATGGGGACAGTGGCACAGAGG + Intergenic
1175410106 20:58762186-58762208 GCATTGACCCAATGGCAGTGAGG - Intergenic
1175558471 20:59894279-59894301 GGGTTGTCACAATGACAGAGGGG + Intronic
1175954502 20:62602248-62602270 TGATGGACTCAATAGCAGAATGG - Intergenic
1178704952 21:34865493-34865515 GGATGGACACACTGGCGTCGAGG - Intronic
1179112939 21:38463036-38463058 AGATGGACACACTGGGAGATAGG - Intronic
1179497808 21:41784959-41784981 GAAGGGAGACAAAGGCAGAGTGG - Intergenic
1179561995 21:42221385-42221407 GGATGGACCCCAGGGCAGGGAGG - Intronic
1179680050 21:43013266-43013288 AGATGTTCACAGTGGCAGAGAGG - Intronic
1180676075 22:17587372-17587394 GGAAGGACACAGAGGCAGATAGG - Intronic
1181098253 22:20521019-20521041 TGATGCACACAATTGCACAGAGG - Intronic
1181851869 22:25755151-25755173 GGGTGGACAAAAGGGGAGAGGGG - Intronic
1182250823 22:28998907-28998929 GGATGGGGACAGTGGCAGGGAGG - Intronic
1182354629 22:29717082-29717104 GGAAGGAGACAAGGGGAGAGAGG - Intergenic
1182997197 22:34825000-34825022 GGATCCAGACAATGGGAGAGAGG + Intergenic
1183343270 22:37293783-37293805 GGAGGCACCCAGTGGCAGAGGGG - Intronic
1184308312 22:43624291-43624313 GGATGGACACAAAGGAGGAGAGG - Intronic
949532860 3:4974796-4974818 GGTTGGACTCAATGGTATAGAGG - Intergenic
952910588 3:38181216-38181238 GGACAGACTCAATAGCAGAGTGG - Intronic
953251961 3:41252509-41252531 GGATAGACTCAATAGCAGAATGG + Intronic
953411663 3:42693638-42693660 GGATGCAAAAACTGGCAGAGTGG - Exonic
955119331 3:56040938-56040960 GGAAGGACTCAACGGTAGAGTGG - Intronic
955600161 3:60636492-60636514 GGATGGACACAATGATCAAGAGG + Intronic
955601585 3:60651443-60651465 GGATGGCCACAATGGCCAATGGG - Intronic
960248153 3:115422376-115422398 GGATGGACAGAAGGGCAAAGGGG + Intergenic
960917278 3:122708917-122708939 GGATGGGCTCAATAGCATAGAGG - Intronic
961378598 3:126482869-126482891 GGGTGGCAAGAATGGCAGAGGGG - Intronic
961460240 3:127045499-127045521 GGAAGGACAGAAAGGGAGAGAGG + Intergenic
961906152 3:130264661-130264683 GGCTTGACACAATGTCAGGGCGG - Intergenic
962148221 3:132864376-132864398 GGATAGACTCAATAGCAGAATGG - Intergenic
962781769 3:138725610-138725632 GAATGGACCCAATAGCAGAATGG - Intronic
962787083 3:138778519-138778541 TGATGGACACATTGGCTGTGGGG - Intronic
963167241 3:142217398-142217420 GGATGGGCTCAATAGCAGAAGGG + Intronic
963289594 3:143474241-143474263 GGAAGGAGATAATGCCAGAGAGG + Intronic
963590801 3:147256084-147256106 GAAGGGACAAAATGGAAGAGAGG + Intergenic
963794612 3:149619050-149619072 AGACAGAAACAATGGCAGAGAGG + Intronic
964089121 3:152852032-152852054 AGATGGACTCAACAGCAGAGTGG + Intergenic
971774861 4:30950053-30950075 GGATGGACACCATTGTATAGGGG + Intronic
973605496 4:52583149-52583171 GGATGGAAAAAAGGGCAAAGTGG - Intergenic
978826206 4:113026987-113027009 GGTTGGACACAAAGGAAGAAGGG + Intronic
979151009 4:117314214-117314236 TGAAGGAAATAATGGCAGAGGGG - Intergenic
979171991 4:117611393-117611415 GGATGTCCACAGTGGCAGTGAGG - Intergenic
981776749 4:148377466-148377488 GGATTGGCTCAGTGGCAGAGGGG + Intronic
983279062 4:165657410-165657432 GAATGGACAAATTGGCATAGTGG - Intergenic
983558745 4:169080633-169080655 AGATGGAAAAAATCGCAGAGAGG + Intergenic
983709727 4:170698926-170698948 GGATGCACACACTGGCTGCGTGG - Intergenic
986036858 5:3949161-3949183 GGATTGATACAATGGTAGAATGG - Intergenic
987666520 5:20949001-20949023 TGATGGGCATAATGGCAGACTGG - Intergenic
987806064 5:22769732-22769754 GGATGGATATAATGGGGGAGTGG + Intronic
989172908 5:38491312-38491334 GCATGGAGACACTTGCAGAGTGG + Intronic
990238144 5:53790044-53790066 GAATGGAGACAATGGTAGATTGG + Intergenic
990528256 5:56649952-56649974 GGAAGGAGACAAAGGCAGGGTGG - Intergenic
990636315 5:57731844-57731866 CGATGAAAACAAAGGCAGAGAGG + Intergenic
990845784 5:60137002-60137024 GCATGGACACATTGGGAGTGGGG - Intronic
992095583 5:73359555-73359577 GGATGGACACAGATGCAGAGAGG - Intergenic
992112952 5:73513320-73513342 AGAAGGACATCATGGCAGAGCGG + Intergenic
992248927 5:74857888-74857910 GGATGGAAAAAATGGCATACTGG - Intronic
992707606 5:79413014-79413036 GAATGGACCCAATAGCAGAATGG + Intronic
993619924 5:90156210-90156232 GGAAGGACCAACTGGCAGAGTGG - Intergenic
994155474 5:96498787-96498809 GGATTAACACAATTTCAGAGGGG - Intergenic
994269761 5:97762921-97762943 GGATGGACAGAATGGCATTTGGG + Intergenic
995446258 5:112247394-112247416 GGAAGGACATAGTGGTAGAGGGG - Intronic
997627956 5:135343978-135344000 GGGAGAAGACAATGGCAGAGTGG - Exonic
997699351 5:135885551-135885573 GGAGGGACACAGTGCCAGAGGGG - Intronic
997937493 5:138126222-138126244 GGCTGGGCACAGTGGCACAGTGG + Intronic
998549439 5:143063280-143063302 GGAAAGACACAATGGCAGCTTGG - Intronic
999358099 5:150956227-150956249 GAATGGACTCAATAGCAGAATGG - Intergenic
1000761415 5:165229797-165229819 GCATCTACACTATGGCAGAGTGG + Intergenic
1002574692 5:180167340-180167362 GGATGGACTTAATAGCAGAATGG - Intronic
1003236842 6:4302522-4302544 TGGGGGACACAGTGGCAGAGGGG - Intergenic
1005078733 6:21935210-21935232 GGATGAACTCAAAAGCAGAGTGG - Intergenic
1005110666 6:22278750-22278772 GGATGGGCATAATCGTAGAGTGG - Intergenic
1006866079 6:37209982-37210004 GGATGGAGACGGAGGCAGAGGGG + Intergenic
1007117047 6:39350174-39350196 GTGTGGACACATTGGAAGAGCGG + Intronic
1007882847 6:45186509-45186531 GGATGCACTCAATGTTAGAGTGG + Intronic
1009718694 6:67435199-67435221 GGATGGAGACAGAGGCAAAGAGG - Intergenic
1010700254 6:79036262-79036284 GGATGTATACAATAGCAGTGTGG - Intronic
1012145397 6:95673976-95673998 GGATGGACTCAAGGGCATACTGG - Intergenic
1014296950 6:119630106-119630128 GGATGGGCTTAATTGCAGAGTGG + Intergenic
1015729752 6:136335502-136335524 GGATGGGCACAGTGGCAGGGGGG + Intergenic
1018044850 6:159956757-159956779 TGATGGCGAGAATGGCAGAGAGG - Intergenic
1018252151 6:161881920-161881942 GGACAGGCACCATGGCAGAGTGG + Intronic
1019489797 7:1306972-1306994 GGAAGGCCAGTATGGCAGAGGGG + Intergenic
1020570232 7:9850973-9850995 AGATGGTCACCATGGCAGTGTGG + Intergenic
1022862931 7:34386733-34386755 GGATGGAGATAATTGCAAAGAGG - Intergenic
1023925129 7:44663191-44663213 GGATAGGCTCAATGGCAGAATGG - Intronic
1024368072 7:48545919-48545941 GAATAGAGACAATGGGAGAGAGG + Intronic
1028058966 7:86285490-86285512 GAATGGACACAATAGCAAAATGG + Intergenic
1028918233 7:96283358-96283380 GGATGAACACAAAGGGAAAGAGG + Intronic
1031018028 7:116596673-116596695 TGATGAACACAAAGGCAGAGTGG + Intergenic
1031132445 7:117848284-117848306 GGATGGGCACCACAGCAGAGTGG - Intronic
1031478669 7:122252261-122252283 GGATAGAGACAATGGAAGATGGG - Intergenic
1031833188 7:126651305-126651327 GGATTGACAGAATGGCAGAATGG + Intronic
1031947869 7:127860014-127860036 AGATGTACATGATGGCAGAGCGG + Intronic
1032237638 7:130139244-130139266 GGAAGGAAAGAATGGAAGAGAGG + Intergenic
1033249073 7:139743242-139743264 TGATGGGCACAAAAGCAGAGGGG + Intronic
1034462477 7:151205443-151205465 GAGTGGACACAATGTCTGAGGGG - Exonic
1036018522 8:4815275-4815297 GGAAGGACACAAATGCAGATTGG - Intronic
1038947560 8:32378010-32378032 GGATGAACACAAAAGTAGAGTGG + Intronic
1039101179 8:33943514-33943536 GGAGGGACACCATCGCACAGTGG - Intergenic
1039461819 8:37751481-37751503 GAGTGCACACAAGGGCAGAGTGG - Intronic
1040059199 8:43090003-43090025 GGATAGATTCAATGGCAGAATGG - Intergenic
1044881665 8:96729300-96729322 GGATGGATAAAAGGGCAGAGAGG + Intronic
1046398227 8:113669670-113669692 GGATGGAGCCAATAGCAGAATGG - Intergenic
1049395580 8:142398648-142398670 GGATGGACACAGTGGCAAGCAGG - Intronic
1049447788 8:142639352-142639374 GGATGGACAGACAGGCAGATGGG + Intergenic
1050694298 9:8261756-8261778 TACTGGACAGAATGGCAGAGAGG + Intergenic
1052483288 9:29060771-29060793 GGATGGACTCAATAGCTGAATGG + Intergenic
1056930576 9:90873087-90873109 GTTTGGAAACAATGGCTGAGTGG + Intronic
1057807878 9:98233592-98233614 GGAAGGACAGAAGGGCAGAAAGG - Intronic
1057830614 9:98403374-98403396 AGCTGGACACAAATGCAGAGAGG + Intronic
1059024607 9:110612215-110612237 GGATGGGCTTAATGGCATAGGGG + Intergenic
1059434249 9:114266760-114266782 GGGTGGACGCCCTGGCAGAGAGG + Intronic
1060295552 9:122340735-122340757 CGCTGGACACAGAGGCAGAGGGG + Intergenic
1061192330 9:129089062-129089084 GGATGGACAGGATGACAGACAGG + Exonic
1061244740 9:129395674-129395696 GGATGGAAAAAATGGATGAGAGG + Intergenic
1061434233 9:130550903-130550925 GGATGAACACAGTGGCCGGGTGG - Intergenic
1062119292 9:134825488-134825510 GGGTGGACAGAAATGCAGAGAGG - Intronic
1186512577 X:10141077-10141099 GGAAGGACACACTGGCACATAGG - Intronic
1187284239 X:17887658-17887680 GGATGGGCTCAATAGCAGAATGG + Intergenic
1188839203 X:34994382-34994404 GGATAGACACAACAGCAGAATGG - Intergenic
1189507819 X:41630446-41630468 TGATAGGCACAATGGCAGAAGGG + Intronic
1189600558 X:42620484-42620506 AGAAAGACACAAAGGCAGAGAGG + Intergenic
1189713038 X:43834576-43834598 AAATGCACACAAAGGCAGAGAGG - Intronic
1189890338 X:45594981-45595003 GGATGGACACAGTAGCAGAATGG - Intergenic
1190173369 X:48129298-48129320 GGAGGGACACAATAAAAGAGTGG + Intergenic
1191009151 X:55743059-55743081 GGCTTGACAGAATGGCAGAATGG - Intronic
1192582350 X:72294865-72294887 GGATGGACTCAATAATAGAGTGG - Intronic
1194878236 X:99216929-99216951 GTATGGTCACAATGGTAGAGCGG + Intergenic
1196404007 X:115345756-115345778 GGAAAGTCAGAATGGCAGAGGGG + Intergenic
1199077399 X:143539820-143539842 AAATGTACACAATGGCAGAATGG + Intergenic
1201917946 Y:19202964-19202986 GTATGCACACAAAGACAGAGTGG - Intergenic