ID: 1168902720

View in Genome Browser
Species Human (GRCh38)
Location 20:1378574-1378596
Sequence CACACGTACCATTCTAGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 211}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168902720 Original CRISPR CACACGTACCATTCTAGTGG GGG Intronic
901771780 1:11534274-11534296 CACACGCACCACTCCATTGGTGG + Intronic
902424924 1:16312707-16312729 CACATGTACCACTCTGGTGGGGG + Intronic
903727731 1:25463954-25463976 CAAATGTACCACTCTGGTGGGGG - Intronic
904518589 1:31076494-31076516 CAAATGTACCATTCTGGTGCTGG + Intergenic
908238111 1:62166818-62166840 CAAATGTACCATTCTGGTGGAGG - Intergenic
909471083 1:76028879-76028901 CAAATGTACCACTCTCGTGGAGG + Intergenic
910097428 1:83539347-83539369 CAAATGTACCACTCTGGTGGGGG + Intergenic
910640953 1:89461399-89461421 CACAAGTGCCACTCTAGAGGAGG + Intergenic
910732142 1:90409688-90409710 CAAAGGTACCACTCTGGTGGGGG - Intergenic
911664346 1:100537159-100537181 CAGACGAACCACTCTGGTGGGGG - Intergenic
913493370 1:119404056-119404078 CAAAGGTACCATTCTGGTGCAGG + Intergenic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
914993990 1:152524305-152524327 CAAATGTACCACTCTGGTGGGGG - Intronic
915982785 1:160431919-160431941 CAAATGTACCACTCTGGTGGGGG + Intergenic
916004203 1:160644945-160644967 CAAATGTACCATCCTGGTGGGGG + Intronic
916052595 1:161046979-161047001 CACAGGTCCCACTCTAGTGAAGG - Exonic
917585139 1:176418220-176418242 CAAATGTACCACTCTAATGGAGG - Intergenic
917616360 1:176749395-176749417 CAAATGTACCACTCTGGTGGGGG - Intronic
918557614 1:185822248-185822270 CAAATGTACCACTCTGGTGGGGG + Intronic
919633473 1:199981633-199981655 CAAATGTACCACTCTGGTGGGGG - Intergenic
920361108 1:205417079-205417101 CACTGGTACCATTAGAGTGGAGG - Intronic
920507748 1:206528601-206528623 CAAATGTACCACTCTGGTGGGGG + Intronic
921121395 1:212140548-212140570 CTCATGTTACATTCTAGTGGAGG - Intergenic
921172839 1:212564565-212564587 CAAACGTGCCAGTCTGGTGGGGG + Intergenic
923417027 1:233772959-233772981 CAAATGTACCATTCTGGTGGGGG - Intergenic
923940756 1:238823114-238823136 CAAATGTATCACTCTAGTGGGGG + Intergenic
924700962 1:246451674-246451696 CAAACGTGCCATTCTGGCGGGGG + Intronic
1065828550 10:29594458-29594480 CGTATGTACCACTCTAGTGGGGG + Intronic
1067150596 10:43729456-43729478 CTCAGGTTCTATTCTAGTGGTGG + Intergenic
1068295270 10:55062779-55062801 CATATGTACCACTCTAGTGGAGG + Intronic
1069332180 10:67305697-67305719 CACATCTACCACTCTAGTGCAGG - Intronic
1070195639 10:74153971-74153993 CACAGGTACCATCCTCTTGGTGG + Intronic
1070204299 10:74241325-74241347 CAAATGTACCACTCTGGTGGGGG - Intronic
1071370097 10:84942462-84942484 CACACTCACCATTCTCTTGGGGG - Intergenic
1072528122 10:96292757-96292779 CAAATGTACCACTCTGGTGGGGG - Intergenic
1072942264 10:99776731-99776753 CAAATGTACCACTCTGGTGGGGG - Intergenic
1074150147 10:110751993-110752015 CAAAAGTACCAGTCTGGTGGGGG - Intronic
1076273125 10:129174078-129174100 CAAAAGTACCATTTTAGTGGGGG - Intergenic
1081459538 11:43259203-43259225 CAAACGTACCACTCTAGTTGGGG + Intergenic
1084283444 11:68115432-68115454 CAAATGTCCCATTCTGGTGGGGG + Intronic
1084491526 11:69481244-69481266 CACAAGCCCCATTCTAATGGTGG - Intergenic
1084924200 11:72498854-72498876 CAAATGTACCACTCTGGTGGGGG - Intergenic
1085162155 11:74358201-74358223 CATATGTACCACTCTAATGGGGG + Intronic
1087289587 11:96305393-96305415 CAAACATACCACTCTGGTGGAGG + Intronic
1089394628 11:118128292-118128314 CCCATGTACCACTCTGGTGGGGG - Intergenic
1090580108 11:128150327-128150349 CACAGGTACTATTGCAGTGGAGG + Intergenic
1092775337 12:11940161-11940183 CAAACGTACCACTCTGGTGCTGG + Intergenic
1093842329 12:23919183-23919205 CACAGGAGCCATTCTAGTTGGGG - Intronic
1095522000 12:43077663-43077685 CAAATGTACCACTCTGGTGGGGG + Intergenic
1095522779 12:43086655-43086677 CAAATGTATCATTCTGGTGGTGG + Intergenic
1096564344 12:52464947-52464969 CAAATGTACCACTCTGGTGGGGG + Intergenic
1098285284 12:68900995-68901017 CAAATGTACCACTCTGGTGGGGG + Intronic
1098656398 12:73035708-73035730 CAAATGTACCACTCTAGTGGAGG - Intergenic
1099087393 12:78262258-78262280 CCCCTGTTCCATTCTAGTGGGGG + Intergenic
1099166966 12:79318537-79318559 CCCACGTACAATTCTAGATGAGG + Intronic
1100076430 12:90790168-90790190 CAGATGTACCACTCTGGTGGGGG + Intergenic
1100082819 12:90873983-90874005 CAAATGTACCACTCTGGTGGGGG + Intergenic
1100551183 12:95647591-95647613 TACACTCTCCATTCTAGTGGGGG - Intergenic
1100610950 12:96192161-96192183 CAAAGGTACCACTCTGGTGGGGG - Intergenic
1100911758 12:99372171-99372193 CACATGTACCACTCTAGTGGGGG + Intronic
1103364808 12:120374093-120374115 CAAATGTACCACTCTGGTGGGGG - Intergenic
1105387860 13:19948726-19948748 AAAACGTACCACTCTGGTGGGGG + Intergenic
1105643739 13:22294145-22294167 CAAATGTACCACTCTAATGGTGG - Intergenic
1107160278 13:37217661-37217683 CAAACGTGCCAGTCTGGTGGGGG - Intergenic
1109103844 13:58223148-58223170 TACACGTTCAAATCTAGTGGAGG - Intergenic
1110956918 13:81564428-81564450 CACACGTACCACTCTCATGGGGG - Intergenic
1114358604 14:21943513-21943535 CAAATGTACCACTCTGGTGGTGG - Intergenic
1114764833 14:25359106-25359128 CAAATGTACCACTCTGGTGGAGG - Intergenic
1116105124 14:40492842-40492864 CTGATGTACCATTCTGGTGGAGG - Intergenic
1116315565 14:43386999-43387021 AAAATGTACCATTCTGGTGGGGG + Intergenic
1116839944 14:49809940-49809962 CAAATGTACCGTTCTGGTGGGGG + Intronic
1119028948 14:71176434-71176456 CATATGTACCAGTCTGGTGGGGG - Intergenic
1119197737 14:72729964-72729986 CAAATGCACCACTCTAGTGGAGG + Intronic
1119303439 14:73589036-73589058 CAAATGTACCATTCTGGTGGGGG - Intergenic
1127183972 15:56458400-56458422 CAAATGTACCAGTCTAATGGAGG - Intronic
1128518277 15:68357827-68357849 CACACGTGCCCTTCTAATGCTGG + Intronic
1130165188 15:81448676-81448698 CAAAGGAACCATTCTGGTGGAGG + Intergenic
1130194657 15:81768161-81768183 CAAATGTACCATTCTGGTGGGGG + Intergenic
1130449838 15:84040275-84040297 CAAATGTACCATTCTGGTGGGGG - Intergenic
1135662019 16:24305153-24305175 CAAATGTGCCATTCTGGTGGGGG + Intronic
1135847892 16:25935267-25935289 CCAACGTACCACTCTGGTGGGGG - Intronic
1136400514 16:30015063-30015085 CACAGTTACCATTCTTGTGCAGG - Intronic
1137692621 16:50440145-50440167 CAAATGTACCACTCTGGTGGGGG + Intergenic
1138176940 16:54909126-54909148 CAAACGCACCATTCTGGTGTGGG + Intergenic
1138671912 16:58622316-58622338 AAAATGTACCACTCTAGTGGGGG + Intronic
1139837480 16:69850912-69850934 CAAATGTACCACTCTGGTGGGGG - Intronic
1140709274 16:77661374-77661396 CAAATATACCATTCTAGTGTGGG - Intergenic
1141336489 16:83160229-83160251 CAAATGTACCACTCTGGTGGGGG + Intronic
1142065549 16:88060320-88060342 CACACTGACCATCCAAGTGGAGG - Intronic
1144583305 17:16472428-16472450 CCCACGTACCCCTCCAGTGGGGG - Intronic
1146281349 17:31546802-31546824 CAGATGTACCACTCTAGTGGAGG - Intergenic
1148034468 17:44648465-44648487 CATATGTACCATTCTAGTGCAGG + Intergenic
1148387791 17:47247394-47247416 CAAATGTACCACTCTGGTGGGGG + Intergenic
1149954831 17:61037022-61037044 CACACGTACCACTCTGGTTGGGG - Intronic
1150543117 17:66124072-66124094 CACATGTACCACTCAAGGGGTGG + Intronic
1155383014 18:25245372-25245394 CAAATGTACCATTCTGGTGGGGG - Intronic
1156131664 18:33983375-33983397 CAAATGTACCATTCTGGTGAGGG + Intronic
1156187635 18:34681758-34681780 CAAATATACCATTCTGGTGGAGG - Intronic
1158534446 18:58295063-58295085 CAAACATACCACTCTGGTGGGGG - Intronic
1158730963 18:60022055-60022077 CAAGCGTACCACTCTGGTGGGGG - Intergenic
1158937333 18:62376560-62376582 CAAATGTACCACTCTAGTGGGGG - Intronic
1159608283 18:70498011-70498033 CACATGTACCACTCTGCTGGTGG - Intergenic
1160689320 19:453933-453955 CACACGTACCATTTTGGCGCTGG - Intronic
1165647048 19:37449451-37449473 CACACGCACAATTATAGTTGGGG - Intronic
1165877169 19:39016319-39016341 AACATGTACCACTCTGGTGGGGG + Intronic
926266186 2:11323790-11323812 CAAACGTATCATTCTGGTGAGGG - Intronic
930241764 2:48942849-48942871 CACATGTGCCACTCTGGTGGGGG - Intergenic
931144052 2:59497327-59497349 CAACCGTACAATACTAGTGGGGG - Intergenic
931500744 2:62863296-62863318 CACACGTACCATTGTTGTCCAGG + Intronic
931531921 2:63224935-63224957 CAGATGTACCATTCTAGAAGGGG + Intronic
931900790 2:66785656-66785678 CAAATGTACCACTCTGGTGGTGG + Intergenic
936620567 2:114092756-114092778 CAAACACACCACTCTAGTGGAGG - Intergenic
936919408 2:117672193-117672215 CAAATGTACCACTCTGGTGGGGG + Intergenic
937140962 2:119599791-119599813 CACAGTTTACATTCTAGTGGGGG - Intronic
937598069 2:123694225-123694247 CAATTGTACCACTCTAGTGGGGG + Intergenic
939664375 2:144932671-144932693 CAAATGTACCACTCTGGTGGGGG - Intergenic
940539760 2:154997242-154997264 CAAATGTACCATCCTTGTGGGGG + Intergenic
942287025 2:174429575-174429597 CAAATGTACCATTCTGGTGCTGG - Exonic
942761716 2:179406590-179406612 CAAAAGTACCACTCTGGTGGGGG - Intergenic
942919022 2:181348281-181348303 CAAACATACCACTCTGGTGGGGG + Intergenic
945073287 2:206012515-206012537 CACTGCTACCATTCTAGTTGAGG - Intronic
1168902720 20:1378574-1378596 CACACGTACCATTCTAGTGGGGG + Intronic
1170316032 20:15042443-15042465 CACACGTCCCATTCTGCTGTAGG - Intronic
1170417036 20:16155656-16155678 CAAATGTACCACTCTAGTGGAGG + Intergenic
1170689175 20:18596863-18596885 CAAATGCACCACTCTAGTGGTGG - Intronic
1177484458 21:21738919-21738941 CAAATATACCACTCTAGTGGGGG + Intergenic
1177766083 21:25459085-25459107 CAAATGTACCATTCTGGTGCAGG + Intergenic
1183674915 22:39293793-39293815 TACACCTTCCATTCTAGTGGGGG - Intergenic
949693956 3:6672511-6672533 CAGATGTACCATTCTGGTGAGGG + Intergenic
950807176 3:15615710-15615732 CAAACATACCATTCTAGTCTGGG - Intronic
952917277 3:38256483-38256505 CAAATGTACTACTCTAGTGGGGG - Intergenic
953779817 3:45857831-45857853 CACATGTACCATTCTGGTGGGGG - Intronic
955479350 3:59373798-59373820 CAAATGTACCACTCTGGTGGGGG + Intergenic
955528960 3:59852477-59852499 CAAATGTACCAGTCTGGTGGGGG - Intronic
955677966 3:61469225-61469247 CAAATGTACCACTCTAGTGCAGG - Intergenic
957901762 3:86503353-86503375 TACATGTACCACTCTAATGGAGG - Intergenic
958146136 3:89628106-89628128 CAAATGTACCATTCTGGTGGGGG + Intergenic
964004889 3:151815073-151815095 CACAGTTGACATTCTAGTGGTGG + Intronic
964207657 3:154192133-154192155 CACAGGTGCCATTCTAGCAGTGG + Intronic
965641524 3:170833760-170833782 CAAATGTACCACTCTGGTGGGGG - Intronic
966765342 3:183456928-183456950 CCCATGTACCATTCTGGTGTGGG - Intergenic
967110910 3:186293074-186293096 CAAATGTACCACTCTGGTGGGGG - Intronic
967911109 3:194543224-194543246 CAAATGTACCATTGTGGTGGAGG - Intergenic
971904668 4:32711002-32711024 CAAATGTACCAGTCTGGTGGGGG - Intergenic
972807263 4:42542067-42542089 CAAATGTACCACTCTGGTGGGGG + Intronic
972911915 4:43827674-43827696 CAAATATACCATTCTAGTGTAGG + Intergenic
976064154 4:81164620-81164642 CACACCTAACACTCTAATGGTGG - Intronic
976172646 4:82319937-82319959 CAAATGTACCATTCTAGTGCAGG + Intergenic
976357912 4:84141981-84142003 CAAATGTACCATTCTGGTGAAGG + Intergenic
979560652 4:122097789-122097811 CAAAGGTACCACTCTGGTGGAGG - Intergenic
979991243 4:127378337-127378359 CAAATGTACCACTCTGGTGGGGG - Intergenic
980600029 4:135010943-135010965 CAAATGTACCACTCTGGTGGGGG - Intergenic
980728445 4:136796472-136796494 CACAATTGCCATTCTAGTGTGGG + Intergenic
982429245 4:155303688-155303710 CAAATGTATCATTCTGGTGGGGG + Intergenic
983110709 4:163745966-163745988 CAAATGTACCACTCTGGTGGGGG - Intronic
984100126 4:175474313-175474335 CAAATGTACCACTCTGGTGGGGG + Intergenic
985308093 4:188565759-188565781 CACATTTACCACTCTTGTGGGGG - Intergenic
985330440 4:188825873-188825895 CAACTGTACCATTCTGGTGGGGG - Intergenic
986942156 5:12966893-12966915 CACATGCACCATTCTAGTGAGGG - Intergenic
987196705 5:15534124-15534146 CAAACATACCACTCTGGTGGGGG - Intronic
988483397 5:31648274-31648296 CCCCCTTACCATTCCAGTGGGGG + Intronic
992495009 5:77283291-77283313 CAAATGTACCACTCTGGTGGGGG - Intronic
993348435 5:86815901-86815923 CAGTTGTACTATTCTAGTGGGGG + Intergenic
994703513 5:103168631-103168653 CAAATGCACCATTCTTGTGGGGG - Intronic
995466488 5:112454565-112454587 CAAATGTACCACTCTGGTGGGGG - Intergenic
998181440 5:139948331-139948353 CATACCAACCTTTCTAGTGGTGG + Intronic
998361883 5:141595358-141595380 CAAATGTACCACGCTAGTGGGGG + Intronic
999846140 5:155482664-155482686 CAAATGTACCATTCTGGTGGTGG + Intergenic
1000224770 5:159249904-159249926 CAAACGTACCACTCCAATGGGGG - Intergenic
1001373719 5:171233928-171233950 CAAATGCACCACTCTAGTGGGGG + Intronic
1004471480 6:15933374-15933396 CAAATGCACCATTCTGGTGGGGG - Intergenic
1004952010 6:20683666-20683688 CAAATGTACCATTCTGATGGGGG - Intronic
1006421575 6:33937466-33937488 CACATGTACCACTCTGGTGCAGG - Intergenic
1006992629 6:38228451-38228473 CAAATGTACCACTCTGGTGGAGG + Intronic
1012328246 6:97951157-97951179 CAAATGTACCATTCTAGTGTGGG - Intergenic
1012418311 6:99034060-99034082 CAAATGTACCACTCTGGTGGGGG + Intergenic
1013517751 6:110904086-110904108 CAAACGTGCCACTCTGGTGGGGG - Intergenic
1013566607 6:111370818-111370840 CACATGTACCACTCTGGTAGGGG - Intronic
1014324287 6:119972529-119972551 CATATGTACCACTCTGGTGGTGG + Intergenic
1014368834 6:120579705-120579727 CATACATATCATTCTGGTGGAGG + Intergenic
1014711924 6:124816469-124816491 TAAATGTACCATTCTAGTGTAGG + Intronic
1014716437 6:124869807-124869829 CAAATGTACCATTTTGGTGGAGG + Intergenic
1015049475 6:128821884-128821906 CAAATGTACCATTCTAGTGAAGG + Intergenic
1016101401 6:140105644-140105666 CAAATGTACCACTCTGGTGGGGG - Intergenic
1016125583 6:140398825-140398847 CACATGTCCCACTCTGGTGGGGG - Intergenic
1016222644 6:141693783-141693805 CAAATGTACCACTCTGGTGGGGG + Intergenic
1016430300 6:143977124-143977146 CAAATGTACCACTCTAGTGGGGG - Intronic
1017478752 6:154827967-154827989 TATACGTACCACTCTGGTGGAGG - Intronic
1017828411 6:158100888-158100910 CAAATGTACCAGTCTGGTGGGGG - Intergenic
1021620594 7:22547938-22547960 CACATGTACAATTATCGTGGAGG - Intronic
1021664056 7:22956643-22956665 CAAACGTACCACTCTGGTGCGGG + Intronic
1022249527 7:28593580-28593602 CACACCAACCATTCTTCTGGAGG - Intronic
1022480059 7:30737179-30737201 CAAATGTACCACTCTGGTGGGGG - Intronic
1022658237 7:32341042-32341064 CACATGTACCACTCCAGTGGGGG + Intergenic
1024035964 7:45507646-45507668 CAAATGTACCATTCTGGTGGGGG - Intergenic
1024466436 7:49716463-49716485 CGCACCTACCAAACTAGTGGAGG - Intergenic
1028586175 7:92454064-92454086 CAAGTGTACCACTCTAGTGGTGG + Intronic
1030290524 7:107867657-107867679 AACATGTACCACTCTTGTGGGGG + Intergenic
1030596867 7:111550491-111550513 CAAACGTACCATTCTGGTGGGGG + Intronic
1030723945 7:112902672-112902694 CAAATGTACCACTCTAGTGCTGG + Intronic
1031225329 7:119029847-119029869 CTAATGTACCACTCTAGTGGGGG + Intergenic
1031639973 7:124150596-124150618 CAAATTTACCACTCTAGTGGGGG - Intergenic
1032015314 7:128376330-128376352 CAAATGTACCATTCTGGTGAGGG - Intergenic
1033139318 7:138810856-138810878 CAAACGTACCAGGCTGGTGGGGG + Intronic
1033437872 7:141350380-141350402 CAGACCTTACATTCTAGTGGGGG - Intronic
1034068995 7:148164480-148164502 CACTCACACCATTCCAGTGGCGG + Intronic
1034499759 7:151441987-151442009 CAAATGTACCACTCTAATGGGGG - Intergenic
1036667662 8:10758097-10758119 CAAATGTACCACTCTGGTGGGGG - Intronic
1038961775 8:32527973-32527995 CACATGTACCAGTCAAGGGGAGG - Intronic
1039862938 8:41474806-41474828 CAAATGTACCATTCTGGTGTGGG - Intergenic
1040430005 8:47330310-47330332 CAAATATACCATTCTGGTGGGGG - Intronic
1042253762 8:66782431-66782453 CATATGTACCACTCTGGTGGGGG - Intronic
1043197715 8:77319789-77319811 CACACATACTATTCTATTGTTGG - Intergenic
1045037614 8:98188158-98188180 CAAATGTACCACTCTGGTGGGGG + Intergenic
1045271924 8:100669499-100669521 CAAAAGTACCACTCTGGTGGGGG - Intergenic
1046227457 8:111302716-111302738 CAAATGTACCACTCTGGTGGAGG + Intergenic
1048666087 8:136662926-136662948 CACATGGACCATGCTGGTGGAGG + Intergenic
1048697286 8:137041829-137041851 CACATGCAGCATTCTAGAGGAGG + Intergenic
1048994211 8:139781664-139781686 CAAATGTACCACTCTAGTGTGGG + Intronic
1050777348 9:9282267-9282289 CAAATGTACCATTCTGTTGGGGG + Intronic
1052133086 9:24874664-24874686 CAAATGTATCATTCTGGTGGGGG - Intergenic
1052783872 9:32810817-32810839 CAAATGTACCACTCTGGTGGGGG + Intergenic
1053187876 9:36034445-36034467 CAAATGTACCATTCTGGTGCAGG + Intergenic
1055072774 9:72184160-72184182 CAAATGTAGCATTCTGGTGGGGG - Intronic
1055538632 9:77277380-77277402 CAAATGTACCACTCTAGTGGAGG - Intronic
1055781507 9:79826259-79826281 CACATGTACTACTCTGGTGGAGG + Intergenic
1055981036 9:82001000-82001022 CAAATGTACCATTCTGGTGGAGG - Intergenic
1055992940 9:82127645-82127667 CAAATGTACCATTCTCGTGTGGG + Intergenic
1057462453 9:95275535-95275557 CAAATGTACCACTCTGGTGGGGG + Intronic
1060769058 9:126317687-126317709 CAAATGTACCACTCTGGTGGTGG + Intergenic
1186533391 X:10320464-10320486 CAAATGTTCCACTCTAGTGGGGG - Intergenic
1188502189 X:30839631-30839653 CAAACGTACCACTCTGGTGTAGG + Intronic
1189336442 X:40173389-40173411 CACACGTAGCATTGTACTGGAGG - Intronic
1194184438 X:90756491-90756513 CAAATGTACCACTCTGGTGGGGG + Intergenic
1195587477 X:106581793-106581815 CAGATGTACCACTCTGGTGGAGG + Intergenic
1197181488 X:123541629-123541651 CAGAGCTTCCATTCTAGTGGAGG + Intergenic
1197493136 X:127143221-127143243 TAAACGCACCATTCTAGTGAGGG + Intergenic
1198410839 X:136365986-136366008 CAAACATACCACTCTGGTGGGGG - Intronic
1198550169 X:137736843-137736865 CAAATGTACCACTGTAGTGGAGG - Intergenic
1198738486 X:139813978-139814000 CAAATGTACCATTCTGGTGTGGG + Intronic
1200021105 X:153209881-153209903 CAAAGGTACCACTCTGGTGGGGG - Intergenic