ID: 1168904341

View in Genome Browser
Species Human (GRCh38)
Location 20:1391807-1391829
Sequence TTGAGAAAGGGGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1573
Summary {0: 1, 1: 1, 2: 19, 3: 133, 4: 1419}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168904341 Original CRISPR TTGAGAAAGGGGAAGGAGGA GGG Intronic
900374339 1:2346722-2346744 TCGAGATGGGGGAAGGAGAAGGG - Intronic
900384087 1:2401410-2401432 ATGGGAGAGAGGAAGGAGGAAGG - Intronic
900977146 1:6025059-6025081 GGGAGAAGGGAGAAGGAGGAAGG - Intronic
901002563 1:6155802-6155824 TTGGCACAGGGGAAAGAGGAGGG + Intronic
901651140 1:10743843-10743865 TTGAGGAAAGGGAGGGAGGGAGG + Intronic
901927329 1:12574633-12574655 TTGGGAAAGGGAAGGCAGGATGG + Intronic
902036623 1:13462753-13462775 TTGGGAAGAGGGAAGGAGGCTGG + Intergenic
902320341 1:15658947-15658969 TAAAGAAAGGGGAATGTGGAGGG - Intronic
902688037 1:18091634-18091656 TTGAAAAATGGGAAGGAGGGGGG - Intergenic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902797963 1:18811644-18811666 GGGAGAAAGATGAAGGAGGAAGG - Intergenic
902798220 1:18813395-18813417 TTGGGAGACGTGAAGGAGGATGG + Intergenic
902813722 1:18904210-18904232 TTGGGGGAGGGGTAGGAGGACGG - Intronic
902992977 1:20202583-20202605 TTGGAGAAGGGGAAGGAGAATGG - Intergenic
903313287 1:22477885-22477907 GTGGGAAAGGGGAAGAAGGAAGG - Intronic
903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG + Exonic
903406263 1:23099095-23099117 TTGAGAATGAGGAAGCAGGTAGG - Intronic
903441065 1:23388145-23388167 TGGTGGAAGGGGAAGGAGGGTGG + Intronic
903912907 1:26741369-26741391 TTGAGAAAAGGAAATGAGCAAGG + Intronic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
904087191 1:27917133-27917155 AGGAGGAAGGGGAAGGAGGAAGG - Intergenic
904087196 1:27917146-27917168 TTTTTAAAGAGGAAGGAGGAAGG - Intergenic
904295760 1:29518852-29518874 AGGAGAATGAGGAAGGAGGAAGG - Intergenic
904348512 1:29889856-29889878 AGGAGAAATGGGAAGGAGGCAGG + Intergenic
904357158 1:29947779-29947801 ATGAGAAAAGGGGAAGAGGAAGG - Intergenic
904493935 1:30876520-30876542 TTGAGAAGGGACAGGGAGGAGGG - Intronic
904576773 1:31509919-31509941 AAGAGAAAGGGAATGGAGGAAGG - Intergenic
904677672 1:32208244-32208266 ATGAGTATAGGGAAGGAGGAAGG + Exonic
904713260 1:32447765-32447787 TAGGGGAAGGGGAAGGAGGGGGG - Intergenic
904897585 1:33828528-33828550 TAGAGGAAGGGGAATGAGGAAGG + Intronic
904921513 1:34011856-34011878 TTGTGAGTGGGGAGGGAGGAGGG - Intronic
905013110 1:34760228-34760250 TTGGGGATGGGGAAGGAGGAGGG + Intronic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905279126 1:36837693-36837715 TGGAGAAGGGGGAAAGAGGTAGG - Intronic
905286174 1:36881854-36881876 TTGAGGGAGGGAAAGAAGGATGG - Intronic
905325460 1:37148737-37148759 GGGAGATAGGGGAAGGAGGGAGG + Intergenic
905743251 1:40390548-40390570 TTGAGGAAGGGGAGTGTGGATGG + Intronic
906118738 1:43373266-43373288 TTGAGAAAGAGGATGGAGACGGG - Intergenic
906698847 1:47843068-47843090 TAGTGAAAGGGGGTGGAGGAGGG + Intronic
907074516 1:51566268-51566290 TGGAGATAGGAGAAGGAGGCTGG - Intergenic
907231270 1:53001272-53001294 GAGAAAAAGGGAAAGGAGGATGG + Intronic
907791270 1:57667005-57667027 TTGAGCAAGGAGAAGGATGGTGG - Intronic
907935828 1:59041463-59041485 TTAAGGAAGGGCAAGGAGGAAGG + Intergenic
907941558 1:59093230-59093252 TGGAGACAGGGTAAGGGGGAGGG + Intergenic
907975371 1:59426378-59426400 TGAAGGGAGGGGAAGGAGGAAGG + Intronic
908331478 1:63074970-63074992 TTGAGGATGGGGAGGGAGGAGGG - Intergenic
908558183 1:65278964-65278986 ATGGGGAAGGGGATGGAGGAGGG - Intronic
908572757 1:65426422-65426444 TTGAGAATGGGTTTGGAGGAGGG + Intronic
908874088 1:68649717-68649739 CTGTGAAAGGGAAAGAAGGATGG - Intergenic
909055875 1:70820527-70820549 TGGAGAAAGAGGAAGGACAAAGG + Intergenic
909224527 1:73000857-73000879 ATGAGACAGGGGTAGGAGCATGG + Intergenic
909705052 1:78571636-78571658 GTGAAAGAAGGGAAGGAGGAAGG - Intergenic
909739167 1:79006850-79006872 TGGGGAAAGGGGATGGAGGCCGG - Intergenic
909831472 1:80196680-80196702 GTGGGAAAAGGGAAGGTGGATGG + Intergenic
909882581 1:80898719-80898741 ATGAGAAAAAGGAAAGAGGAGGG - Intergenic
909940757 1:81608978-81609000 TTGAGAAAGAGGAGGCGGGATGG + Intronic
910238020 1:85055805-85055827 CGGAGAAAGGAGAATGAGGAAGG + Intronic
910240319 1:85079517-85079539 TTGAGAAGTTGGAGGGAGGATGG + Intronic
910397019 1:86803773-86803795 ATCAAAAAGGGGAAGGAGAAGGG - Intergenic
910549848 1:88463205-88463227 GGGAGAAAGGAGGAGGAGGAGGG - Intergenic
910607662 1:89104767-89104789 TTGTGAACGGGGCAGGGGGAGGG + Intergenic
910820001 1:91336149-91336171 TTGCAAGAAGGGAAGGAGGAGGG - Intronic
910840680 1:91558426-91558448 TTGGGGAGGGGGAAGGGGGATGG - Intergenic
910856155 1:91697948-91697970 AGGGGAAAGGGGAAGGGGGAAGG + Intronic
911109082 1:94164048-94164070 TTGAGGAAGAGGAATGTGGATGG - Intronic
911151122 1:94597630-94597652 TGGAGAAAGGGGCTGGAAGAGGG + Intergenic
911208947 1:95119515-95119537 TTGAGAAATGGGAAAGGGGCTGG + Intronic
911307507 1:96248986-96249008 TTATGAGAGGGGAAGGATGAGGG - Intergenic
911428230 1:97749096-97749118 TTGAGAAAGGGAAGGGAGATAGG - Intronic
911584059 1:99669810-99669832 ATTAAAAAGGAGAAGGAGGAGGG + Intronic
911694242 1:100870529-100870551 ATGAGGGAGGGGAAGAAGGAGGG + Intergenic
911748800 1:101471734-101471756 TAGATAAAGAGGAAGGATGAAGG + Intergenic
912032488 1:105265877-105265899 GTTAGAAAGGAGAAGGAGGTGGG - Intergenic
912564763 1:110579759-110579781 TGGAAAAAGGGCAAGGAGGAAGG + Intergenic
912573688 1:110644187-110644209 TTGAGAAAGGAAAAAGAGGTGGG - Intergenic
912810897 1:112793677-112793699 TTGAGGAAGGGCAAGGGGAAAGG + Intergenic
912959076 1:114179382-114179404 TTGGGAAAGGGAGAGGAAGAGGG - Intergenic
913010443 1:114677845-114677867 TTGAGGAAAGGGAAGAAGGAAGG - Intronic
913275991 1:117138185-117138207 TAGAGATGGCGGAAGGAGGATGG - Intergenic
913322876 1:117601583-117601605 ATGAGAAAGGGGTACGAGGTTGG + Intergenic
913450800 1:118991259-118991281 TGGAGAAAGAGTAAGCAGGATGG + Intergenic
913453700 1:119009395-119009417 TAGAGAAAGGAGAAAGATGAAGG + Intergenic
913939865 1:125091650-125091672 AGGAGGAGGGGGAAGGAGGAAGG + Intergenic
914412475 1:147444265-147444287 GTGAGGTAGGGGAAGGAGGGAGG + Intergenic
914684458 1:149965924-149965946 TTCAGAAATAGGAAGGTGGAAGG - Intronic
914838910 1:151231587-151231609 TTCAGAAAGGGGAAGCTAGAAGG - Intronic
914945825 1:152065229-152065251 TTGAGAAACTGGAAGGACGGTGG - Intergenic
915119492 1:153619988-153620010 TTAAGAAAGAAGAAGCAGGAAGG + Intronic
915839074 1:159201091-159201113 TTTGGAATGGGGAGGGAGGAGGG + Exonic
915952575 1:160199221-160199243 CTGAGCAAGGGGAAACAGGACGG + Intronic
915972324 1:160363373-160363395 TTGAGGGAGGGGAGGGAGGTTGG - Intergenic
916046679 1:161005282-161005304 GGGAGGGAGGGGAAGGAGGAAGG - Intronic
916064017 1:161121528-161121550 TTGACAAATGGGAAAAAGGAAGG + Exonic
916149335 1:161771206-161771228 AGGAGAAAGGAGGAGGAGGAGGG - Intronic
916151311 1:161794285-161794307 TTGAGAATGGGGAGGAAGAAGGG + Intronic
916203515 1:162294142-162294164 AAGAGAGAGGGGAAGAAGGAAGG + Intronic
916611360 1:166395148-166395170 GGGGGAAAGGGGAAGGAGGAGGG + Intergenic
916702183 1:167308537-167308559 GTGAGACCAGGGAAGGAGGAAGG - Intronic
916790830 1:168123682-168123704 AGGAGAAAGGGAAAGGAGAAGGG - Intronic
916874907 1:168958790-168958812 TTGAGATAGGGGAAGGAGGAGGG - Intergenic
917090803 1:171351347-171351369 GTGACAGAGGAGAAGGAGGAGGG + Intergenic
917224805 1:172770156-172770178 TGGAGTTAGGGGAAGGAGCAAGG + Intergenic
917313594 1:173702595-173702617 AGGAGAAGGAGGAAGGAGGAAGG + Intergenic
917653455 1:177102198-177102220 TTAAATAAGGGGAGGGAGGAAGG + Intronic
917794037 1:178520187-178520209 TTGGGGAAGGGGGATGAGGAAGG + Intronic
918045711 1:180939828-180939850 ATGAGAAAGGGGGAAGAGGCAGG - Intronic
918177999 1:182061867-182061889 CTGAGAGGAGGGAAGGAGGAAGG - Intergenic
918371364 1:183864761-183864783 TAGAGAAAGGAGCAGGTGGATGG + Intronic
918448269 1:184635358-184635380 GGGAGAAAGAAGAAGGAGGAAGG - Intergenic
918472418 1:184887549-184887571 AGGAGAAAAGGAAAGGAGGAGGG - Intronic
918656809 1:187037010-187037032 ATGAGAAGGGGGATGGGGGAGGG + Intergenic
918703829 1:187637389-187637411 TTGGGGATGGAGAAGGAGGAGGG - Intergenic
918833982 1:189435533-189435555 AAGGGGAAGGGGAAGGAGGAAGG + Intergenic
919123462 1:193369380-193369402 ATCAGACAGGGGAAGGAGGCTGG - Intergenic
919153154 1:193725571-193725593 ATGAGAGAAGAGAAGGAGGAAGG - Intergenic
919218416 1:194592023-194592045 TTCAGAGAGGTGAAGGAGGCTGG - Intergenic
919233281 1:194804219-194804241 TTGGGAAAGGGGGATGAAGATGG - Intergenic
919277051 1:195433894-195433916 TCGAGAGAAGGAAAGGAGGATGG + Intergenic
919434828 1:197544961-197544983 AGGAGAAGGAGGAAGGAGGAAGG + Intronic
919693071 1:200544735-200544757 GTGAGGAAGGGGAGGGAGGGAGG + Intergenic
919922619 1:202175536-202175558 TTGAGTAAAGGCAAGGAGCATGG - Intergenic
919990142 1:202703778-202703800 TGGAGAAATGGGATGAAGGAAGG - Intronic
920144284 1:203844827-203844849 CAGAAAAAGGGGAGGGAGGAGGG - Intronic
920160912 1:203997109-203997131 TGGAAAAAGGGGAGGGGGGAGGG - Intergenic
920217564 1:204371960-204371982 TTAAGGAAGGGGAAGCATGAAGG + Intronic
920942340 1:210495567-210495589 TAGAGAAAGAGGGAGAAGGAGGG - Intronic
920975276 1:210780042-210780064 TTGAGAAAGCTGAAGGTGGGTGG + Intronic
921269890 1:213458146-213458168 TTGTAGAGGGGGAAGGAGGATGG - Intergenic
921312332 1:213856524-213856546 TGGAGAAAGGAAATGGAGGAAGG - Intergenic
921586623 1:216954031-216954053 TTGAAAAATAGGAAGGAGCATGG - Intronic
921732529 1:218594112-218594134 TGGAGCAAAGGGCAGGAGGACGG - Intergenic
921818371 1:219589387-219589409 ATGAAAAAGGGAGAGGAGGAGGG + Intergenic
921942159 1:220853518-220853540 ATGGGAAAGGGAAAGGAGGAAGG - Intergenic
921957614 1:221000484-221000506 TCGGGACAGGGGAAGGAAGAGGG - Intergenic
921995343 1:221411850-221411872 TTGAGAAAGGAGAATGACCATGG - Intergenic
922191536 1:223323174-223323196 GTGACAAAAAGGAAGGAGGAAGG + Intronic
922570317 1:226630879-226630901 AGGAGAAAGGAGAAGAAGGAAGG + Intergenic
922614145 1:226951228-226951250 CTGAGAAAGTGGAGGGATGAAGG + Intronic
922874100 1:228926506-228926528 TTGACAAGTGGGAAGGAAGACGG + Intergenic
922894430 1:229089283-229089305 TTGAGGAGGGGGAGAGAGGAGGG + Intergenic
923119463 1:230977719-230977741 TAGAGAAGGGGGAAAGAGAAAGG + Intronic
923127764 1:231047329-231047351 AGGAGGAAGGGGAAAGAGGAGGG - Intergenic
923314058 1:232762298-232762320 CTGAGGAAGAGGAAGAAGGATGG - Intergenic
923576314 1:235161904-235161926 TTGCAGAAGGGGAAAGAGGAGGG - Intronic
923842397 1:237687411-237687433 AAGAGAAAAGGGAAGGGGGAAGG - Intronic
924286286 1:242490900-242490922 TTTACAAAGAGGAAGCAGGAAGG - Intronic
924603170 1:245509437-245509459 TGGTGAGAGGGGAATGAGGAGGG - Intronic
1062878951 10:963080-963102 TGGAGGAAGGAGAAGGAGAAAGG - Intergenic
1063245747 10:4216454-4216476 CTTAGGAAGGGGAAGAAGGATGG + Intergenic
1063348057 10:5329623-5329645 TAGAGGAAGGGGAAGGGGGTTGG - Intergenic
1063362408 10:5469180-5469202 AAGAGACAGAGGAAGGAGGAGGG - Intergenic
1063440794 10:6071423-6071445 TGGAGGAAGAGGAAGGAGGAGGG - Intergenic
1063475333 10:6323477-6323499 GTGAGAAAGGGGCATGAGGCTGG - Intergenic
1063538447 10:6908561-6908583 TTGAGAAAGCAGAAGCAGGAAGG + Intergenic
1063790978 10:9447521-9447543 GAGAGGAAGGGGAAGGGGGAAGG - Intergenic
1063802287 10:9594064-9594086 TTCACAAGGGGGAAGGAGGAAGG + Intergenic
1064267342 10:13835833-13835855 TGGTGAAAGGGGGAGGGGGATGG - Intronic
1065089520 10:22218004-22218026 TAGAGAAAGAGCAAGGACGAGGG + Intergenic
1065229178 10:23579511-23579533 TTGAGCAAAAGGAAAGAGGAGGG + Intergenic
1065276197 10:24088436-24088458 TTGAGTAGGGGGAGGGGGGAGGG - Intronic
1065368013 10:24953230-24953252 TGGAGAAAGGTGGAGGAAGATGG - Intergenic
1065473989 10:26114114-26114136 TTGAGAAAGGACAGGGAGGCAGG - Intronic
1066087956 10:31989369-31989391 TTGGGAAAGGGCAAGGACCAAGG - Intergenic
1066397587 10:35041249-35041271 CTGAGAGAGGTGAAGGAGGATGG + Intronic
1066950243 10:42110747-42110769 ATGAGAGAAGGGAGGGAGGAAGG - Intergenic
1067062463 10:43084847-43084869 TGGAGGAAGGGGAAGGTGCAAGG + Intronic
1067211974 10:44266897-44266919 TTTAGAAAGAGGAAAGAGAAAGG + Intergenic
1067316303 10:45167498-45167520 TTTAAAAAGGTGAAGGAGGAGGG - Intergenic
1067371046 10:45682828-45682850 AGGAGAGAGGGGAAGGGGGAAGG + Intergenic
1067388736 10:45843322-45843344 AGGAGAGAGGGGAAGGGGGAAGG - Intronic
1067409962 10:46055542-46055564 AGGAGGAAGGGGAAGGAGAAGGG - Intergenic
1067417329 10:46113634-46113656 AGGAGAGAGGGGAAGGGGGAAGG + Intergenic
1067445528 10:46341245-46341267 AGGAGAGAGGGGAAGGGGGAAGG + Intergenic
1067454786 10:46411669-46411691 TTGAGAATGAGAAAGCAGGAAGG + Intergenic
1067502742 10:46820517-46820539 AAGAGAGAGGGGAAGGGGGAAGG + Intergenic
1067591848 10:47519496-47519518 AAGAGAGAGGGGAAGGGGGAAGG - Intronic
1067632418 10:47972965-47972987 TTGAGAATGAGAAAGCAGGAAGG - Intergenic
1067638963 10:48027569-48027591 AAGAGAGAGGGGAAGGGGGAAGG - Intergenic
1067832305 10:49617177-49617199 GGGGGAAAGGGGAAGGGGGAAGG - Intronic
1067874519 10:49992732-49992754 AGGAGAGAGGGGAAGGGGGAAGG + Intronic
1067964169 10:50890155-50890177 TTGAGCCAGGGCAGGGAGGATGG - Intergenic
1068075521 10:52248965-52248987 TGGGGAAGGGGGAAGGGGGAAGG - Intronic
1068283295 10:54904853-54904875 TGGAGAAAAGGGAAGAAGGTGGG + Intronic
1068430992 10:56931960-56931982 TTGTACAAGGGGAAGGATGAGGG + Intergenic
1068650524 10:59517764-59517786 GAGAGAAGTGGGAAGGAGGAGGG - Intergenic
1068757280 10:60669779-60669801 TATAGAAAGGGAAAGGAAGAGGG - Intronic
1068884234 10:62082008-62082030 TTAAGAAAGAAGAATGAGGAGGG + Intronic
1069060975 10:63894190-63894212 ATGGGAGAAGGGAAGGAGGAAGG - Intergenic
1069089598 10:64183687-64183709 TTGAGAAAGATGTAGAAGGATGG + Intergenic
1069133935 10:64740692-64740714 ATGAGAAAAGGGAAGGATGCCGG - Intergenic
1069603947 10:69728309-69728331 TGGAGGAAGGGGAAGCAGGAAGG - Intergenic
1069633397 10:69911190-69911212 TTGAGAAGGGGCAAGGGGAAGGG - Intronic
1069651551 10:70053270-70053292 TACTGAGAGGGGAAGGAGGAGGG + Intronic
1070135951 10:73693726-73693748 AGGAGAGAGGGGAAGGGGGAAGG - Intronic
1070158241 10:73849673-73849695 TGGAGAAAGAGAAAGAAGGAAGG - Intronic
1070481244 10:76884739-76884761 TTTAGAAAGTGGAAGAAGGAAGG + Intronic
1071404538 10:85317564-85317586 TAGAGAAGGGGGCAGGAAGAGGG - Intergenic
1071445964 10:85747522-85747544 AAGAGGAAGGGGCAGGAGGAAGG - Intronic
1071544047 10:86514487-86514509 TTGTGAAGGAGGAAGGAAGATGG + Intronic
1071553252 10:86583710-86583732 ATGAGAGGAGGGAAGGAGGATGG - Intergenic
1071808832 10:89155602-89155624 CTGAGAAACAGGAAGGAAGAGGG + Intergenic
1071988684 10:91077637-91077659 TTGAGAAAGGGGTGGGAAAAGGG - Intergenic
1072108022 10:92291830-92291852 TTGGGGAGGGGGAAGGGGGAGGG - Intronic
1072723221 10:97793684-97793706 GGAAGAAAGGGGAAGAAGGAAGG - Intergenic
1072802781 10:98404992-98405014 GTGAGGGAGGGGAGGGAGGATGG + Intronic
1072877731 10:99191042-99191064 TGAAGAAAGGGGAAAGAAGAAGG + Intronic
1072979502 10:100087911-100087933 AGGAGAAAGGGGAAGGGAGAGGG + Intergenic
1073040309 10:100599679-100599701 TTAAGAAAAGGTAAGAAGGAAGG - Intergenic
1073061649 10:100737086-100737108 ATGGGAAAGGGAAAGAAGGAGGG - Intronic
1073201672 10:101740530-101740552 TTGGGAAAGTGGGAGGAGAAGGG + Intergenic
1073217018 10:101842082-101842104 TTGAGACCTGGGAAGGGGGAGGG - Intronic
1073348513 10:102802095-102802117 AGGAGAAGGTGGAAGGAGGAGGG - Intronic
1073634894 10:105187592-105187614 TGGAGGGAGGGAAAGGAGGAGGG + Intronic
1073984478 10:109192857-109192879 CTGAGGAAGTGGAAGGAGTAAGG - Intergenic
1074079007 10:110152684-110152706 TTCTGAATGGGGAAGGAGGAAGG + Intergenic
1074247333 10:111708113-111708135 TTGAGAAAGGGAAAGCAAGATGG - Intergenic
1074284049 10:112081148-112081170 AAGAGAAAAGGAAAGGAGGAAGG + Intergenic
1074339934 10:112618599-112618621 TTGGCCTAGGGGAAGGAGGAAGG + Intronic
1074737008 10:116445935-116445957 TTGGGAATGGGGTAGGAAGATGG + Intronic
1074773757 10:116750964-116750986 TGAAGAAAGAGGAAGGAAGAAGG + Intergenic
1074869245 10:117564074-117564096 CTGAGAGAGGGGCAGGAGGAGGG - Intergenic
1075075876 10:119349787-119349809 TTGAGGAAGGAAGAGGAGGAAGG + Intronic
1075131571 10:119744312-119744334 TTTAGCAAGGGGAAGGATGGAGG - Intronic
1075244954 10:120812838-120812860 TTGAGGAAAGGTAAGAAGGAAGG - Intergenic
1075317248 10:121462698-121462720 TTGGGAAATGAGAAGGAGAATGG + Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075338017 10:121622738-121622760 TAGAGAAAGGGGAAGAAGGAGGG - Intergenic
1075688008 10:124377384-124377406 TTGAGAAAAGGGCACGAGGAAGG - Intergenic
1075813075 10:125241421-125241443 TTGAGAGATGGTAAGAAGGAGGG + Intergenic
1075931488 10:126300397-126300419 TTTGGTAAGGGGAAGAAGGAAGG - Intronic
1076087705 10:127649794-127649816 TTGAGGAAGAGGAAGGGGAACGG - Intergenic
1076114608 10:127886585-127886607 GAGAGAAAAGGGCAGGAGGAGGG + Intronic
1076169056 10:128304941-128304963 TTTAGAAAGGTCAAGGAGGGAGG - Intergenic
1076268829 10:129132814-129132836 TTGAGAAAGAGGCAGGATGCAGG - Intergenic
1077398201 11:2336992-2337014 TAGGGGAAGGGGAAGGAGAAGGG + Intergenic
1077652317 11:3984160-3984182 TTAAGAAAGGAGAAAGAGGCTGG - Intronic
1077887022 11:6394082-6394104 GTGGGATAGGGGAAGGAGGTTGG + Intronic
1077972824 11:7213097-7213119 CTGAGGAATGGTAAGGAGGATGG + Intergenic
1078078482 11:8183870-8183892 TTAATAAAGGGGCAGGAGGTGGG - Intergenic
1078120853 11:8507537-8507559 GTGGTAAAGGTGAAGGAGGAAGG + Intronic
1078146240 11:8723478-8723500 TTGAGAGAAGGGAAAGAGGAGGG + Intronic
1078152889 11:8774378-8774400 TGGAGGAAGGGAAAGCAGGAAGG - Intronic
1078501216 11:11879487-11879509 TTGAGAAAGTTTAAGCAGGAAGG + Intronic
1078525149 11:12095046-12095068 TTGATGAAAGGGAGGGAGGAAGG + Intronic
1078575056 11:12494302-12494324 ATGAGAAAGGGGAAGGAAGCTGG - Intronic
1078609792 11:12810273-12810295 TTAAGAATGGGGAAAGAGGAAGG - Intronic
1078657186 11:13252671-13252693 GTGAGAATGGGAAGGGAGGATGG + Intergenic
1078838059 11:15051155-15051177 TTGAGATAGAGGATGGAAGAGGG + Intronic
1079023005 11:16924526-16924548 TTTAGGAAGGCAAAGGAGGAGGG + Intronic
1079329266 11:19520596-19520618 TAGAGGATGGGAAAGGAGGAAGG - Intronic
1079403015 11:20121409-20121431 AGGAGGAAGGGGAGGGAGGATGG - Intronic
1079431827 11:20397486-20397508 TTGAGGAAGAGGAAAGGGGAGGG - Intronic
1079471838 11:20786052-20786074 TTGAGAAAGGGAGAAGAGGCTGG + Intronic
1079635828 11:22739276-22739298 TTAAGAAAGGGGAAGTTGGCCGG + Intronic
1079717315 11:23764573-23764595 TATAGAAAGGGGAGGGAGCATGG + Intergenic
1080684629 11:34504851-34504873 CTGAGAAAGAGGAGGGAGGGTGG + Intronic
1080767035 11:35306670-35306692 GGGGGAAAGGGGAAGGACGAAGG - Intronic
1080776124 11:35388497-35388519 TGGAGATTGGGGCAGGAGGATGG - Intronic
1080824281 11:35834865-35834887 GTGAGCAGGGGGAAGGTGGAGGG - Intergenic
1081459068 11:43254258-43254280 TAGAGAAAGAGGAGGGAAGAGGG - Intergenic
1081497700 11:43632005-43632027 GTGAGGGAGGGGGAGGAGGAGGG + Intronic
1081540001 11:44027565-44027587 CTGAAAAAGGGGAAAGAAGAAGG - Intergenic
1081623763 11:44634722-44634744 GGGAGGGAGGGGAAGGAGGAGGG - Intergenic
1081659487 11:44879267-44879289 TAGGGAAAGAAGAAGGAGGAAGG - Intronic
1081728972 11:45355264-45355286 CTGAGAAAGGAGAGGGAGGGGGG + Intergenic
1081737011 11:45411324-45411346 GGGAGAATGGGGAAGGGGGAAGG - Intergenic
1081975663 11:47233085-47233107 TTGAGAAAGAGAAAGAAGGGCGG - Intronic
1082054069 11:47798540-47798562 TTGAGAAAGGTTAAGTAGGCCGG + Intronic
1083193488 11:61069004-61069026 AAGAGAAGGGGGAAGGGGGAGGG - Intergenic
1083215377 11:61215496-61215518 TTGAGATGGGGGAGGAAGGAAGG - Intergenic
1083218261 11:61234325-61234347 TTGAGATGGGGGAGGAAGGAAGG - Intergenic
1083330825 11:61897648-61897670 TTATGAAGGGGGAGGGAGGAAGG + Exonic
1083827929 11:65213676-65213698 TAGAGAAAGGGCATGGGGGAGGG + Intergenic
1084372237 11:68751503-68751525 TGGAGAAGGGGGAAGGGTGAGGG + Exonic
1084712308 11:70851473-70851495 AGGAGAAAGGGGCAGGAGAAAGG - Intronic
1084923741 11:72495015-72495037 TGGAGAAAGCTAAAGGAGGAGGG - Intergenic
1084952524 11:72674450-72674472 TGCAGAAGGGGGAGGGAGGAGGG + Exonic
1085101578 11:73805204-73805226 CTGAGAATGGGGAAGGAGCAAGG - Intronic
1085483401 11:76841579-76841601 GTGAGAAAGGGGATGGGGAAAGG - Intergenic
1085565113 11:77506611-77506633 GTGAGAAGGGGAATGGAGGAGGG + Intergenic
1086061219 11:82701785-82701807 GTGACAAAGGGGGTGGAGGATGG - Intergenic
1086074858 11:82839738-82839760 GTGAGAAAGGGCAAAGGGGAAGG - Intronic
1086154047 11:83646401-83646423 AAGAGAAAGGGAAAGAAGGAAGG + Intronic
1086263918 11:84975099-84975121 GTGAGAATGGGTAAGGAGGAGGG + Intronic
1086428456 11:86711647-86711669 TTAAAAAAGTGGAGGGAGGAGGG + Intergenic
1086474548 11:87157798-87157820 TGGAGAGAAGGGAAGGAAGAGGG + Intronic
1086924697 11:92627522-92627544 TAGAGAGAGGGGAAGGGAGAGGG + Intronic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1087201379 11:95347502-95347524 TTGAGAAAGGGAGAGAAGAATGG + Intergenic
1087423435 11:97962474-97962496 TATAGAAAGGGGAAGGAGTAAGG - Intergenic
1087483447 11:98731611-98731633 TTGAGAGATGGGAAGGAGTCAGG + Intergenic
1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG + Exonic
1087693463 11:101348593-101348615 CTGAGAAAGTTGAGGGAGGAAGG + Intergenic
1087774318 11:102243557-102243579 GGGAGAAGGGGGAAGGGGGAAGG + Intergenic
1088377984 11:109162672-109162694 TTGAGAGAGGCTAAGGAGGATGG - Intergenic
1088524302 11:110736293-110736315 GAGAGAAAGGGAAAGAAGGAAGG + Intergenic
1088531917 11:110819651-110819673 TTTGGGTAGGGGAAGGAGGAGGG + Intergenic
1088620558 11:111678065-111678087 TAAAGAACAGGGAAGGAGGAAGG - Intronic
1088744461 11:112794032-112794054 AGGAGAAAGGGGAAGAAGGAAGG + Intergenic
1088836748 11:113584021-113584043 TTGAGAAAGAGGTATGTGGACGG + Intergenic
1089100403 11:115958195-115958217 TAGGGAGAGAGGAAGGAGGAAGG - Intergenic
1089139242 11:116273089-116273111 GGGAGCAAAGGGAAGGAGGAAGG + Intergenic
1089162301 11:116448010-116448032 GGGAGAAAGGGGCAAGAGGAAGG - Intergenic
1089346559 11:117795296-117795318 TTGCGAAAGGGGATGGGGGTTGG + Intronic
1089368191 11:117933935-117933957 TGGATAAAGAGGAAAGAGGAGGG + Intergenic
1089378597 11:118012100-118012122 TAGAGCAAGTGGGAGGAGGAGGG - Intergenic
1089520574 11:119059932-119059954 TGGGGAAAGGGGGAGGGGGAGGG + Intergenic
1089612069 11:119674930-119674952 ATCAGAGAGGGGCAGGAGGAAGG - Intronic
1089759704 11:120714358-120714380 TTAAGAAAGGGAAGGCAGGAAGG - Intronic
1090437050 11:126695744-126695766 CTGAGAGAGGGGAAGGAGGCAGG + Intronic
1090623550 11:128584849-128584871 GGGAGGAAAGGGAAGGAGGAGGG + Intronic
1090648857 11:128789114-128789136 TGAAGCAAAGGGAAGGAGGAAGG + Intronic
1090678432 11:129027506-129027528 TTGGTAAAGGGTCAGGAGGAAGG - Intronic
1090972496 11:131655409-131655431 TTGCCAAAAAGGAAGGAGGAAGG - Intronic
1091079880 11:132656466-132656488 TTAAAAAGGGAGAAGGAGGAAGG - Intronic
1091197903 11:133747449-133747471 GTGAGAAATGGGAGGGAGAAAGG - Intergenic
1091269138 11:134293362-134293384 TTTGGGATGGGGAAGGAGGAGGG + Intronic
1091416841 12:295254-295276 AGGAGAAAGGGGAAGGAAAAAGG + Intronic
1091468101 12:703207-703229 TTGAAAAATGCGTAGGAGGAAGG + Intergenic
1091849277 12:3682191-3682213 CTGAGGGTGGGGAAGGAGGAAGG - Intronic
1091874608 12:3923743-3923765 TTGGACAAAGGGAAGGAGGAGGG - Intergenic
1091985226 12:4905437-4905459 TTGAGAAAGCAAAAGGAGAATGG - Intergenic
1092034005 12:5315006-5315028 TTTAAAAAGGGGAAAGAGGAAGG - Intergenic
1092237417 12:6818936-6818958 TTGAGAGAGGGGAAAGGGGGAGG + Intronic
1092322095 12:7487082-7487104 GAGAGAGAGGGGAAGGTGGATGG + Intronic
1092662193 12:10750495-10750517 TTGAAAATTGGGGAGGAGGAAGG - Intergenic
1092798726 12:12141171-12141193 ATGAGAAAGGGGAAGAGGAAAGG + Intronic
1092828039 12:12415551-12415573 TGGAGAGAGGGGGAGGGGGAGGG + Intronic
1092830714 12:12441871-12441893 TTGAGAAATGTGAAGCTGGATGG + Intronic
1092859911 12:12711429-12711451 ATGAGAAAGGGGAAAGAGAGTGG + Intergenic
1092861801 12:12725133-12725155 TTGAGAAAAGGCAGGGAGCAGGG + Intergenic
1092971916 12:13704299-13704321 ATGAGAAAGGGAAAGGATGGAGG + Intronic
1093608622 12:21126577-21126599 TTTACACAGGGGAAGGAGGTTGG + Intronic
1093734597 12:22606262-22606284 TTGAGAAAAGGAAGGAAGGAAGG - Intergenic
1093991172 12:25591422-25591444 TTTGGAAAGGGGATGGAAGAGGG + Intronic
1094260358 12:28490143-28490165 ATGAGAAAGGGGCAGGAAGATGG - Intronic
1094592354 12:31833532-31833554 TTGAGAAATAGGAAAGAAGAAGG - Intergenic
1095562214 12:43579034-43579056 TGGAGAACTGGGAAGGAGGGAGG - Intergenic
1095664019 12:44773561-44773583 GTTAGAAAGAGGAAGGAAGAAGG - Intronic
1095932885 12:47646831-47646853 TTTAGAAAGATGAAGGTGGAGGG - Intergenic
1096046663 12:48568466-48568488 TGGGGTAAGGAGAAGGAGGATGG + Intronic
1096081731 12:48837820-48837842 TTTGGAAAGGGGAAGGATGGTGG - Intronic
1096199075 12:49668439-49668461 TTGGGAAAGAGGAGGGAGGTAGG - Intronic
1096619021 12:52850886-52850908 TGGGGCCAGGGGAAGGAGGAAGG - Intergenic
1096647174 12:53045302-53045324 TGGAGAAAGGGCAAGGCTGAAGG - Intergenic
1096815598 12:54199986-54200008 AGGAGAAAGGGGAAGAAAGAAGG + Intergenic
1096847719 12:54417347-54417369 TAGAAAAGAGGGAAGGAGGAAGG - Intronic
1097114563 12:56687999-56688021 TTGTGAACGGGGCAGGGGGACGG + Exonic
1097204005 12:57304555-57304577 TGGAGAACTGGGAAGGTGGATGG + Intronic
1097241350 12:57577644-57577666 TAGAGGAAGAGGCAGGAGGAAGG + Intronic
1097540699 12:60938522-60938544 TGGTGAAAGGGAAAGGGGGAAGG - Intergenic
1097933201 12:65213792-65213814 TTTTGAAAGGGGAGTGAGGAAGG + Intronic
1098006933 12:66007518-66007540 GTGGGACAGGGGAAGGAGGGAGG - Intergenic
1098343547 12:69476035-69476057 TTTAAAAAGGGGCACGAGGAAGG - Intronic
1098525253 12:71480065-71480087 TTAAGAATGAGGAAGGAGGCTGG + Intronic
1098917866 12:76275899-76275921 CAGAGAGAGGGGAGGGAGGAAGG + Intergenic
1098952335 12:76653817-76653839 GTGAGACTGAGGAAGGAGGATGG + Intergenic
1098986073 12:77013728-77013750 CTGAGGAAGAGGAAGGAGAAGGG - Intergenic
1099096490 12:78380292-78380314 TTGTGTTTGGGGAAGGAGGAAGG - Intergenic
1099212409 12:79808179-79808201 TTAGGAAAGGGGAAAGAAGAAGG - Intronic
1099231624 12:80032518-80032540 TTGAGGAAGGAGTAGGAAGAGGG + Intergenic
1099301118 12:80895740-80895762 AAAAGAAAGGGGAAAGAGGAAGG - Intronic
1099576675 12:84392039-84392061 ATGAAAAAGGGGAAGGAGAGGGG - Intergenic
1099869624 12:88330476-88330498 AAGAGAAAGGGGATGGAGGAGGG + Intergenic
1100039780 12:90301371-90301393 TTGAGAAAGTGGAGGGTGGGAGG - Intergenic
1100041415 12:90323001-90323023 TTGAGAAAGAGGAAGAGAGAAGG + Intergenic
1100282279 12:93129104-93129126 TTGAAAAATGTGAAGCAGGAAGG + Intergenic
1101043953 12:100785406-100785428 TTGCCAAGGTGGAAGGAGGAAGG - Intronic
1101585739 12:106083984-106084006 GAGAGAAAGAGGAAGGAGGAGGG + Intronic
1102105173 12:110315193-110315215 TTGAAAGAGGGGAAGAAGAATGG + Intronic
1102216511 12:111165272-111165294 CTGAGAAAAGAGAAGTAGGAAGG + Intronic
1102230383 12:111257682-111257704 AGGAGGAAGGGGAAGGAGGAGGG - Intronic
1102295255 12:111731348-111731370 TGGAGAAAGAAGATGGAGGAGGG - Intronic
1102397054 12:112595501-112595523 AGGCAAAAGGGGAAGGAGGAGGG - Intronic
1102426497 12:112848111-112848133 TTGAAGAAGGGGCAGGGGGAGGG + Intronic
1102454654 12:113064023-113064045 GGGAGAAGGGGGAAGGGGGAAGG - Intronic
1102552507 12:113702094-113702116 GAGAGAAAAGGGAAGGAGAAAGG - Intergenic
1102597733 12:114005726-114005748 AAGAGGAAGGGGAAGGAGAAGGG + Intergenic
1102681181 12:114691800-114691822 TAGAGGAAGGGGAATGAGGAAGG + Intergenic
1102984448 12:117266968-117266990 TTGAGACAGGGCAAGAGGGAAGG - Intronic
1103058891 12:117842982-117843004 TTGGGAAGGAGGGAGGAGGAAGG + Intronic
1103231140 12:119331437-119331459 AGGATAAAGGGGAAGGAAGAAGG - Intergenic
1103296939 12:119895720-119895742 TTAATAAAGGTGGAGGAGGAAGG + Intergenic
1103953453 12:124564581-124564603 TTCAGACAGCGGCAGGAGGAGGG + Intronic
1104103092 12:125634157-125634179 TTTGGAAAGGCGAAGGAAGAGGG - Intronic
1104517769 12:129443575-129443597 TAGAGAAAGAGGAAGGGAGAAGG - Intronic
1104548342 12:129732603-129732625 TTGTGGAAGGGGAAGTGGGAGGG - Intronic
1104722721 12:131054287-131054309 TTGGGACAGGGGAGGGAGGTGGG - Intronic
1105046409 12:133007541-133007563 GTGAGAAAGAGGAAGGTGGGAGG + Intronic
1105575812 13:21650574-21650596 CAGAGAAAGAGGAAGAAGGAGGG - Intergenic
1105595870 13:21837401-21837423 GAGAGAAAGGGGCAGGGGGAAGG - Intergenic
1106065140 13:26340595-26340617 TTAAGAAATGTAAAGGAGGAAGG - Intronic
1106203590 13:27566939-27566961 TTGAGATGAGGGGAGGAGGATGG - Intronic
1106506685 13:30376575-30376597 TTGAGGAAGGAAAAGGAAGAGGG + Intergenic
1106519184 13:30482244-30482266 AAGAGAAAGGGAGAGGAGGAGGG - Intronic
1106626957 13:31430571-31430593 GTGGGAAAAGTGAAGGAGGAGGG - Intergenic
1106720752 13:32432376-32432398 GGGGGAAGGGGGAAGGAGGAAGG + Intergenic
1106925083 13:34605437-34605459 TTGAGAAAACAGAAGCAGGAAGG + Intergenic
1107328735 13:39273941-39273963 TTCTGAAAGGGGAAGAATGAAGG + Intergenic
1107842614 13:44474737-44474759 GGGAGGTAGGGGAAGGAGGACGG + Intronic
1107996052 13:45862184-45862206 GAGAGAAAGGGGAAGGAAAAGGG + Intergenic
1108106613 13:47017337-47017359 ATGAGAAACTGGGAGGAGGATGG + Intergenic
1109065725 13:57687313-57687335 TTGAGAAAGAGAGAGGAGAAAGG + Intronic
1109272394 13:60268838-60268860 GTGAGAAAGGGGAAGGGGCCGGG + Intergenic
1109631671 13:65056957-65056979 TTGAGAAATGGGAAAAAGCAAGG + Intergenic
1109792522 13:67268378-67268400 TGGAGAAGGGAGAAAGAGGAAGG + Intergenic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1110805685 13:79751648-79751670 TTGAGAGAGGGAAATAAGGAAGG - Intergenic
1111501709 13:89130209-89130231 TTGAGAGAGGAGACAGAGGATGG + Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1111715236 13:91871350-91871372 TTGAGAGAGGGGTGGGAGGAGGG + Intronic
1112221784 13:97498424-97498446 AATAGAAAGGAGAAGGAGGATGG - Intergenic
1112489371 13:99848168-99848190 CTGAGAAGGGGGTTGGAGGAGGG - Intronic
1112742638 13:102492585-102492607 TTGGGCAGGGGGAGGGAGGAAGG + Intergenic
1113092686 13:106631929-106631951 ATGAGAAGGGGGAAGGAGCCTGG - Intergenic
1113576788 13:111400509-111400531 TAGAGAGAGAGGAGGGAGGAGGG - Intergenic
1113634867 13:111912656-111912678 TTGTGAAGGGGCAAGGAGGCTGG - Intergenic
1113813336 13:113154972-113154994 GAGAGAAAGGGGAGAGAGGAAGG - Intergenic
1115353916 14:32426846-32426868 TGGGGAGAGGGGTAGGAGGAAGG + Intronic
1115788225 14:36850161-36850183 ATGGGAAAGGGGAAGGAGTGAGG + Intronic
1116152979 14:41165788-41165810 TGGAGCAGGGGGAAGAAGGAGGG - Intergenic
1116722041 14:48509383-48509405 TTGAGAAACGGGAGAAAGGAGGG + Intergenic
1116806858 14:49502045-49502067 AATAGAAAGGGGAAGGAAGACGG + Intergenic
1116980171 14:51160747-51160769 TTAAGAAAGAGGAAGTAGGCAGG - Intergenic
1117008024 14:51442294-51442316 AAGAGAAAGAGAAAGGAGGAGGG - Intergenic
1117232851 14:53739438-53739460 TTGAGGAAGGAGAAGGAGCAAGG + Intergenic
1117370883 14:55077470-55077492 GTGATAAAGGGGAAAGAGCATGG - Intergenic
1117402751 14:55372537-55372559 GGGAGAAAGGGAAAGAAGGAAGG - Intronic
1117405005 14:55393483-55393505 CTGAGAAATGGGAAGGAGTCAGG - Intronic
1117623969 14:57616905-57616927 TTGAGAAAGGGGATGGGGCGAGG - Intronic
1117794518 14:59378240-59378262 TTGGGAAGGGGAAAGGTGGAAGG + Intergenic
1118075274 14:62291436-62291458 TTGAGAAATGGTAAAGAGGGTGG + Intergenic
1118261409 14:64250708-64250730 CTGAGTTCGGGGAAGGAGGAGGG - Intronic
1118333332 14:64831227-64831249 TTGAGGAATGGGCAGCAGGAAGG - Intronic
1118380662 14:65214965-65214987 TTGACAGAGAGCAAGGAGGAAGG + Intergenic
1118477806 14:66134719-66134741 TTGAGAAAGAAGAAGGAGTCAGG - Intergenic
1118638582 14:67771121-67771143 TTGAGACAGAGGAGGGTGGAAGG - Intronic
1118663633 14:68042603-68042625 ATGGGAAAGGGGAGGGAGAAAGG - Intronic
1118753964 14:68824777-68824799 TGCAGAAAGGTGAGGGAGGATGG - Intergenic
1118810268 14:69268031-69268053 AAGAGAAAGGGGAAGGATGAGGG - Intronic
1118982228 14:70726186-70726208 TTCACACAAGGGAAGGAGGAGGG + Intronic
1119071103 14:71585136-71585158 ATGAGAAAAGGGAGGGAGGGAGG + Intronic
1119078125 14:71664967-71664989 CCTAGAAATGGGAAGGAGGATGG + Intronic
1119177587 14:72580553-72580575 ATGAGATAGGGCAAGGAGAAAGG + Intergenic
1119310234 14:73640187-73640209 TGGAGAAGGTGGAAGGTGGAAGG - Intergenic
1119529643 14:75350774-75350796 TTGAGATAGGGGAGAGAGAAGGG + Intergenic
1119557790 14:75566912-75566934 CTGAGCAGAGGGAAGGAGGAAGG + Intergenic
1119812448 14:77533725-77533747 TCAAGAAAGGGGAAGTAGGTTGG + Intronic
1120045064 14:79796453-79796475 AAGAGAGAGGGGAGGGAGGAAGG - Intronic
1120621024 14:86764799-86764821 TTGAGAAAGAGGAAAGAAAATGG + Intergenic
1120945822 14:89996177-89996199 TTCAGAAAGGTGAAGGGGCATGG - Intronic
1120982216 14:90300146-90300168 TTAGGAAAGGGGCAGGGGGAGGG + Intronic
1121057629 14:90873036-90873058 TTGAGAAAGGAGAAGGTATAGGG - Intronic
1121379920 14:93455969-93455991 TTGAGATGAGGCAAGGAGGAGGG + Intronic
1121385372 14:93517171-93517193 TGGAGAGAGGGGAGGAAGGAAGG - Intronic
1121550100 14:94792841-94792863 AAGAGAAAGAGGAAGGAGGGAGG + Intergenic
1121652076 14:95566117-95566139 AGAGGAAAGGGGAAGGAGGAAGG + Intergenic
1121760006 14:96436772-96436794 CAGAGAGAAGGGAAGGAGGAGGG - Intronic
1121810797 14:96887832-96887854 TTGGGGCAGGGGAAGGAGTAGGG - Intronic
1121997737 14:98616885-98616907 TGGAGGAAGGGTAAGGAGCAAGG - Intergenic
1122366859 14:101199464-101199486 TTGGGAAAGGGGAGGAAGGGAGG - Intergenic
1122419551 14:101566852-101566874 TTGAGCAAGGAGAGAGAGGAGGG + Intergenic
1122461942 14:101903320-101903342 ATGTGACAGGGCAAGGAGGAAGG + Intronic
1122804749 14:104250647-104250669 GTGAAAAGGGGGAAGGAGGGAGG + Intergenic
1123396224 15:19939793-19939815 AGGAGGAGGGGGAAGGAGGAAGG - Intergenic
1123541634 15:21297899-21297921 TTAGGAAAGCGGAAGGAGGTGGG - Intergenic
1123632139 15:22268840-22268862 GGGAGAAAGGGGAAGTGGGAGGG - Intergenic
1123797412 15:23785920-23785942 TTCAGAAAGGGGAAGGAAGGCGG + Intergenic
1124411900 15:29443704-29443726 CTGAGAAAGAGCAAGCAGGAGGG + Intronic
1124824233 15:33077505-33077527 TGGAGTCAGGGGAAGGGGGAGGG - Intronic
1124939296 15:34203195-34203217 TTGAGAAATTGGAAGGAGGATGG - Intronic
1124975229 15:34523995-34524017 TGCAGACAGGGGAGGGAGGAAGG + Intergenic
1125240707 15:37572230-37572252 TGTAGGAAGGTGAAGGAGGAAGG - Intergenic
1125258279 15:37792127-37792149 TTGAGAAAGGGGGAGATGAAGGG - Intergenic
1125456518 15:39865552-39865574 GTGAGGAGGTGGAAGGAGGATGG + Intronic
1125670062 15:41465141-41465163 AAGGGAAGGGGGAAGGAGGAAGG - Intronic
1126238091 15:46409098-46409120 TGGAGAAAGGGGATGGAAAAAGG - Intergenic
1126411111 15:48374104-48374126 GGGAGAAATGGGGAGGAGGAGGG - Intergenic
1127706327 15:61550566-61550588 ATGAGGGAGGGGAAGGAGCAGGG - Intergenic
1127961130 15:63891799-63891821 TAAAGAAGGGGCAAGGAGGAGGG - Intergenic
1128363454 15:66979561-66979583 ATGAGAAAGGGGAGGGAGGAAGG - Intergenic
1128614959 15:69101779-69101801 TTGAGAAAGTGAAAAGAAGAGGG - Intergenic
1128768573 15:70265723-70265745 TGGAGAATGGAGAAGGAAGATGG + Intergenic
1128783265 15:70376732-70376754 TTCAGAAAGGAAAAGGATGAAGG - Intergenic
1128845826 15:70893274-70893296 ATGAGACAGGTGAAGGAGGTGGG - Intronic
1129071682 15:72956700-72956722 TTGGGAAAGGAGAAGGAAGCAGG - Intergenic
1129158087 15:73731325-73731347 GTGGGGAAGGGGAAGGGGGAGGG - Intergenic
1129218887 15:74119543-74119565 GTGAGGAAGGGTAAGGGGGAGGG - Intronic
1129255065 15:74329796-74329818 TAGAAGATGGGGAAGGAGGAGGG + Intronic
1129915287 15:79264790-79264812 TTGAAAAAAGGAAAGGAGGGGGG + Intergenic
1129949047 15:79570104-79570126 AGGAGAAAGGGAAAAGAGGAAGG + Intergenic
1130109796 15:80954612-80954634 TTGGGGGAGGGGATGGAGGAAGG + Intronic
1130225707 15:82056862-82056884 TGGAGAAAAGGAAGGGAGGAAGG - Intergenic
1130397927 15:83520636-83520658 TTGAGGAAGGGGCTGAAGGAAGG + Intronic
1130424969 15:83787826-83787848 TTGAGAAAGGAGAAAGAGGAGGG - Intronic
1130459973 15:84153618-84153640 GGGAGAAAGGGAGAGGAGGAGGG + Intergenic
1130528263 15:84725402-84725424 TTGTGATAGGGGAAGAATGAAGG - Intergenic
1130843396 15:87722855-87722877 CTGAGACAGGGTGAGGAGGATGG + Intergenic
1130990720 15:88874126-88874148 TTGAGCAAGGGAAGGGAGGTCGG + Intronic
1131386818 15:92014852-92014874 TTGAGGGAGGTGGAGGAGGAGGG + Intronic
1131532207 15:93203323-93203345 TTGACAAAGGGGTAGGAGCAGGG - Intergenic
1131669159 15:94600738-94600760 TGGAGGAGGGGGAAGGAGAAGGG - Intergenic
1132354176 15:101159202-101159224 TTGAGACAGGGGAAGGGGCTGGG - Intergenic
1132550959 16:553672-553694 TTCAGGGAGGGGAAGGAGGGGGG - Exonic
1132857800 16:2054776-2054798 TGGAGAAAGGAGGAGGAAGACGG - Intronic
1133000229 16:2846990-2847012 TTATGTTAGGGGAAGGAGGAGGG - Intergenic
1133392825 16:5423007-5423029 AGGAGAAAGGAGAGGGAGGAAGG + Intergenic
1133392851 16:5423083-5423105 GGGAGGAAGAGGAAGGAGGAGGG + Intergenic
1133634107 16:7649988-7650010 GGGAGAAAGGAAAAGGAGGAGGG + Intronic
1133702767 16:8324657-8324679 TAGAGACAGTGGAAGGAGGTTGG + Intergenic
1133720206 16:8487732-8487754 ATGAGAAATGGGAAGGAGAATGG + Intergenic
1133834940 16:9359506-9359528 GTGAGAAAGGTGAAACAGGAGGG - Intergenic
1133839830 16:9397634-9397656 TAGAGAAACAGGAAGGAAGATGG - Intergenic
1133928957 16:10216653-10216675 TAGAAGAAGGGGAAGGGGGAGGG + Intergenic
1133982041 16:10640126-10640148 GGAAGAAAGGGGGAGGAGGAAGG - Intronic
1134071952 16:11265758-11265780 TTGCGAAAGAGGAATGAGGAAGG + Intronic
1134205562 16:12235004-12235026 GAGAGACAGGGAAAGGAGGAAGG - Intronic
1134330669 16:13248352-13248374 TGGAGAAGGGGGAAGGAGAAGGG - Intergenic
1134556702 16:15171895-15171917 TTGAGAAGTGGCAAGGAGGTTGG - Intergenic
1134661354 16:15986876-15986898 TAGAGAATGTGGAAGGAGGCCGG + Intronic
1134718955 16:16370583-16370605 TGGAGAAAGGGGAGGGAAGGGGG - Intergenic
1134745858 16:16587726-16587748 GAGAGAGAGGGGAAGGAGGATGG + Intergenic
1134770595 16:16806023-16806045 GGGAGAAGGGGGAAGCAGGAAGG - Intergenic
1134917283 16:18083608-18083630 TTGAGAAGTGGCAAGGAGGTTGG - Intergenic
1134999621 16:18766016-18766038 GAGAGAGAGGGGAAGGAGGATGG - Intergenic
1135236689 16:20763433-20763455 TTGAGAAAAAGCAAGGAGGCCGG + Intronic
1135568852 16:23532806-23532828 GAGATAAAGTGGAAGGAGGAAGG - Intronic
1135794842 16:25431966-25431988 TAGAGAAAAGGAAAGAAGGAAGG - Intergenic
1136049775 16:27641960-27641982 TCGAGAAGGGGCAAGGAGGAGGG - Intronic
1136368417 16:29820639-29820661 ATCAGAGTGGGGAAGGAGGATGG + Intronic
1136402442 16:30025885-30025907 GTGACAGAGGGGAAAGAGGAAGG - Intronic
1136698695 16:32111945-32111967 AGGAGGAGGGGGAAGGAGGAAGG - Intergenic
1136768909 16:32815884-32815906 AGGAGGAGGGGGAAGGAGGAAGG + Intergenic
1136799198 16:33055241-33055263 AGGAGGAGGGGGAAGGAGGAAGG - Intergenic
1137237913 16:46630356-46630378 TTGGGGAAGGGGAAGGAGGGGGG - Intergenic
1137378903 16:47979490-47979512 TTGTAAAAGAGGCAGGAGGAGGG - Intergenic
1137498888 16:48995354-48995376 TTAATAAAGAGGAATGAGGAGGG + Intergenic
1137589023 16:49682208-49682230 GAGAAAAAGGGGCAGGAGGAAGG - Intronic
1137615130 16:49841843-49841865 ATGTGAAAGGGAAAGAAGGAGGG + Intronic
1137640257 16:50022814-50022836 CTGACAAATGGGAAGGAGGAAGG + Intergenic
1137689709 16:50414414-50414436 GAGAGAAAGGGGAAGGGGAAGGG - Intergenic
1137774383 16:51043235-51043257 TTGAGACAGGGGAAGGTGGGTGG - Intergenic
1137827305 16:51510164-51510186 CTGACAAAGGAGAAGGAAGATGG - Intergenic
1137919699 16:52474882-52474904 GTGAGAAAGGGGAAGGACGATGG - Intronic
1137956107 16:52831531-52831553 TTGTAAAAATGGAAGGAGGAAGG + Intergenic
1137993413 16:53183407-53183429 GAGAGAAAGGGGAAGGAACAGGG + Intronic
1138143564 16:54588693-54588715 TGGAAAGAGGGAAAGGAGGAGGG - Intergenic
1138326444 16:56175019-56175041 GTGGGAAAGGGGGAGGATGAGGG - Intergenic
1138567168 16:57841901-57841923 TTGAGAAGAGGGGAGGAGGTGGG - Intronic
1138579404 16:57930546-57930568 GAGAGAGAGGGGAAGGAGGAGGG + Intronic
1138926387 16:61596576-61596598 ATGAGAAAGTGGAAGGAAGTAGG - Intergenic
1139023441 16:62781976-62781998 TTGAGAACAGGGAAGAAAGATGG - Intergenic
1139060948 16:63250702-63250724 GAGGGGAAGGGGAAGGAGGAGGG + Intergenic
1139130164 16:64133348-64133370 TTGAGGGAGGGCAAGGAGGATGG + Intergenic
1139330319 16:66183550-66183572 AGGAGAGAGGAGAAGGAGGAAGG + Intergenic
1139424964 16:66873799-66873821 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1139424972 16:66873817-66873839 GAGAGGAAGGGGGAGGAGGAGGG - Intergenic
1140104433 16:71946805-71946827 ATGAGAGAGGGGGAGGAGGAGGG + Intronic
1140309491 16:73835380-73835402 TGGGGAAAGGGGAAAGAAGAGGG - Intergenic
1140314275 16:73879509-73879531 ATGAGAAATGGGAAGGAGGTAGG + Intergenic
1140859253 16:79004993-79005015 ATGAAAAAGGGGAAGGGAGAGGG + Intronic
1140973203 16:80033349-80033371 GAGAAAAAGGGGAAAGAGGAAGG + Intergenic
1141092194 16:81137858-81137880 TGGAGGAAAGGGAAGGAGCAGGG - Intergenic
1141104100 16:81219000-81219022 TTGAGAATGGACAAGGAGGCTGG - Intergenic
1141190897 16:81823939-81823961 AAGGGAAAGGGAAAGGAGGAAGG - Intronic
1141427140 16:83951880-83951902 GAGAGAAGGAGGAAGGAGGAAGG - Intronic
1142218480 16:88841465-88841487 TTGAGGAAAGGGAAGGACGGGGG - Intronic
1142269157 16:89080134-89080156 TGGAGAAAGCAGAGGGAGGAAGG + Intergenic
1142329833 16:89444702-89444724 TTGGAAAACAGGAAGGAGGATGG + Intronic
1142388820 16:89784707-89784729 TTGGGGAAGGGGAAGGGGAAGGG + Intronic
1142421738 16:89974873-89974895 TGAAGAAAGGGAATGGAGGAGGG + Intergenic
1203071326 16_KI270728v1_random:1077995-1078017 AGGAGGAGGGGGAAGGAGGAAGG + Intergenic
1142472057 17:170132-170154 TGGACAGAGGGAAAGGAGGAAGG + Intronic
1142759617 17:2035052-2035074 TTGGGGAAGGGGGTGGAGGAGGG + Intronic
1143005164 17:3827077-3827099 GGGGGAAAGGGGAAGGGGGAAGG + Intronic
1143105142 17:4525980-4526002 TAGAGAAAGATGAAGGAAGAAGG + Intronic
1143292728 17:5843704-5843726 TGGCGAAAGGCAAAGGAGGAGGG + Intronic
1143305123 17:5940488-5940510 TTGTCAAAGGGGAGAGAGGATGG + Intronic
1143447956 17:7019885-7019907 TGGAGAGACGGGGAGGAGGAAGG - Intergenic
1143500456 17:7335759-7335781 TTGAGGAGAGGGGAGGAGGAAGG + Intergenic
1143539746 17:7561963-7561985 TCGCGGGAGGGGAAGGAGGAGGG + Exonic
1143620480 17:8077394-8077416 TAGAGACAGGGGCAAGAGGAAGG - Intronic
1143725628 17:8843318-8843340 ATAAGAAAGAGGAAGAAGGAAGG - Intronic
1143871298 17:9958968-9958990 GTGAACAAGTGGAAGGAGGATGG - Intronic
1143905865 17:10208641-10208663 GCGAGAGAGGGGAAGGAGGTGGG + Intergenic
1144100885 17:11941324-11941346 GGGAGAGAGGGGAAGGAGGGAGG - Intronic
1144247972 17:13386556-13386578 TTTAGGAAGGGGAAAGAGGAGGG - Intergenic
1144291665 17:13832577-13832599 GTAAGAAATGGGAAGGAAGAAGG + Intergenic
1144721153 17:17470726-17470748 TTAAAGAAGGGAAAGGAGGAGGG + Intergenic
1145058197 17:19716663-19716685 ATGAGTAAGGGGCAGGAGGAGGG + Intronic
1145692848 17:26762195-26762217 AGGAGGAGGGGGAAGGAGGAAGG - Intergenic
1145774134 17:27515053-27515075 TTAAGGAAGGAAAAGGAGGATGG + Intronic
1146034281 17:29391501-29391523 TAGAGGATGGGGAAGGGGGAAGG - Intronic
1146167614 17:30601715-30601737 TTTAGAAAAAGGAAGGGGGAGGG - Intergenic
1146220022 17:31009637-31009659 TTTAGAAAAAGGAAGGGGGAGGG - Intergenic
1146380482 17:32323785-32323807 TTGGGAGAGGGGATGGAGGTGGG - Exonic
1146497777 17:33338196-33338218 TTCTGGAAGGGAAAGGAGGATGG + Intronic
1146673679 17:34758586-34758608 AGGAGAAAGAAGAAGGAGGAAGG + Intergenic
1146908599 17:36633490-36633512 TTGGGCAGGGGGATGGAGGAAGG + Intergenic
1146955816 17:36935935-36935957 TTGGGAAGAGGGAAGGAGGAGGG - Intergenic
1147043791 17:37737987-37738009 TTCAGAAAGGAGAAGGAGGCAGG - Intronic
1147242734 17:39101265-39101287 TTGAGAAAGGGAAGGAGGGAGGG + Intronic
1147356033 17:39897485-39897507 TTCAGAAAGCAGAGGGAGGAGGG + Intergenic
1147490941 17:40865488-40865510 TTGAGCATGGAAAAGGAGGAAGG + Intronic
1148018787 17:44540167-44540189 TTGAGAGTGGAGAAGGAGGGGGG - Intergenic
1148154575 17:45415556-45415578 CTAAGATCGGGGAAGGAGGAGGG - Intronic
1148171074 17:45520338-45520360 GTGAGAAAGTGGAAGAAGCATGG + Intergenic
1148255799 17:46130791-46130813 ATGAGGGAGGGGAAAGAGGAGGG - Intronic
1148278605 17:46329467-46329489 GTGAGAAAGGGGAAGAAACATGG - Intronic
1148300815 17:46547329-46547351 GTGAGAAAGGGGAAGAAACATGG - Intronic
1148364948 17:47048214-47048236 GTGAGAAAGTGGAAGAAGCATGG - Intergenic
1148467564 17:47874023-47874045 AAGAGGAAGAGGAAGGAGGAGGG - Intergenic
1148677202 17:49452319-49452341 TTCAGTCAGGGGAAGCAGGAAGG - Intronic
1148767157 17:50046124-50046146 AAGAGAAAGGGGAAGGGGAACGG + Intergenic
1149033900 17:52113703-52113725 TTCAGTAAGAGGAAGTAGGATGG - Intronic
1149170276 17:53801384-53801406 GAGAGAAAGGGGGAGGAGGAAGG + Intergenic
1149184957 17:53986513-53986535 TTGTAAAAGGGAAAGGAGGGAGG - Intergenic
1149206257 17:54252187-54252209 TTAAGGAAGAGGAAGGAAGAAGG + Intergenic
1149455633 17:56785881-56785903 TTGACAAAGGAGATGGAGGTGGG - Intergenic
1149940370 17:60858322-60858344 AAGAGAGAGGGAAAGGAGGAAGG - Intronic
1149952710 17:61007775-61007797 TTGAGAAAGGGTGAGAAGGTAGG - Intronic
1150244581 17:63664814-63664836 GGGAAAAAGAGGAAGGAGGAAGG - Intronic
1150266652 17:63836539-63836561 ATGGGGAAGGGGAAGGAGAAAGG + Intronic
1150352299 17:64455050-64455072 TTGTGAAAGGAAAAGGAAGAAGG + Intronic
1150386467 17:64765519-64765541 CTGAGAATGGGGAGGGAGGAGGG - Intergenic
1150401688 17:64861934-64861956 GTGAGAAAGGGGAAGAAACATGG + Intronic
1150465196 17:65386681-65386703 AAGAGAAAGAGGAAGGAGGATGG - Intergenic
1150535931 17:66040783-66040805 TTAAGAAAGGGAAAAGAGGCTGG - Intronic
1150553302 17:66231050-66231072 TTGAGAGAGGACAAGGAGAAGGG + Intronic
1151287051 17:73119701-73119723 TAGAGAACGGGCAAGGAGGCAGG + Intergenic
1151365645 17:73614565-73614587 TTGAAAAGGGGGAGGGAGGGAGG + Intronic
1151365685 17:73614689-73614711 TTGAAAAGGGGGAGGGAGGGAGG + Intronic
1151365697 17:73614722-73614744 TTGAAAAGGGGGAGGGAGGGAGG + Intronic
1151365710 17:73614755-73614777 TTGAAAAGGGGGAGGGAGGGAGG + Intronic
1151365721 17:73614788-73614810 TTGAAAAGGGGAAAGGAGGGAGG + Intronic
1151412437 17:73940175-73940197 CAGAGAAGGGGGAAGGAGGGAGG + Intergenic
1151624373 17:75267533-75267555 TTGAGCAAGGAGGAGGAGGTGGG - Exonic
1151660379 17:75515484-75515506 TTGGAAAAGGAGAAGGAGAAAGG - Exonic
1151890431 17:76948043-76948065 TTCAGGAAGGGGAAGAAGGAGGG - Exonic
1152042745 17:77915072-77915094 CAGAGAAAAGGGCAGGAGGATGG - Intergenic
1152474600 17:80509843-80509865 ATGAGAAAGGCGGAGCAGGAGGG - Intergenic
1153044332 18:842006-842028 TTGAGAAACAGAAAGGAGGTTGG - Intergenic
1153148677 18:2063845-2063867 TTGAAAAAGGAGAAGGAAAAAGG + Intergenic
1153320418 18:3768500-3768522 TTGAAAAAGGAGAAGGAAGGGGG + Intronic
1153463974 18:5368215-5368237 GTGTGAAAGGAGAGGGAGGAAGG - Intergenic
1153655799 18:7281046-7281068 TAGACAAAGAGGAAGGAGGCAGG + Intergenic
1154477250 18:14774351-14774373 TTTAAAAAGGTGAAAGAGGAGGG - Intronic
1155280619 18:24235925-24235947 TTTATAAAAGGGAAGGAGCAAGG + Intronic
1155394064 18:25367868-25367890 TAGAGAAGGGGGAAAGAGAAAGG + Intergenic
1155402970 18:25458904-25458926 TTATGAAAGGGCAAGGAAGAGGG - Intergenic
1155954344 18:31944251-31944273 TTGATAAATGGGAGGTAGGAAGG + Intronic
1156596864 18:38557505-38557527 TTGACTAATGGCAAGGAGGAGGG + Intergenic
1156841808 18:41617860-41617882 TGGAGGTGGGGGAAGGAGGAGGG - Intergenic
1156996744 18:43478380-43478402 TTGACAATGGATAAGGAGGAAGG - Intergenic
1157329551 18:46693342-46693364 TTGAGAAGGGAGAAAGAGAAGGG - Intronic
1157393519 18:47323036-47323058 TTGAGAGAGGGGAGGGTGGGTGG - Intergenic
1157406434 18:47425770-47425792 ATGAGAGAGGGGAAGCAGGGAGG - Intergenic
1157422677 18:47559567-47559589 AGGAGAAAGGGGAAGGGGAAGGG - Intergenic
1157422684 18:47559580-47559602 AAGAGGAAGGGGAAGGAGAAAGG - Intergenic
1157428088 18:47601356-47601378 AAGAGAAAGGGAAGGGAGGAGGG - Intergenic
1157564214 18:48668749-48668771 TTGGGCGAGGGGCAGGAGGAAGG - Intronic
1157602451 18:48902324-48902346 TGGAGAAAGGGGAAGGAGGGCGG - Intergenic
1157705018 18:49799222-49799244 TGGGGAGAGGGGGAGGAGGAGGG - Intronic
1157990717 18:52492485-52492507 TTGAGACAGGAGAAAGAAGAAGG + Intronic
1158528186 18:58234282-58234304 GGGAGGAAGGGGAAGGAGAAGGG - Intronic
1158746392 18:60204553-60204575 TTGGCAAGAGGGAAGGAGGAGGG - Intergenic
1158951520 18:62499585-62499607 TAGATAAAGAGGAAGGAAGAAGG - Intergenic
1159179957 18:64890059-64890081 TTAAGGAAGGGGAAGGAGGAGGG + Intergenic
1159317014 18:66788525-66788547 TTTTAAAAGGGGAATGAGGAAGG - Intergenic
1159595156 18:70376146-70376168 CTGACAAAGGGAAGGGAGGATGG - Intergenic
1159777957 18:72625357-72625379 TAGAGAGATGGGGAGGAGGAGGG - Intronic
1159983261 18:74811874-74811896 TGGGGTAAGGGGAAGGGGGAGGG + Intronic
1160048837 18:75412857-75412879 ATGAGACTGGGGGAGGAGGAAGG - Intronic
1160122258 18:76141230-76141252 TTGAGATAGGCGAAGGATGGGGG + Intergenic
1160178294 18:76613439-76613461 CTGAGAAAAGGGATGGAGGCAGG + Intergenic
1160392679 18:78546968-78546990 GGGAGGAAGGGGGAGGAGGAGGG + Intergenic
1160819776 19:1052515-1052537 AGGAGAAGGGGGGAGGAGGAGGG + Intronic
1161207136 19:3047099-3047121 GGGGGAGAGGGGAAGGAGGAGGG - Intronic
1161388483 19:4009137-4009159 ATGTGAAAGGGGATGGGGGAGGG - Intronic
1161693837 19:5754063-5754085 TAAAGAAAGGGCAAGGAGGTGGG - Intronic
1161756429 19:6137460-6137482 GTGAGGAGGGGGAGGGAGGAAGG + Intronic
1161756580 19:6138472-6138494 GAGAGAGAGGGGAAGGGGGAAGG + Intronic
1161800575 19:6415101-6415123 AGGAGAAAGGAGGAGGAGGAGGG + Intronic
1161821575 19:6533632-6533654 GAGAGGGAGGGGAAGGAGGAAGG - Intronic
1161918740 19:7250353-7250375 AAGGGAAAGAGGAAGGAGGAGGG + Intronic
1162155922 19:8677898-8677920 TAGATAAATGGAAAGGAGGAAGG - Intergenic
1162426257 19:10598165-10598187 TTGAGAAAGGGAGAAGAGGTAGG - Intergenic
1162690508 19:12426029-12426051 AAGGGAAAGGGGAAGGAGAAGGG + Intronic
1162789012 19:13053590-13053612 TTGGGAATGAGGATGGAGGATGG - Intronic
1163632240 19:18423434-18423456 TTGGCAGAGGGGAGGGAGGACGG + Intronic
1163745348 19:19043437-19043459 TTGAGATGGGGGCAGGAGGAGGG - Intronic
1163836231 19:19575973-19575995 TTGAAATAGGGAAAGGAGCATGG + Intronic
1164323924 19:24176123-24176145 TGGAGAGGGGGGAAGGGGGAGGG - Intergenic
1164406899 19:27957248-27957270 AAGAGAGAGGGGAAGGGGGAAGG + Intergenic
1164544855 19:29151867-29151889 AAGGGAAAGGGAAAGGAGGAAGG + Intergenic
1164757644 19:30702430-30702452 TAGAGAGAGGGGAATGAGGTGGG + Intronic
1164956668 19:32392362-32392384 GGGAGGAAGGGGAGGGAGGAAGG + Intergenic
1164992650 19:32695645-32695667 ATCAAAAAGGGGAAGGAGAAGGG - Intronic
1165317804 19:35067196-35067218 TGGAGAAAGGGGTTGGGGGAGGG - Intergenic
1165637573 19:37355102-37355124 CTGAGAAAGGGGAAGGAAGGAGG - Intronic
1165793564 19:38506188-38506210 TTGAGCCAGGGGAGGGTGGAGGG + Intronic
1165831926 19:38734781-38734803 CTGGGATAGGGGCAGGAGGAGGG - Intronic
1165847404 19:38827084-38827106 GGGAGGGAGGGGAAGGAGGAAGG + Intronic
1165963597 19:39555757-39555779 AGGAGAAAGGGCAAGAAGGAAGG - Intergenic
1166332716 19:42088171-42088193 TTGGGAAGGGGGTAGGAGGGAGG - Intronic
1166881112 19:45930690-45930712 CTGGGAAGGGGGAAGGAGGGAGG - Intergenic
1167241953 19:48349283-48349305 TGGTGAAAAGGGAAGGAGGCAGG - Intronic
1167417881 19:49386710-49386732 GGGAGGAAGGGGAGGGAGGAGGG + Intergenic
1167477515 19:49709468-49709490 TTGGGGATGGGGATGGAGGAGGG - Intronic
1167596468 19:50430919-50430941 GTGGGAAGGGGGAGGGAGGAAGG + Exonic
1167679036 19:50908336-50908358 GTGAGAGAGGGGAAAGGGGAGGG - Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1168433809 19:56302326-56302348 AAGAGGAAAGGGAAGGAGGAAGG - Intronic
1168501904 19:56899949-56899971 TCAAGAGAAGGGAAGGAGGAAGG + Intergenic
1168547231 19:57263522-57263544 TTGATAAAGGGGGTGGGGGAAGG - Intergenic
1202682845 1_KI270712v1_random:25116-25138 AAGAGGAGGGGGAAGGAGGAAGG - Intergenic
925179766 2:1809661-1809683 TTGAGACTGGGGAAGCAGGAGGG - Intronic
925314314 2:2909506-2909528 TCAAGACAGGGGCAGGAGGAGGG + Intergenic
925356739 2:3246959-3246981 GGGAGAGAGGGGAAGGAGGGAGG + Intronic
925641851 2:5993031-5993053 TGTAGAAAGGGGAAGGAGACAGG - Intergenic
925648922 2:6068081-6068103 GAGAGAAAGAGAAAGGAGGAGGG - Intergenic
925712004 2:6750299-6750321 ATAAGAAAAGGGAAGAAGGAAGG + Intergenic
925715876 2:6783903-6783925 GTGAGAAAGAGGAAGCATGAGGG + Intergenic
926036346 2:9638728-9638750 ATGACTAAGGGGAAGGAGGGCGG - Intergenic
926309801 2:11667282-11667304 TTGTGGAAGGGGAAAGAGGCTGG - Intronic
926856065 2:17257195-17257217 AGGAGAGAGGGGAAGGATGAAGG + Intergenic
927438469 2:23090646-23090668 GAGAGAAAGAGGAAAGAGGAGGG + Intergenic
928008389 2:27583442-27583464 TTGAGAATGGGGGAAGACGAAGG + Intronic
928323028 2:30298449-30298471 TAAAGAAAGGGGAAGGAGGATGG + Intronic
928373683 2:30758832-30758854 GGGAGAAAGGGAAAGAAGGAAGG - Intronic
928626089 2:33141578-33141600 CTGAGAAGGGGGATGGAGAATGG + Intronic
928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG + Intronic
929047479 2:37804131-37804153 TGGGGTCAGGGGAAGGAGGAAGG - Intergenic
929330675 2:40676596-40676618 TTCAAAAAGGGGAAGGAGAAGGG + Intergenic
929385702 2:41403699-41403721 GAGAGGAAGGGGAAAGAGGATGG + Intergenic
929507562 2:42540110-42540132 TTGAGTCAGGTGAAGGAGGTGGG + Intronic
929736485 2:44555441-44555463 GTGAGGATGGGGAGGGAGGATGG + Intronic
929961330 2:46498426-46498448 GGGAGAAAGGGGAGGCAGGAGGG - Intronic
929967764 2:46548377-46548399 ATGAGAAAAGGGAAGGAGAAAGG + Intronic
930027862 2:47040332-47040354 CTGGGAAAGGGGAAGGAGCGTGG - Intronic
930084071 2:47480240-47480262 AAGAGGAAAGGGAAGGAGGAAGG - Intronic
930506494 2:52287996-52288018 TTGACAATGGGGATGGTGGAAGG - Intergenic
930640528 2:53850090-53850112 GGGAGAAAGGGAAAGAAGGAGGG + Intergenic
930763109 2:55057664-55057686 TTGAGAAAGCGAAAAGAGGATGG + Intronic
930929328 2:56861653-56861675 GTGAGAAAGGGGGTGGAAGAAGG + Intergenic
931430512 2:62205537-62205559 TTGAGAAAGGGAGAAGAGGCGGG + Intronic
931644680 2:64411279-64411301 TTGAGAAAAGAGAAGAAGGCAGG - Intergenic
931767504 2:65469917-65469939 TTGAGAAAGGGGAGGAAGGAAGG - Intergenic
931832794 2:66070063-66070085 TGGAGACAGGGGAAGGATGCTGG + Intergenic
931926052 2:67073734-67073756 TTGGGCAGGTGGAAGGAGGAAGG - Intergenic
932624526 2:73286771-73286793 AACAGAAAGGGGAAGGAGGAGGG - Intergenic
932688982 2:73896538-73896560 GTGGGAAAGGGGAACCAGGAGGG + Intronic
932714185 2:74089742-74089764 TTGAGAAAGGGGTTGGGGGTGGG + Intronic
932860417 2:75285841-75285863 TTGAAAAAGTGGAAGTGGGAAGG - Intergenic
933040225 2:77455606-77455628 GTGAGAGAGGTGCAGGAGGAGGG - Intronic
933150752 2:78911975-78911997 AGGAGAAAGGGAAAGAAGGAAGG + Intergenic
933231071 2:79808263-79808285 AGGAGAAGGGAGAAGGAGGAAGG + Intronic
933552948 2:83797288-83797310 TAGTGAATGGGGAAGGAGAATGG - Intergenic
933789208 2:85870422-85870444 ATGAAAAAGGAGAACGAGGAGGG - Intronic
934248955 2:90330058-90330080 AAGAGGAGGGGGAAGGAGGAAGG + Intergenic
934260624 2:91473418-91473440 AAGAGGAGGGGGAAGGAGGAAGG - Intergenic
934331824 2:92075314-92075336 ATGAGAGAAGGGAGGGAGGAAGG + Intergenic
934751752 2:96798296-96798318 TTGTGGAATGGGAAGGAGAAGGG + Intronic
934874912 2:97908571-97908593 ATGAGCAAGGGGAAAGAGGAGGG + Intronic
935028623 2:99301435-99301457 GTGAGAAGGGGAAGGGAGGAAGG + Intronic
935029364 2:99307070-99307092 GTGAGAAGGGGAAGGGAGGAAGG - Intronic
935033862 2:99348771-99348793 TTGGGGATGGGGACGGAGGAAGG + Intronic
935207755 2:100911243-100911265 TGAAGAAAGGGGAAGGACCATGG - Intronic
935813587 2:106825226-106825248 CTGAGAAAGAGCAAGGAGGAAGG - Intronic
936068328 2:109348738-109348760 AGGAGGAAGGGGAAGCAGGAGGG - Intronic
937057493 2:118952028-118952050 TAGGGGAAGGGGAAGGAGAAGGG - Intronic
937100940 2:119267859-119267881 CTGAGAACAGGGGAGGAGGAAGG + Intergenic
937207612 2:120246528-120246550 GTTAGGAAGGGGGAGGAGGAAGG - Intronic
937458033 2:122060816-122060838 TTGAGTAAGGGGGTGGGGGAAGG - Intergenic
937705682 2:124918181-124918203 CTGAGAAAAGGGAAGGAGAGGGG - Intergenic
937871987 2:126792575-126792597 TAGAGCAAGGGAAAGGAGGAAGG - Intergenic
937887962 2:126913235-126913257 ATGAAAAAGGAGAAGGATGATGG - Intergenic
937896356 2:126979371-126979393 TTGAGAGTGAGGAAGGAGTAGGG - Intergenic
938130462 2:128710998-128711020 TTGAGAAAGAGGAAGGGGGCAGG + Intergenic
938190741 2:129277904-129277926 AGGAGAAAGGGGATGAAGGAAGG - Intergenic
938206274 2:129426983-129427005 TTGAGAGAGGAAAAGGTGGAGGG - Intergenic
938236406 2:129709945-129709967 TTGAAAAAGGAGAAGGTGAAAGG - Intergenic
938516120 2:132009493-132009515 ATGAGAGAAGGGAGGGAGGAAGG - Intergenic
938836057 2:135105239-135105261 TGGAGAGAGGGGGAGGGGGAAGG - Intronic
938845717 2:135206728-135206750 GAGAGAAAGGGGAAGAGGGAGGG + Intronic
938926833 2:136051072-136051094 TTTAAAAAGGAGAAGGAAGATGG - Intergenic
938999561 2:136718376-136718398 TTGAGATAGGGGCTGGAGGGAGG + Intergenic
939044980 2:137239424-137239446 TTGGGGACAGGGAAGGAGGACGG - Intronic
939931011 2:148232879-148232901 TTGAGAAAAGAGAAGGAGACTGG - Intronic
940261582 2:151785428-151785450 TTGAGAAATGGGAAAGAAGGAGG + Intergenic
940644516 2:156376517-156376539 ATGAGAAAGGGAAAGAGGGAGGG + Intergenic
940987383 2:160062669-160062691 TTGGGGAAGGAGGAGGAGGAGGG + Intergenic
941003683 2:160226132-160226154 TTGAGAAAGGGGAGGTGTGAAGG - Intronic
941290328 2:163666289-163666311 TTGAGGAAGGCGAAGAAGCAAGG - Intronic
941521046 2:166543510-166543532 GAAAGAAAGGGGAAGGGGGAAGG + Intergenic
941943072 2:171064224-171064246 TTATTAAAGGGGAAGGAGAAGGG + Intronic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942210424 2:173664232-173664254 TTGAAGAAGGCGGAGGAGGAGGG - Intergenic
942807809 2:179954154-179954176 TTGAGAACAGGGAATTAGGAAGG + Intronic
943168020 2:184357239-184357261 TTGAGATAGAGCAAGGAGGCTGG + Intergenic
943600901 2:189919855-189919877 TAGAGGAAGAGGATGGAGGAGGG - Intronic
943920334 2:193699156-193699178 CTGAGAAACTGGAAGGAGGTGGG - Intergenic
944217075 2:197267332-197267354 ATTAGAAAGGTGGAGGAGGATGG - Intronic
944827586 2:203501027-203501049 TAGAGAAAGGGGCAGGAGGGAGG + Intronic
944927229 2:204477722-204477744 TTTAGAAAGAGTAGGGAGGAAGG + Intergenic
945273196 2:207962209-207962231 TCCAGGAAGGGGAAGGAGGCTGG + Intronic
945891780 2:215437135-215437157 GTGAGAAAGGGGCCGAAGGAGGG - Intergenic
946229723 2:218283729-218283751 TTCAGAGAGGGGAAGGTGGCAGG + Intronic
946440297 2:219689396-219689418 TTGTGGAAGGAGAGGGAGGACGG - Intergenic
946519067 2:220446583-220446605 GAGGGAAAGGGGAAGGGGGAAGG - Intergenic
946531798 2:220578321-220578343 TTGAGAAAGGGAAAGGAGATGGG + Intergenic
946553085 2:220823842-220823864 AAGAGGAAGGGGAGGGAGGAAGG - Intergenic
946592138 2:221262462-221262484 TTGCATAAGGGGAAGGATGAAGG - Intergenic
946606554 2:221411492-221411514 AAGAGAAAAGGGAAGGAGAAAGG + Intergenic
947051584 2:226050297-226050319 TTGAGAAAAGGAAGGCAGGAGGG + Intergenic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947224134 2:227823930-227823952 TTGGGAAAAGGGACAGAGGATGG + Intergenic
947308515 2:228774576-228774598 TTGAGAAAGAAGAAAGAGCAGGG - Intergenic
947491461 2:230598753-230598775 TAAAGAGAGGGGAGGGAGGAGGG + Intergenic
947491495 2:230599289-230599311 TTGAGAAAGAAGAATGAAGATGG + Intergenic
947511014 2:230754403-230754425 GAGGGAAAGGGGAAGAAGGAGGG - Intronic
947511027 2:230754439-230754461 GAGGGAAAGGGGAAGAAGGAGGG - Intronic
947526197 2:230878162-230878184 CTAAGCAGGGGGAAGGAGGAGGG - Exonic
947833387 2:233158029-233158051 AAGAGAGAGGGGAAGGAGGGAGG + Intronic
948091881 2:235302039-235302061 GAGAGAAGGGGGAAGGAGGGAGG - Intergenic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
948316553 2:237031808-237031830 TGGGGAAAGAGGAAGGAGGGAGG + Intergenic
948533180 2:238626523-238626545 CTGAGAAAGGAGAACAAGGAGGG - Intergenic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
1168904341 20:1391807-1391829 TTGAGAAAGGGGAAGGAGGAGGG + Intronic
1169001922 20:2174169-2174191 TAGAGGAAGGGGAAGCAGGCAGG + Intronic
1169026985 20:2379938-2379960 GTGAGGAAGGGGAAGTGGGAGGG - Intergenic
1169071978 20:2738381-2738403 TAGAGAAAAAGGAGGGAGGAGGG - Intronic
1169115973 20:3066155-3066177 TTGAGCAATGGGAAGGATGAAGG - Intergenic
1169292412 20:4364137-4364159 TTGAGGGATGGGAAGAAGGATGG + Intergenic
1169329079 20:4702559-4702581 TTGAGGAAGGCTGAGGAGGAAGG + Intergenic
1169373868 20:5050385-5050407 TAGAGAAGGGGGAAGGATAACGG - Intergenic
1169404374 20:5311290-5311312 GGGAGAAAGGGTAAGGATGATGG + Intronic
1169655248 20:7915371-7915393 AAGGGAAAGGGGAAGGAGAAGGG + Intronic
1169725485 20:8724464-8724486 TTTATAAAAGGGAGGGAGGAAGG - Intronic
1169792364 20:9425025-9425047 AAGACAAAGGAGAAGGAGGAAGG - Intronic
1169803227 20:9532708-9532730 TGGAGAAAGGGGAGGAAAGATGG + Intergenic
1169875628 20:10294171-10294193 TTTAGAAGGGGGAAGTGGGAGGG - Intronic
1170232116 20:14060587-14060609 TTGAGACCTGGGATGGAGGATGG + Intronic
1170881043 20:20296515-20296537 TTGAGTGAGGGGAGGAAGGAAGG - Intronic
1171307274 20:24117204-24117226 ATGAGAGAGGGGGAGGAGGAAGG + Intergenic
1171420585 20:25014775-25014797 TTCAGAAAGGGGCACTAGGAAGG + Intronic
1171474518 20:25397830-25397852 AAGGGAAAGGGGAAGGGGGAAGG + Intergenic
1171823770 20:29876880-29876902 TAGAGAAAGGGAAAGGGTGAGGG - Intergenic
1172053653 20:32139072-32139094 TTGAGGAAGGGCATGGATGAAGG - Intronic
1172260707 20:33562344-33562366 TGGAGAGAGAGGAAGCAGGAGGG + Exonic
1172302218 20:33858136-33858158 GGGAGGAAAGGGAAGGAGGAAGG + Intergenic
1172874205 20:38154488-38154510 TTGAGCAAGGGGGAGGAGGCAGG - Intronic
1172925049 20:38526353-38526375 AAGAGAAAGAGGCAGGAGGAAGG - Intronic
1173185053 20:40834204-40834226 TTGAGTAAGAGGGAGGTGGACGG + Intergenic
1173285217 20:41664705-41664727 TAGAGAAAGAGGAAGGAGAAAGG + Intergenic
1173294280 20:41742199-41742221 GGAAGGAAGGGGAAGGAGGAAGG - Intergenic
1173350993 20:42245447-42245469 TTGAGAAACGAAAAGGAGAAAGG - Intronic
1173408192 20:42785792-42785814 GAGACAAAGGGGAAGGAGGAAGG - Intronic
1173929152 20:46804077-46804099 GGGAGAAAGGCAAAGGAGGAAGG + Intergenic
1173946065 20:46951933-46951955 TTAAGAGAGAGGAAGGAAGAGGG - Intronic
1173952772 20:47006326-47006348 TTCACAAAGGAGAAGGAGGCAGG + Intronic
1174339852 20:49888896-49888918 CTGGGAGAGGGGAAAGAGGATGG - Exonic
1174412759 20:50346552-50346574 TTGAGCAAGGGTAAGGAGGTGGG - Intergenic
1175096934 20:56548676-56548698 GTAAAGAAGGGGAAGGAGGATGG - Intergenic
1175120149 20:56710796-56710818 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1175120174 20:56710871-56710893 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1175120200 20:56710946-56710968 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1175472296 20:59239142-59239164 TGGAGAAAGGGGAAGAAAAATGG - Intronic
1175616642 20:60405366-60405388 TGGAGAAGGGGGAAGGAGAAGGG + Intergenic
1175654012 20:60753105-60753127 TTTGAAAAGGAGAAGGAGGAAGG - Intergenic
1175657805 20:60787023-60787045 GGGAGAAAGGAGGAGGAGGAGGG - Intergenic
1175846645 20:62063309-62063331 TTCAGAGAGGGGACGCAGGAGGG + Intronic
1175918811 20:62440369-62440391 AGGAGAAAGGTGAGGGAGGAAGG - Intergenic
1176510500 21:7744633-7744655 TCGAGACAGCGGAAGGCGGAAGG + Intergenic
1176876685 21:14136483-14136505 TTTGGAAAGGGGAGGGAAGAGGG + Intronic
1177235008 21:18377395-18377417 CTCAGAAGGGGGAAGGAGTAGGG + Intronic
1177648689 21:23933469-23933491 ATGAGGAAAGGAAAGGAGGATGG - Intergenic
1177758269 21:25373602-25373624 GTGGGAGAGGGGGAGGAGGAGGG - Intergenic
1177833566 21:26167248-26167270 GGGAGTAAGGGGAGGGAGGAGGG + Intronic
1177974276 21:27827680-27827702 TTGAGAAAGGTAAATGAGGCCGG - Intergenic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1178070364 21:28958913-28958935 GAGAGAAAGAGGAAGGAAGAAGG + Intronic
1178277812 21:31254833-31254855 GCAAGAAAGGGGAAGGAGGATGG + Intronic
1178480328 21:32974644-32974666 TTGGGGAAGGGGAAGGCTGAAGG + Intergenic
1178644613 21:34375162-34375184 TCGAGACAGCGGAAGGCGGAAGG + Intergenic
1178836869 21:36105527-36105549 TAGGGAAAGGGGAAGGAGAGGGG + Intergenic
1178886303 21:36487419-36487441 TCAAGAAATGGGAGGGAGGAGGG - Intronic
1179189115 21:39108293-39108315 ATGAGAAACAGGATGGAGGAGGG + Intergenic
1179273920 21:39873621-39873643 TTGAAAAATGGGAAGAAGAATGG - Intronic
1179429104 21:41306899-41306921 ATGTCAAATGGGAAGGAGGAAGG - Intronic
1179659793 21:42866916-42866938 TAGAGAAAGGGGAGGCAGCAAGG + Intronic
1179787810 21:43739880-43739902 TGGGGTAAGGGGTAGGAGGAGGG - Intronic
1179812990 21:43884270-43884292 AGGAGGAGGGGGAAGGAGGAGGG - Intronic
1180872091 22:19151892-19151914 GTGAGAATGGGAAAGGATGAAGG - Intergenic
1181080729 22:20413186-20413208 AAGAGAAAGGGGAAGGGGCAAGG + Intergenic
1181441506 22:22938237-22938259 GGGAGAAAGGGGTAGGTGGATGG + Intergenic
1181774476 22:25149561-25149583 TTGGGGAGGGGCAAGGAGGAAGG - Intronic
1181789220 22:25250507-25250529 AAGAGAAAGGGAAAGAAGGAAGG - Intergenic
1181907317 22:26209698-26209720 AAAAGAAAGAGGAAGGAGGAAGG + Intronic
1182282827 22:29226971-29226993 TAGAGAAAGGGGATGGGGCAGGG - Intronic
1182329647 22:29542047-29542069 CTGAGAGATGAGAAGGAGGAAGG - Intronic
1182351675 22:29703278-29703300 GTGAGGAGGGGGAAGGATGAAGG - Intergenic
1182469148 22:30536691-30536713 TTGAACAAGGAGGAGGAGGAGGG + Intronic
1182809775 22:33105875-33105897 ATGACAAAGGGGAAGGAGCCTGG + Intergenic
1183020808 22:35024458-35024480 TTCAGAGTGGGGCAGGAGGAGGG + Intergenic
1183228007 22:36563482-36563504 TTGAGGAAAGGGAAGGAGAGGGG - Intergenic
1183235475 22:36613840-36613862 TTGGGAAATGGGCTGGAGGAAGG - Intronic
1183247577 22:36705629-36705651 TTGAGAAAAGGGAAAGGGGTGGG + Intergenic
1183491142 22:38116252-38116274 TGGGGAAAGGGAAAGGTGGATGG - Intronic
1183532732 22:38371424-38371446 TTGAGTAGGGGGAGGGGGGAGGG - Intronic
1183564356 22:38602773-38602795 TTAGGAAAGGGGAAGGACGCTGG - Intronic
1183647127 22:39133385-39133407 GGGAGGAAGGGGCAGGAGGAAGG - Exonic
1183858644 22:40653257-40653279 GGGAGAAGGGGGAAGGGGGAAGG + Intergenic
1183891048 22:40929000-40929022 TTGAGAAATTGGAGGGAGGTGGG - Exonic
1184312216 22:43653778-43653800 TGGAGGAAGGGGCAGGGGGAGGG + Intronic
1184437608 22:44488930-44488952 GGGAGAAAGGGGAGGGAGGGAGG + Intergenic
1184475328 22:44717533-44717555 TGGGGAAAGGGTAATGAGGAGGG - Intronic
1184529956 22:45049066-45049088 TTGAGTGAGGGGAATGATGAAGG + Intergenic
1184799521 22:46751281-46751303 TGGAGAAGGAGGGAGGAGGAAGG - Intergenic
1184925105 22:47631103-47631125 TTGAGAGAGGGGAAGGAGCTGGG + Intergenic
1184959365 22:47917906-47917928 GGGAGGAAGGAGAAGGAGGAAGG - Intergenic
1185028534 22:48429472-48429494 GGGAGAAAGAGGAGGGAGGAAGG + Intergenic
1185243955 22:49763410-49763432 TGGGGGAAGAGGAAGGAGGAGGG + Intergenic
949301197 3:2586002-2586024 TTAACAGAGAGGAAGGAGGATGG - Intronic
950001919 3:9663315-9663337 TTGGGAAAGAGGAGGAAGGAAGG + Intronic
950085551 3:10254991-10255013 GTGGGAAGTGGGAAGGAGGAAGG - Intronic
950766604 3:15277720-15277742 TTTAGAAAGGGGAGTGGGGAAGG - Intronic
950789995 3:15463977-15463999 TTGAAATAGGGAGAGGAGGAAGG - Intronic
950958640 3:17081248-17081270 GTGAGGGAGGAGAAGGAGGAGGG - Intronic
951046877 3:18049861-18049883 TTGAGAAACTGAAAGGAGGCGGG - Intronic
952238822 3:31508758-31508780 TTGAGAAAGAGGAAGTGGGTAGG + Intergenic
952424011 3:33156546-33156568 TTGAGAGAGGGGAAGGTCAAAGG - Intronic
952496367 3:33919383-33919405 TGGAGGAATGGGATGGAGGAGGG + Intergenic
952569211 3:34694402-34694424 AAGGGAAAGGGGAAGAAGGAAGG - Intergenic
952580868 3:34831954-34831976 ATGAGTAAGGGGCAGGAGAAGGG + Intergenic
952655422 3:35779872-35779894 TCCAGAAAGGGAAAGGAGGAGGG - Intronic
952704010 3:36358573-36358595 ATAAGAAGGGGGTAGGAGGAGGG - Intergenic
952749943 3:36816960-36816982 GTGGGAAAGGGGAAGGGGAAGGG - Intergenic
952920023 3:38277661-38277683 ATGAGAAAGGTGAAGGAGGCCGG - Exonic
953022866 3:39127081-39127103 TTGAGAAGGGAGAAGGTGAAAGG - Intronic
953309464 3:41863181-41863203 TTTGGAAAGGGGAAGGAGGAAGG - Intronic
954808551 3:53234167-53234189 CTCAGAAAGGGAGAGGAGGAAGG - Intronic
954858571 3:53667894-53667916 TTCATAAAGAGGAAGGAGGAAGG + Intronic
954881654 3:53840054-53840076 TTCAGGAAGGGAAGGGAGGATGG + Intronic
955072441 3:55583446-55583468 GGGAGAGAGGGGAAGGAGGGAGG - Intronic
955298238 3:57753600-57753622 TTGGGAAGGGGGAAGGAAAAAGG - Intergenic
955475336 3:59330384-59330406 AGGAGAAAGGAGAAGGAGAAAGG + Intergenic
955856777 3:63280591-63280613 TTGGGATAGAGGAAAGAGGAAGG - Intronic
955867925 3:63405132-63405154 TTGAGAAAGGGGAAGGACAGAGG - Intronic
955896440 3:63705697-63705719 GTGAGCAAAGGCAAGGAGGAAGG + Intergenic
956214207 3:66831826-66831848 GGCAGAAGGGGGAAGGAGGAGGG - Intergenic
956313954 3:67913816-67913838 AGGGGAAAAGGGAAGGAGGAGGG - Intergenic
956369339 3:68541254-68541276 TTGAGAAGGAGGGAGGAGGGAGG - Intronic
956413488 3:69003096-69003118 GAGAGAGAGGGGGAGGAGGACGG - Intronic
956478869 3:69652874-69652896 GTGAGAAAGGGGATAGAGAAGGG - Intergenic
956734617 3:72228613-72228635 TAGAGAACAGGGAAGAAGGAAGG + Intergenic
956765470 3:72480933-72480955 TTGAGGGAGGGGAAGGAATATGG + Intergenic
956768556 3:72505293-72505315 AGGACAAAGGAGAAGGAGGAAGG + Intergenic
957415237 3:79893329-79893351 TTAAGAAGGAGGAAAGAGGAAGG + Intergenic
957564280 3:81865073-81865095 GTGAGGAAGGGGAAGGGGGAGGG - Intergenic
957640746 3:82850210-82850232 AAGGGAAAGGGGAAGGAGAAGGG - Intergenic
957810597 3:85215939-85215961 TAGAGAATGAGGGAGGAGGAGGG + Intronic
957866829 3:86036418-86036440 TTTAGCAAGGGGGAGTAGGAAGG - Intronic
957884988 3:86275396-86275418 TGGAGACAAGGGAAAGAGGAGGG - Intergenic
957892096 3:86373197-86373219 TTAAGAGAGAGGAAAGAGGAGGG + Intergenic
958058708 3:88449060-88449082 GGGAGAGAAGGGAAGGAGGAAGG - Intergenic
958147605 3:89646664-89646686 TTGGGGCAGGGGATGGAGGATGG - Intergenic
958682301 3:97346579-97346601 ATTAGTAAGGGAAAGGAGGAAGG + Intronic
959112628 3:102140250-102140272 TAGAGAGAGGGGAGGAAGGAAGG - Intronic
960074539 3:113469819-113469841 TAGAGAAAGAGAGAGGAGGATGG - Intronic
960235863 3:115281296-115281318 TTGGAACAGGGAAAGGAGGATGG - Intergenic
960322572 3:116254435-116254457 AAGAGAAAGGGAAAGGAAGAAGG + Intronic
960571286 3:119187711-119187733 TTGGGAAAGGGGGTGGAGGGTGG - Intronic
960616929 3:119604603-119604625 CTGAGAAGGGGGAAGGAGTTGGG + Intronic
960822886 3:121752969-121752991 TGGGGAAAGGGGAAAGAAGAGGG + Intergenic
961067168 3:123885004-123885026 TTAAAAAAGGGGAAAGGGGAGGG + Intergenic
961231858 3:125320167-125320189 TTGAGAAAACAGAGGGAGGAAGG - Intronic
961384662 3:126516702-126516724 GGGAGAAAGGGGAAGCAGGTTGG - Intronic
961425939 3:126847846-126847868 GTAAGAGAGGGGAAGGAGGACGG - Intronic
961516286 3:127439416-127439438 TTAAGCAAGGAGGAGGAGGAGGG + Intergenic
961635778 3:128331447-128331469 CTGAGGAAGGGGAGGGAAGAGGG - Intronic
961635794 3:128331507-128331529 TTGAGGAAGGAGAGGGAAGAGGG - Intronic
961703085 3:128762259-128762281 ATGAAAAAGGCTAAGGAGGAGGG + Intronic
962186164 3:133261928-133261950 TTGAGACAGGTGAGGGAGAAAGG - Intronic
962394030 3:134999173-134999195 TTGAGAAAGTGGAAGCAGTTAGG + Intronic
962462760 3:135629914-135629936 CAGAGAACGGGGAGGGAGGAAGG - Intergenic
962480450 3:135793699-135793721 GTGAGAACAGGGAAGGAAGAAGG - Intergenic
962491294 3:135896551-135896573 TGGAGAAACTGGAGGGAGGAGGG + Intergenic
962795304 3:138844808-138844830 TTGAAAAAGGAGAGGGAGGCTGG + Intergenic
962966545 3:140359466-140359488 TTAAGAAAGGAGAAGGAAAAAGG + Intronic
963534704 3:146513157-146513179 GTGAGGAAGGGGGAGAAGGAGGG - Intergenic
963863623 3:150336219-150336241 TAGAGAAAGGGGAAGGAGAGTGG - Intergenic
963873661 3:150448063-150448085 AGGAGAAAGGGGTATGAGGAGGG - Intronic
963962055 3:151320655-151320677 TTGATTAAAGGGAAGGGGGATGG + Intronic
964036482 3:152205461-152205483 ATTAAAATGGGGAAGGAGGAGGG - Intergenic
964193139 3:154029656-154029678 TTGAGAAAGGGAAAGGGAGGAGG - Intergenic
964316361 3:155448732-155448754 TAGAAAAAGGGGTAGGAGAATGG - Intronic
964388285 3:156172592-156172614 TTTAAAAAAGGGAATGAGGATGG + Intronic
964466574 3:156999422-156999444 TTGAGAAAGAGAAAGGAAAACGG - Intronic
964475154 3:157091333-157091355 ATAGGAAAGGGGAAGCAGGAGGG + Intergenic
964612877 3:158632439-158632461 TTGAGTGAGGGGCAGGGGGAGGG + Intergenic
964920748 3:161892567-161892589 GTGGAAAAGGGGAAGGAGAAAGG + Intergenic
965496587 3:169405874-169405896 TTGAACAAGGGTAAGGAGAAGGG + Intronic
965679254 3:171233606-171233628 TGGAGAAAGGTGAAGGATGATGG + Intronic
965689846 3:171344003-171344025 TTGAGCAATGGGAAGGAGGGAGG - Intronic
966014082 3:175119487-175119509 TTGAGAAAGACAAAGGAGGTGGG + Intronic
966521913 3:180882416-180882438 AGGAGAAGGAGGAAGGAGGAAGG - Intronic
966739985 3:183223615-183223637 AAGAGAAAGAGGAAAGAGGACGG + Intronic
966886888 3:184381816-184381838 GTGAGAAAGGGGAAGGAGCAAGG + Intronic
966889649 3:184397794-184397816 CTGGAAAAGGGGAAGAAGGAAGG + Intronic
967112310 3:186304631-186304653 TGGGGAAAGGGGATGGAAGAGGG + Intronic
967335998 3:188345420-188345442 TTCAGAAAAGGGCAGGAGGCGGG - Intronic
967336695 3:188352088-188352110 TTAAGTCAGGAGAAGGAGGAAGG - Intronic
967350764 3:188511304-188511326 GGGAGAGAGGGGAGGGAGGAAGG - Intronic
967507200 3:190266016-190266038 ATAGAAAAGGGGAAGGAGGAGGG + Intergenic
967598252 3:191353399-191353421 TTGAGAAATGGGAGGGTGAAAGG + Intronic
967899495 3:194434994-194435016 TTCTCAATGGGGAAGGAGGAGGG + Intronic
968041419 3:195592257-195592279 GAGAGAAAGGAGAAGGAGGGAGG + Intergenic
968862815 4:3185955-3185977 GGGAGGAAGGGGAGGGAGGAAGG + Intronic
969199308 4:5589971-5589993 TAGAGAAAAGAGAAGGTGGAGGG + Intronic
969228970 4:5816626-5816648 GGGAGAGAGGGGAAGGAGGGAGG - Intronic
969228980 4:5816652-5816674 GGGAGAGAGGGGAAGGAGGGAGG - Intronic
969278332 4:6152086-6152108 AAGAGACAGGGGAAGGAAGAAGG + Intronic
969307979 4:6336499-6336521 TTCAGGAAGGGGCAGGAGGAGGG + Intronic
969316344 4:6383458-6383480 TTGGGAAAGGGCAAGGAGCCTGG - Intronic
969475149 4:7418118-7418140 CAGAAAAAAGGGAAGGAGGAAGG - Intronic
969551274 4:7869224-7869246 AGGAGGAAGGGGAAGGAGGAAGG + Intronic
969922849 4:10557257-10557279 TAGAGAAGGGTGAAGGTGGAGGG - Intronic
970512231 4:16792801-16792823 TTTAACAAGAGGAAGGAGGAAGG + Intronic
970760141 4:19475832-19475854 TTGAAAAACAGCAAGGAGGACGG + Intergenic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971032827 4:22659513-22659535 TTGAGAATAGGGAAAGGGGAAGG + Intergenic
971055924 4:22912396-22912418 GAGAGAAAGGGGAAGGAGGAAGG - Intergenic
971063582 4:23001236-23001258 GAAAGAAAGGGAAAGGAGGAAGG + Intergenic
971172003 4:24242929-24242951 TGGAAAAAGGGGATGGAGAAAGG - Intergenic
971307546 4:25496794-25496816 ATGAGAAAGGGGAAGGGTGGGGG - Intergenic
971466535 4:26969253-26969275 TTGTGGAAGGGGATGGAGGCGGG + Intronic
971849097 4:31960259-31960281 GAGAGAAAGAGAAAGGAGGAAGG - Intergenic
972185881 4:36527778-36527800 ATGAGAAAGAGGAAGGAGTTAGG - Intergenic
972265933 4:37459763-37459785 TTAAGATAGGTGAAGGAGGGTGG + Intronic
972271017 4:37510934-37510956 TTGTGAAAGGGGAGGGAAGAAGG - Intronic
972445984 4:39144387-39144409 ATAAGAAAGGGGGAGGAGGGTGG - Intergenic
972784754 4:42315800-42315822 TAGGGAAAGGGGAAGGAGAGGGG + Intergenic
972807150 4:42540776-42540798 GTGAGACAGAGGGAGGAGGATGG + Intronic
972960321 4:44446861-44446883 TTGGGACAGGGGAGGGTGGAAGG - Intronic
973001747 4:44960903-44960925 TGGGGAAAGGGGAAGGAAAAGGG - Intergenic
973570509 4:52234191-52234213 TTGGGAGAAGGGAAGGAGAAAGG - Intergenic
973602899 4:52559636-52559658 TTGAGGAAGGGGAAGGGAGGTGG + Intergenic
974187753 4:58463473-58463495 ATCAAAAAGGGGAAGGAGAAGGG + Intergenic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
974707546 4:65541046-65541068 ATGAGAAAGGGGAAGGAGGGAGG - Intronic
974838438 4:67276920-67276942 ATCAGAAAGGGGAAGGAGAGGGG - Intergenic
975231483 4:71939392-71939414 TAGAGAAAGAGGAAGGAGAGAGG - Intergenic
975270381 4:72425475-72425497 TGGGGTAAGGGGAAGGGGGAGGG - Intronic
975391471 4:73822897-73822919 GGGAGAAAGGGGAGGGAGGGAGG + Intergenic
975495904 4:75035631-75035653 GAGATAAAAGGGAAGGAGGAGGG - Intronic
975643853 4:76527076-76527098 TTCAGACAGGAGAAGGAGAAAGG - Intronic
976344841 4:83988999-83989021 TTGAGGATGGGGCAGAAGGAGGG + Intergenic
976440353 4:85066317-85066339 GAGAGAGAGGGGAAGAAGGAAGG - Intergenic
977294075 4:95192397-95192419 GTGAGAAGGGGGGAGGAGGTGGG - Intronic
977534570 4:98242022-98242044 TTGAGAAGGGGGAAAGGGAAAGG + Intergenic
977541747 4:98326380-98326402 TTGAGAATGGGGAAGAAAAAAGG - Intronic
977919220 4:102625191-102625213 GGGAGAAAGAGGAAGGAGGGAGG - Intergenic
978018228 4:103775173-103775195 TTGATCAAGAGGCAGGAGGATGG - Intergenic
978492848 4:109327311-109327333 TTGAAATGGGGGAAGGGGGAAGG - Intergenic
978752011 4:112260288-112260310 CTGAGAAAAGGGAAGGATGAAGG + Intronic
978913683 4:114097074-114097096 CTCAGAATGGGGAAGGTGGAAGG - Intergenic
978987678 4:115034317-115034339 TACAGCAAGTGGAAGGAGGAAGG - Intronic
979121935 4:116914227-116914249 TTGAGAAAGGGGAATAAGAAAGG - Intergenic
979521669 4:121674341-121674363 AGGAGAAAGGGGAAAGAGAAAGG + Intronic
980155316 4:129097311-129097333 TGCAGATATGGGAAGGAGGAAGG - Intronic
980208699 4:129756406-129756428 TAGTGGCAGGGGAAGGAGGAGGG - Intergenic
980265863 4:130514884-130514906 ATTAGAAAGGGGAAAGAGGCCGG + Intergenic
980841256 4:138264316-138264338 TTAAGAAAAGGAAAGAAGGAAGG + Intergenic
980931802 4:139189184-139189206 GTGAGAAGTGGGAAAGAGGAAGG + Intergenic
981086541 4:140689655-140689677 AGGAGAAAGGGGAGGGGGGAAGG - Intronic
981360786 4:143843349-143843371 TAGAGGAAGGGAAAGGAAGAGGG + Intergenic
981360794 4:143843381-143843403 TAGAGGAAGGGAAAGGAAGAGGG + Intergenic
981468702 4:145103676-145103698 CTGAAAAAGGGGAAGCAGGATGG - Intronic
981835089 4:149044569-149044591 TTGAGGAAGGGGTATGTGGATGG + Intergenic
981972300 4:150678635-150678657 TTATGAAAGGGGAACAAGGAGGG + Intronic
981990060 4:150907338-150907360 GGGAGGAAGGGGAAGGGGGAGGG + Intronic
982123370 4:152162901-152162923 AGGAGAAAGGGGAAAGGGGAGGG + Intergenic
982173637 4:152684721-152684743 TTGGGTTAGGGGGAGGAGGAAGG - Intergenic
982373206 4:154657147-154657169 TTAAGAAAAGGGGATGAGGAAGG - Intronic
983297714 4:165887259-165887281 ATGAGAAAGTGGGAGGAGGGAGG + Intronic
983580649 4:169306400-169306422 TTGGAAGAGGGGAAGGAGGGAGG + Intergenic
983640759 4:169942127-169942149 TTGAAAAAGCAGAAGCAGGAAGG + Intergenic
983646396 4:169996034-169996056 GAGAGAGAGGGGATGGAGGAAGG - Intronic
984206438 4:176792720-176792742 TCGGGGAAGGGGAGGGAGGAGGG - Exonic
984479815 4:180285708-180285730 TTGATAAAGGAGAGGGAGAAGGG - Intergenic
984703553 4:182833357-182833379 AGGGGAGAGGGGAAGGAGGAGGG - Intergenic
984703982 4:182834573-182834595 AGGGGAAAGGAGAAGGAGGAGGG - Intergenic
984863112 4:184257299-184257321 TTGAGAAAAAGGAGGAAGGAAGG + Intergenic
984922311 4:184776453-184776475 TTCAGAGAAGGGAAGGAGGCAGG + Intronic
985258375 4:188091848-188091870 TTGAGACATGGGCAGCAGGATGG - Exonic
985314425 4:188640480-188640502 TGGAGAAAGGGCAAGAGGGAGGG - Intergenic
985851626 5:2392626-2392648 AAGAGAAAGAGGAAGGAGGGAGG - Intergenic
985855241 5:2419215-2419237 TGGGGAAAGGGGAGGGAGAAGGG + Intergenic
986060865 5:4188800-4188822 ATGAGAAAGTGGAAGTAGCAAGG + Intergenic
986129375 5:4912731-4912753 GAGAGAAAGGAGAAGGAAGAAGG + Intergenic
986183625 5:5416971-5416993 GAGGGAGAGGGGAAGGAGGACGG + Intergenic
986426473 5:7636543-7636565 TTGAGAAACTGCAAGGAGGTAGG + Intronic
986752579 5:10802181-10802203 GTGAGAGATGGGAGGGAGGAGGG - Intergenic
986773801 5:10995972-10995994 GAGAGAAAGGGAAGGGAGGAAGG + Intronic
987264077 5:16234140-16234162 TTATGAAAGGGAAAGGAGGTTGG + Intergenic
987335042 5:16891380-16891402 GAGAGAGAGAGGAAGGAGGAAGG + Intronic
987389187 5:17360215-17360237 TTTACAAAGGGTAAGGAAGAAGG - Intergenic
987517054 5:18924123-18924145 AGAAGAAAGGGAAAGGAGGAAGG + Intergenic
988798384 5:34673759-34673781 TTGAGAGAGGGGACAGAGGCAGG - Intronic
988803769 5:34721100-34721122 TTAAGAGAGGAGAAGGAAGAAGG - Intronic
989142325 5:38213879-38213901 TAGAGAAAAGAGAATGAGGAGGG + Intergenic
989262948 5:39438867-39438889 TTGATAAAGGAGAAGGTAGAAGG + Intronic
989647950 5:43656395-43656417 TCAATAAAGGGGAAGGATGAGGG - Intronic
989766569 5:45091975-45091997 TTGAGATAAGGGTGGGAGGAGGG + Intergenic
990010743 5:50994646-50994668 TGGTGAAAGTGGAAGGAGAAGGG - Intergenic
990125027 5:52505040-52505062 ATGAGGAAGGGAAAGAAGGAAGG + Intergenic
990140277 5:52695249-52695271 CTGAGAAAGGAGATGAAGGAAGG - Intergenic
990530341 5:56667148-56667170 TTGAGAAATAGGACGGAAGAAGG - Intergenic
991217607 5:64173615-64173637 AGGGGAAAGGGAAAGGAGGAGGG - Intronic
991445723 5:66698312-66698334 TTGAGACAAGGAGAGGAGGAGGG - Intronic
991501518 5:67281992-67282014 GGGGGAAGGGGGAAGGAGGAAGG - Intergenic
991501520 5:67281999-67282021 CGGAGAAGGGGGAAGGGGGAAGG - Intergenic
991508111 5:67346037-67346059 TATACAAAGGGGAAAGAGGAAGG + Intergenic
991631222 5:68657995-68658017 CTGGGAAAGGGGGAGCAGGAAGG + Intergenic
992160570 5:73996811-73996833 GTGAGAGAGGGAAAGGAGAATGG - Intergenic
992349680 5:75916292-75916314 ACGAGAAAGGGGAAGGGGAAGGG - Intergenic
992455606 5:76912749-76912771 ATCAAAAAGGGGAAGGAGAAGGG + Intronic
992605165 5:78448084-78448106 TGGAGTAGGGGGAAGGGGGAGGG - Intronic
992912667 5:81412601-81412623 ATGAGAATGGAGGAGGAGGAGGG - Intergenic
993176575 5:84494383-84494405 GGAAGAAAGGGGAGGGAGGAAGG - Intergenic
993243367 5:85419979-85420001 TTGCAAAAGGGCAAGTAGGATGG - Intergenic
993430194 5:87823362-87823384 GAGAGAAAGAGGAAGGAGAAAGG + Intergenic
994514682 5:100755946-100755968 TTCAGAAATGGAAAGGAAGAAGG + Intergenic
994709039 5:103243653-103243675 TTGAGAGAAGGAAAGGAGGAGGG - Intergenic
995142842 5:108752216-108752238 GTAAAAAAAGGGAAGGAGGAAGG - Intronic
995402340 5:111757275-111757297 TGGAGGAAGAGGAGGGAGGAGGG + Intronic
995701116 5:114937075-114937097 CTGAGAAAAGGGAAGAAGGCAGG + Intergenic
996022238 5:118604088-118604110 ATAAGGAAGGGGAAGGAGAAGGG - Intergenic
996300165 5:121972356-121972378 TTGAAAGAGAGAAAGGAGGACGG + Intronic
996308623 5:122078184-122078206 CTGAGAAAGGGGAAAGGGAAGGG - Exonic
996550222 5:124722658-124722680 TTGAGAAAGGGCAGGGAGGTGGG + Intronic
996845881 5:127898566-127898588 GTGAGAAGGAGGGAGGAGGAAGG + Intergenic
997025794 5:130059438-130059460 TTGGGAGAGGGGGAGGGGGAAGG - Intronic
997380235 5:133430682-133430704 TTGAGGAAGGGAAAGAGGGAGGG - Intronic
997506539 5:134422019-134422041 AAGAGAAAGGAGAAGAAGGAAGG - Intergenic
997506599 5:134422729-134422751 TTGAGAAAGCAGCAAGAGGAAGG + Intergenic
997806324 5:136921801-136921823 GGGAGAGAGGGAAAGGAGGAAGG + Intergenic
997893427 5:137695066-137695088 TTGGAAGAGGGGAAGGGGGAAGG - Intronic
998422627 5:142001464-142001486 CTGTGAAAGTGGAAGAAGGAAGG + Exonic
998503406 5:142652985-142653007 ACGAGACAGAGGAAGGAGGATGG - Intronic
998611516 5:143694313-143694335 TTTAAAAAGGAGGAGGAGGAGGG - Intergenic
999072479 5:148760613-148760635 TTGAGAGAAGGAAAGAAGGAAGG - Intergenic
999072795 5:148765349-148765371 ATGAGAAAGGAGAGGGAAGAGGG - Intergenic
999177248 5:149640099-149640121 TTGGGAAATGGGAAGTGGGATGG + Intergenic
999233630 5:150077719-150077741 TTGGGAGAGAGGGAGGAGGAGGG - Intronic
999269597 5:150289036-150289058 CTGAGAAAGGGGAGGTAGGGAGG + Intronic
999444402 5:151627917-151627939 TGGAGAAGGTGGAAGGAGGCTGG + Intergenic
999558879 5:152776833-152776855 TGGAGTGAGGGGATGGAGGAGGG + Intergenic
999590491 5:153139784-153139806 GTGAGATGGGGAAAGGAGGAGGG - Intergenic
999721514 5:154402228-154402250 GGGAGAAAGGGGAAGAGGGATGG - Intronic
999966896 5:156819833-156819855 TTGAGGATGGGCATGGAGGAAGG + Intergenic
1000477537 5:161729846-161729868 ATGAGAAATGGCAAAGAGGAGGG + Intergenic
1000848042 5:166305623-166305645 CTGAGAAAGGGTGGGGAGGATGG - Intergenic
1000902064 5:166923221-166923243 TTGAAAACGGGGAAGCAGGCCGG + Intergenic
1001147388 5:169196747-169196769 TTAAGAAAGGGAAAGGGAGAGGG - Intronic
1001193642 5:169652714-169652736 TTGGACCAGGGGAAGGAGGAAGG + Intronic
1001193884 5:169654322-169654344 TTGAGGCAGGGAAAGCAGGAAGG + Intronic
1001224537 5:169932409-169932431 GAGAGAATGGGGAAGGAAGATGG + Intronic
1001238686 5:170051323-170051345 GTGAGAAAGGGAAGGAAGGATGG - Intronic
1001421511 5:171590848-171590870 GTTAGAAAGGGGAACAAGGAGGG + Intergenic
1001867264 5:175116499-175116521 AGGAGAAAGGGAGAGGAGGAAGG - Intergenic
1002062434 5:176633711-176633733 TAAAGAAAGATGAAGGAGGATGG + Intronic
1002302004 5:178262601-178262623 TAGGGAAAGGGGTAGTAGGATGG + Intronic
1002552965 5:180010730-180010752 TAGGGAAGGGGGAAGGAGGGAGG + Intronic
1002795100 6:465644-465666 AGGAGAAAGGAGAAAGAGGATGG - Intergenic
1002883302 6:1271896-1271918 TTCAAAATGAGGAAGGAGGAGGG - Intergenic
1002929845 6:1625459-1625481 TGGGGAAAGCGGGAGGAGGAAGG - Intronic
1002969138 6:1996155-1996177 ATGAGAAAGAGGAAGGAGGAAGG - Intronic
1003199262 6:3943847-3943869 CTGAGAAAGGGAAGGGATGATGG + Intergenic
1003335584 6:5168899-5168921 GTGATAAAGGAGAGGGAGGAGGG + Intronic
1003337159 6:5185045-5185067 AAGACAAAGGGCAAGGAGGAAGG - Intronic
1003381918 6:5632570-5632592 GGGGGAAGGGGGAAGGAGGAAGG - Intronic
1003381945 6:5632649-5632671 GTAAGAAAGGGGAGGAAGGAAGG - Intronic
1003432584 6:6053435-6053457 ATGGGAAAGGGAAAGGAGAATGG + Intergenic
1003514134 6:6804310-6804332 TAGGGCAAGGGGCAGGAGGAGGG + Intergenic
1003667638 6:8126628-8126650 TCCAAAAAGGGGAAGGGGGAGGG + Intergenic
1003700058 6:8453845-8453867 TTGGCAAAGGGGAATGGGGAGGG - Intergenic
1003904459 6:10686399-10686421 AAGGGAATGGGGAAGGAGGAGGG + Intronic
1004002053 6:11604828-11604850 AGGAGGAGGGGGAAGGAGGAGGG + Intergenic
1004184546 6:13410806-13410828 AGGAGAAAGAGGAAGAAGGAGGG + Intronic
1004226535 6:13789818-13789840 TGGAGAAGAGGGAGGGAGGAGGG + Exonic
1004487106 6:16077007-16077029 TTGAGAAAGGGGATGGAGTTGGG + Intergenic
1004571915 6:16854394-16854416 TTGAGTTAGGAGAATGAGGAAGG + Intergenic
1004751301 6:18565463-18565485 ATGAAAAAAGGGAGGGAGGATGG - Intergenic
1004907245 6:20247668-20247690 TTAAGAAAGGGGAAGGGGAGGGG + Intergenic
1005492971 6:26363719-26363741 TTGGGGAGGGGGAAGGGGGAGGG + Intergenic
1005816800 6:29559640-29559662 TTGATAAAGGGGATGGGGAAAGG - Intronic
1006224066 6:32521660-32521682 TTGTGGGAGGGGAAGCAGGAGGG - Intronic
1006259513 6:32855963-32855985 TAGAGAAAGTGGAAAGATGAAGG + Intronic
1006285358 6:33089087-33089109 TGGTGAAAGTGGAAGGAGGTGGG + Intergenic
1006359470 6:33579408-33579430 TGGAGACTGGGGAAGAAGGAAGG - Intronic
1006449197 6:34096261-34096283 TAGACAAAGAGGAAGGAGAAAGG - Intronic
1006567806 6:34974309-34974331 AAGAGAAAGGGGAAGGGGAAGGG - Intronic
1006606672 6:35262361-35262383 TTGAGAAAATGGCAGTAGGAAGG - Intronic
1006735147 6:36268073-36268095 TGGAGAATGAGGAAGGAGGATGG - Intronic
1007139239 6:39554827-39554849 TGGAGAAAGATGGAGGAGGAGGG - Intronic
1007160825 6:39790724-39790746 TTGAGAAAGGCAAGGGAGAATGG + Intergenic
1007380786 6:41488832-41488854 GGGAGAAAGTGGGAGGAGGAGGG + Intergenic
1007566723 6:42857227-42857249 TTGAGAAAAGGTAAGCAGGCTGG + Exonic
1007897111 6:45374079-45374101 ATGAGAAAGCGGGATGAGGATGG + Intronic
1008353321 6:50519380-50519402 TTAAGAATGGGAAAGGAGGCTGG - Intergenic
1008375828 6:50790331-50790353 GTGTGAGAGGGGAAGGAGGTGGG - Intergenic
1008473750 6:51913541-51913563 TACAGAAAGAGGAAGGAGTAGGG - Intronic
1008760642 6:54847952-54847974 ATGAGAAAGGGAAAGAAGGGAGG - Intronic
1008863239 6:56176916-56176938 GGGAGGAAGGGGGAGGAGGAAGG + Intronic
1009334354 6:62467502-62467524 GTAAGAAAGAAGAAGGAGGAAGG + Intergenic
1009438843 6:63651704-63651726 TTGGGGAAGGGGAAGGAGCAGGG - Intronic
1010899481 6:81408501-81408523 TAGACAAAGGGAAAGAAGGAGGG + Intergenic
1011242978 6:85291892-85291914 TTGGGTAGGGGGAAGGAGGTGGG - Intergenic
1011771285 6:90676225-90676247 TTGGGGAGGGAGAAGGAGGATGG + Intergenic
1011970207 6:93212806-93212828 TTGAGAAAAGGGCAGGAGGTAGG + Intergenic
1012095589 6:94954615-94954637 GTCAGAAGGGGGAGGGAGGAGGG + Intergenic
1012430001 6:99154158-99154180 TTTACAAAGGGGAAGAAGGAAGG - Intergenic
1012570678 6:100724096-100724118 TTGAGAACAGGGAAGAAGCAAGG + Intronic
1012632048 6:101482724-101482746 TTGAGGTAGTGGAAGTAGGAAGG + Intronic
1012924308 6:105252170-105252192 TTGAGTTAGGGGAAGGGGTAGGG + Intergenic
1012931991 6:105327109-105327131 TGGATAAAGGGCAATGAGGAGGG - Intronic
1013101062 6:106987142-106987164 TTGAGGGAGGAGGAGGAGGAGGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013590850 6:111618669-111618691 ACGAGAAAGGGGAAGGAGAGAGG - Intergenic
1013723737 6:113065419-113065441 TGGAGAAAGGGGGAAAAGGAAGG + Intergenic
1013999886 6:116352912-116352934 AAGAGAGAGAGGAAGGAGGAGGG - Intronic
1014080449 6:117280952-117280974 TTGAGGGAGGGGAAGGAAAAGGG + Intergenic
1014211067 6:118708771-118708793 TAGGGAAAAGGGAGGGAGGAAGG - Intronic
1014307897 6:119765394-119765416 TTGGATAAGGGGAAGGAGGGTGG + Intergenic
1014358232 6:120438557-120438579 TGGGGTGAGGGGAAGGAGGAGGG + Intergenic
1014715558 6:124861048-124861070 CTGAGAAGGGACAAGGAGGAAGG - Intergenic
1015178830 6:130339718-130339740 TTTAGAAAGGAGAAAGAGCATGG - Intronic
1015211191 6:130701140-130701162 CTGAAAGAGGGGAGGGAGGAAGG + Intergenic
1015264325 6:131275594-131275616 TCAGGAAAGGGGAAGCAGGAGGG + Intronic
1015375686 6:132507738-132507760 TTGATAGAGGGAAAGGAGAAAGG - Intronic
1015935345 6:138402831-138402853 AAGAGAAATGGGAAGGAGGGTGG - Intergenic
1016204368 6:141453973-141453995 TTGAGAAAGGGGTCGGGGCATGG - Intergenic
1016598511 6:145828614-145828636 CAGAGAACGGGGAAGGAAGAGGG + Intergenic
1017054833 6:150427406-150427428 CTGAGGGAGGGGAATGAGGAAGG + Intergenic
1017056678 6:150443096-150443118 TAGATGAAGGGGAAGGAGTACGG - Intergenic
1017163913 6:151390767-151390789 TTGGGGGAGGGGAGGGAGGAGGG - Intronic
1017339599 6:153305315-153305337 AAGAGGAAGGGGAAGGAGAAGGG - Intergenic
1017339633 6:153305435-153305457 TAGGGGAAGGGGAAGGAGAAGGG - Intergenic
1018005219 6:159615801-159615823 ATAAGAATGAGGAAGGAGGATGG + Intergenic
1018038077 6:159898658-159898680 AGGAGGAAGAGGAAGGAGGAGGG - Intergenic
1018165225 6:161087576-161087598 TTGGGAAAGGGAAAGTGGGAAGG - Intronic
1018380495 6:163254309-163254331 CTGATGAAGGGGGAGGAGGATGG + Intronic
1018403748 6:163454650-163454672 TTGAGAAAAAGGAAGGGGTAAGG - Intronic
1018415924 6:163601941-163601963 GGGAAAGAGGGGAAGGAGGAGGG + Intergenic
1018617013 6:165696103-165696125 TTGGGGAGGGGGAAGGAAGATGG + Intronic
1019182424 6:170198971-170198993 CTGAGAATGGGGATGGAGGCAGG + Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019315557 7:382899-382921 ATGAGAAGTGGGAAGAAGGAAGG + Intergenic
1019332316 7:466533-466555 TGGAGGAGGGTGAAGGAGGAGGG - Intergenic
1019388151 7:770332-770354 TTGAGAAAGAGGAAGCGGGGAGG + Intronic
1019397533 7:830093-830115 CTGTTAAGGGGGAAGGAGGAAGG + Intronic
1019410721 7:905447-905469 GGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410725 7:905467-905489 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410756 7:905613-905635 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410759 7:905626-905648 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410762 7:905639-905661 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410767 7:905666-905688 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410775 7:905714-905736 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410779 7:905727-905749 AGGAGAAAGGGAAAGGAGAAGGG + Intronic
1019410816 7:905901-905923 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410831 7:905974-905996 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410837 7:906008-906030 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410841 7:906028-906050 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410849 7:906070-906092 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410864 7:906143-906165 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410869 7:906170-906192 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410876 7:906211-906233 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410891 7:906284-906306 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410897 7:906318-906340 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410901 7:906338-906360 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410910 7:906393-906415 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410915 7:906414-906436 GGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410921 7:906448-906470 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410927 7:906482-906504 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410934 7:906517-906539 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410942 7:906552-906574 GGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410945 7:906565-906587 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410954 7:906607-906629 GGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019410959 7:906634-906656 AGGAGAAAGGGAAAGGAGAAAGG + Intronic
1019551879 7:1607086-1607108 GAGAGAAAGAGGAAAGAGGAGGG - Intergenic
1019964050 7:4484543-4484565 GAGAGAAGGGGGAAAGAGGAGGG + Intergenic
1021294134 7:18882867-18882889 TGAAGAAAATGGAAGGAGGATGG + Intronic
1021308633 7:19063484-19063506 TTGAGGAGGTGGAAGGAGGTGGG - Intronic
1021322159 7:19225800-19225822 TTGAGTTAGAGGTAGGAGGAAGG - Intergenic
1021469438 7:20984864-20984886 TCAAGAAAGGGGAAAGAGGCCGG + Intergenic
1021717121 7:23470396-23470418 AAGAGAAAGGAGGAGGAGGAGGG + Exonic
1021869193 7:24986839-24986861 TGGAGAAAGGGAAAGGAAGAAGG - Intergenic
1022103380 7:27182350-27182372 TGGGGACAGGGGCAGGAGGAAGG - Exonic
1022243610 7:28535663-28535685 AAGAGAAAGGGCAAGAAGGAAGG + Intronic
1022270976 7:28807810-28807832 TTGAGAATGAAGAAGGAGGAAGG + Intronic
1022357049 7:29625780-29625802 GAGGGAAAGGGGAAGGAGAAGGG + Intergenic
1022528059 7:31051151-31051173 TCAAGAAGGGGGAAGGAGGAGGG - Intergenic
1022591213 7:31665070-31665092 TAGTGAGAGAGGAAGGAGGAAGG - Intergenic
1022591585 7:31668988-31669010 TTGAGGAAGGAGAAGGAAGTAGG + Intergenic
1023003721 7:35840138-35840160 GGGGGAAGGGGGAAGGAGGAAGG - Intronic
1023013649 7:35944515-35944537 AGGACAAAGAGGAAGGAGGAGGG - Intergenic
1023045727 7:36208608-36208630 TTGAGAAACAGGAAGGCAGATGG + Intronic
1023077468 7:36498366-36498388 TTGAGCCAGGGGATGGGGGATGG + Intergenic
1023110461 7:36806044-36806066 TTGAGAAAGGGAAATGAGTTGGG - Intergenic
1023156373 7:37256505-37256527 TGGAGGGAGGAGAAGGAGGAAGG + Intronic
1023533513 7:41183436-41183458 AGGAGAAGGGGAAAGGAGGAAGG - Intergenic
1023666150 7:42525348-42525370 GGGAGAAAGGGGAAGAGGGAGGG + Intergenic
1024077481 7:45829319-45829341 AGGACAAAGAGGAAGGAGGAGGG + Intergenic
1024229910 7:47355870-47355892 ATGAGGGAGGGGAAGGAAGATGG + Intronic
1024471092 7:49769470-49769492 TTGAAGAAAGGGAAGAAGGAAGG - Intergenic
1024742533 7:52370630-52370652 GTGAGAAAAGGGAAGGGTGAAGG + Intergenic
1025126929 7:56352088-56352110 AGGACAAAGAGGAAGGAGGAGGG - Intergenic
1025565844 7:62433127-62433149 TAGAGACAAGGAAAGGAGGAAGG + Intergenic
1026102477 7:67394522-67394544 TTGAGAAAGGTCAAACAGGAGGG + Intergenic
1026158951 7:67852217-67852239 AAGAGAAAGGAGAAAGAGGAGGG + Intergenic
1026159064 7:67852834-67852856 GAGAGAAAGGAGGAGGAGGAGGG + Intergenic
1026277761 7:68895075-68895097 TGGAGAAAGGGGAAGAAGAAAGG - Intergenic
1026509170 7:71013754-71013776 AAGAGAAAAGGGAAGAAGGAAGG + Intergenic
1026567533 7:71501791-71501813 GTGAGAAAGAGGGAGAAGGAAGG - Intronic
1026606905 7:71824274-71824296 TTGAGGAAGGGGAAACAGGCAGG - Intronic
1026814355 7:73498510-73498532 TTGTGAAAGAGGATGAAGGAAGG - Exonic
1027645317 7:80790324-80790346 AGGAGAAAGGAGGAGGAGGAAGG + Intronic
1028456487 7:91043650-91043672 ATGACGAAGGGGAAGGAGGCAGG - Intronic
1028505502 7:91566068-91566090 TGAGGAAAGTGGAAGGAGGAAGG - Intergenic
1028611522 7:92717362-92717384 AAGGGAAAGGGGAAGGAGAAGGG + Intronic
1029412834 7:100426826-100426848 GGGAGGAAAGGGAAGGAGGAGGG - Intronic
1029676647 7:102074433-102074455 TTCAGGAAGGGGAAGCAGGTGGG - Intronic
1030099336 7:105931347-105931369 GAGAGGAAGGGGAAAGAGGAGGG - Intronic
1030099459 7:105932780-105932802 TTCAGAAAGGGGAAGGAACGTGG + Intronic
1030103482 7:105967095-105967117 TGGGGTGAGGGGAAGGAGGAGGG - Intronic
1030105360 7:105982542-105982564 GGGAGAAGGGGAAAGGAGGAGGG - Intronic
1030174344 7:106636010-106636032 TTAAGAGAGGGAAAAGAGGAAGG + Intergenic
1030629055 7:111875073-111875095 TCAAGAGATGGGAAGGAGGAAGG - Intronic
1030902399 7:115140615-115140637 TCGTGGAAGGGGAAGGAGAACGG - Intergenic
1031003328 7:116443164-116443186 CTGAGAGAGGTGAAGGAGGGAGG + Intronic
1031043612 7:116863149-116863171 TTGAGGAGGGGGAAGTAGAAGGG - Intronic
1031329467 7:120446747-120446769 TTGTTATAGGGGAAGGCGGATGG + Intronic
1031482044 7:122289796-122289818 GTGAGAAAGAGGGAGGAGCAAGG + Intergenic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1032400169 7:131619270-131619292 CTGAGGGAGGTGAAGGAGGATGG - Intergenic
1032463456 7:132128520-132128542 ATGAGCAAGGGGAAAGAGAAGGG + Exonic
1032720450 7:134547082-134547104 TAGACAAAGAGGAAGGGGGAGGG + Intergenic
1033045969 7:137962450-137962472 TCAGGGAAGGGGAAGGAGGATGG - Intronic
1033129697 7:138735281-138735303 TGGGGACAGGGGAAGGAGCAAGG - Intronic
1033184184 7:139210862-139210884 TGGTGGAAGGTGAAGGAGGAAGG + Intergenic
1033354377 7:140587589-140587611 GGGAGAAAGGGGAGGGAGAATGG - Intronic
1033361221 7:140640440-140640462 GAGGGAAAGGGGACGGAGGAGGG - Intronic
1033983968 7:147200063-147200085 GTGAGAAAGGAGGAGGGGGAGGG - Intronic
1034978901 7:155463399-155463421 AGGAAAAAGGAGAAGGAGGAGGG - Exonic
1034993266 7:155561282-155561304 AAGAGAAAGGGGAATGGGGATGG + Intergenic
1035025071 7:155819908-155819930 TTGGGTAAGGGGAGGGAGGAGGG + Intergenic
1035143323 7:156786226-156786248 AAGAGAAGGAGGAAGGAGGAAGG + Intronic
1035415773 7:158684340-158684362 TTAAGAAAAGGAAAGGAGGGAGG + Intronic
1035848519 8:2890781-2890803 TTGAGGAAGAGCAAGGAGGCAGG + Intergenic
1036504249 8:9340940-9340962 TTGGGGAAGGGGAGGGAGAAAGG + Intergenic
1036978763 8:13445030-13445052 TTGAGAGAAGGGAAGGAGAGAGG + Intronic
1037195103 8:16179334-16179356 TGGAGGAAGAGGATGGAGGAAGG - Intronic
1037659790 8:20916665-20916687 TTAAGAGAGAGGAAGGAGTAAGG + Intergenic
1037689435 8:21170186-21170208 GAGGGAAAAGGGAAGGAGGATGG - Intergenic
1038041122 8:23725280-23725302 CTGAGAATAGGGAAGGAGGTGGG - Intergenic
1038374540 8:27025703-27025725 TTTAGCAAGCGGAGGGAGGAGGG - Intergenic
1038395824 8:27244730-27244752 ATCAGAAAGTGGAAAGAGGAGGG + Intronic
1038507047 8:28093234-28093256 GTGCGAAAGGGGAAGGAGATGGG + Intronic
1038721196 8:30037078-30037100 TGGAGTCAGGGGAGGGAGGATGG - Intergenic
1038722238 8:30047310-30047332 TGGAGAAAGGGAGAGGAGGCGGG - Intergenic
1038773748 8:30509259-30509281 CTGAGAGAGGGAAGGGAGGAGGG - Intronic
1039023122 8:33229101-33229123 TGGAGGAAGGGGATGCAGGAAGG - Intergenic
1039314491 8:36356490-36356512 GAGACAAAAGGGAAGGAGGAAGG + Intergenic
1039381047 8:37085913-37085935 TTTAGAGAGGGCAGGGAGGAAGG - Intergenic
1039828356 8:41193743-41193765 GTGACATATGGGAAGGAGGAAGG + Intergenic
1039846675 8:41330378-41330400 GGGAGAAAGGGAAAGGAAGAGGG + Intergenic
1039908785 8:41807915-41807937 AAAAGAAGGGGGAAGGAGGAGGG + Intronic
1039926856 8:41941925-41941947 TTGAGACATGGGCAAGAGGAAGG + Intronic
1040546442 8:48401626-48401648 CTGCAAAAGGGGTAGGAGGAAGG + Intergenic
1040588247 8:48764627-48764649 TGGGGAAAGGGAAAGGAGAAAGG - Intergenic
1040674331 8:49730876-49730898 ATGAGAAAGGCAAAGGAGAAAGG - Intergenic
1041000901 8:53451791-53451813 TTGAAAAATGGGAAGGAAAAAGG + Intergenic
1041312873 8:56534212-56534234 TGGAGAGAGGGGGAGGATGAGGG + Intergenic
1041321243 8:56615138-56615160 AAGAGGAAGGGGAAGGAGGGAGG - Intergenic
1041368103 8:57130661-57130683 CTGAGGGAGGGGAAGGAGCAGGG - Intergenic
1041607538 8:59800531-59800553 TTTAGAAAGTTGAAGGGGGAGGG - Intergenic
1041775221 8:61515458-61515480 TTTAGAAGACGGAAGGAGGAAGG - Intronic
1041785660 8:61630313-61630335 TTGAAAAATGGCAAGGAGGTAGG + Intronic
1041860804 8:62510613-62510635 AGGAGGAAGAGGAAGGAGGAAGG + Intronic
1041971035 8:63742872-63742894 TTGAGAAAGGAGAACGTGCAAGG - Intergenic
1042020549 8:64369305-64369327 GGGAGAAAGGGGAGGGGGGAGGG + Intergenic
1042871712 8:73405656-73405678 TTGGGGAAGGGGAAGCTGGAAGG - Intergenic
1043178205 8:77048142-77048164 GGGAGAAAGGGGAGGGGGGAGGG + Intergenic
1043516170 8:80996792-80996814 TTGAGTGAGGGGAAGGTGGAGGG + Intronic
1044091471 8:88007735-88007757 GTCAGAATGGGGAAGTAGGAAGG - Intergenic
1044734037 8:95259347-95259369 GTGAGAAAGTGGAGGCAGGAAGG + Intronic
1044742539 8:95342593-95342615 TTGAGAACAGTGAATGAGGAGGG + Intergenic
1046089242 8:109479324-109479346 TGAAGAAAGGGGTAGAAGGATGG - Intronic
1046561414 8:115842647-115842669 TAGAGAAAGGGAGAGAAGGAAGG + Intergenic
1046885681 8:119364408-119364430 CTGAGAAAGGGGAAAGGGGGAGG - Intergenic
1047006048 8:120621451-120621473 GTGAGAAATGGGAAAGTGGAGGG + Intronic
1047190001 8:122669691-122669713 TTGGGGAAGGGGCAGGATGAGGG - Intergenic
1047557174 8:125944931-125944953 ATGAGAAAGGGGAAAGTGTAGGG + Intergenic
1047701392 8:127452696-127452718 AGGAGAAAGGGGAAGGGAGAGGG + Intergenic
1047895459 8:129361618-129361640 GAGAGAAAGAGAAAGGAGGAAGG - Intergenic
1047907008 8:129483149-129483171 GGGGGAAGGGGGAAGGAGGAAGG + Intergenic
1047907034 8:129483206-129483228 GGGAGAAGGGGGAAGGGGGAAGG + Intergenic
1048256530 8:132909115-132909137 TTGAGAAAGTGACAGGATGATGG + Intronic
1048383109 8:133885753-133885775 GAGAGAAAGAGAAAGGAGGAGGG + Intergenic
1048507134 8:135031748-135031770 TCCAGAAAGGAGAAGGAAGAAGG - Intergenic
1048557629 8:135496138-135496160 ATGAGAAAGCAGAAGTAGGAAGG + Intronic
1048712832 8:137231442-137231464 TTCAGAAAGGGGAAGTAGCAGGG - Intergenic
1048731686 8:137448991-137449013 TTGATAAAGAGGATGGAGGAAGG + Intergenic
1048803432 8:138216486-138216508 TGGAGAAAGGGAAAGGATGCAGG + Intronic
1048951530 8:139500876-139500898 TTGTGAATGGAGGAGGAGGAAGG + Intergenic
1049214829 8:141402735-141402757 ATGAGAAAGCGGAAGCAGGGGGG - Intronic
1049370263 8:142261028-142261050 GAGAGAAAGAGGAGGGAGGAAGG + Intronic
1049602386 8:143513970-143513992 TTCAGAAAGGGGCTGGTGGAGGG - Intronic
1050008263 9:1157778-1157800 GTGAGAACTGGGAAGTAGGAAGG + Intergenic
1050008876 9:1164322-1164344 ATGAAAAAAGGGAGGGAGGAAGG - Intergenic
1050181649 9:2929180-2929202 TTGAAAAAAGAGAAGAAGGAAGG + Intergenic
1050203486 9:3173894-3173916 TCGTGGAAGGAGAAGGAGGAGGG + Intergenic
1050297650 9:4222116-4222138 TGGAGAAGAGGGAGGGAGGAAGG - Intronic
1050923022 9:11229770-11229792 TTGAGAAAGGTTAATTAGGAAGG + Intergenic
1051074227 9:13210953-13210975 TTGAGAGAAGAGAAGGAAGAAGG - Intronic
1051893455 9:21965851-21965873 TTGAGGAAGGGTAAGGAGGAAGG + Intronic
1052006071 9:23350339-23350361 TTGAGACAGGAGTAGGATGAAGG - Intergenic
1052197591 9:25736400-25736422 TTGAGAAAGGGAGAGAAGGAAGG + Intergenic
1052323424 9:27192669-27192691 GGGAGGAAGGGGAAAGAGGAAGG + Intronic
1052417919 9:28201811-28201833 TTTAAATAGGGGGAGGAGGAAGG - Intronic
1052869946 9:33494973-33494995 TTTAGAAAGGTAAAGGAGGCTGG + Intergenic
1053154227 9:35763961-35763983 TTGAGAAAGGAGAGAGAGGAGGG + Intergenic
1053163205 9:35827936-35827958 GTGAGGAAGGGGAAAGAGAAGGG + Intronic
1054254384 9:62799630-62799652 TAGAGAAAGGGAAAGGGTGAGGG + Intergenic
1054406486 9:64767392-64767414 GTGAGCAAGGGAGAGGAGGAGGG - Intergenic
1054704973 9:68452848-68452870 TTGAGAAAGGAGATGTTGGAAGG - Intronic
1055002506 9:71468303-71468325 CTGGGAGAGGGGAAGCAGGATGG - Intergenic
1055256798 9:74381328-74381350 TTGATCTGGGGGAAGGAGGAAGG + Intergenic
1055443908 9:76363878-76363900 TTGAAAAAGAGGATGGAGGCAGG + Intergenic
1055477598 9:76678380-76678402 AGGAGAAAGGGAAAGGAGGGAGG + Intronic
1055569188 9:77599360-77599382 TTGAATAGGGGGAAGGAGAATGG + Intronic
1055581479 9:77711145-77711167 GAGGGGAAGGGGAAGGAGGAGGG - Intergenic
1055665655 9:78550286-78550308 TTAGGAAAAGGGAAAGAGGAAGG - Intergenic
1055725751 9:79226394-79226416 TTTTAAAAGGAGAAGGAGGAAGG - Intergenic
1055782527 9:79834737-79834759 GTGAGAGAGGGGAGGGAGGGAGG + Intergenic
1055791340 9:79926227-79926249 AGGAGAAAGGGGAAGGGAGAAGG + Intergenic
1056318518 9:85414920-85414942 TTGAGAGAGAGGAAGGAGAAGGG + Intergenic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056407978 9:86294177-86294199 TTGTGAAAGGGGAATTAGAAAGG - Intronic
1056550187 9:87646362-87646384 TTGAGACAGGGGAAGGTGTGTGG + Intronic
1057007445 9:91573122-91573144 GTGAGACAGGAGAAGGAGGAAGG + Intronic
1057012413 9:91616890-91616912 CTCAGAAAGGGGAAGGAAGTTGG + Intronic
1057079868 9:92165361-92165383 TAGAGAAAGGGGAAGGAGATAGG + Intergenic
1057142939 9:92738508-92738530 TTGAGAGTGGGGAGGGAGGGGGG - Intronic
1057175375 9:92993606-92993628 TGGGGTAAGGGGAGGGAGGAGGG - Intronic
1057182576 9:93037993-93038015 GGGAGAAAGGGGAGGGAGGATGG - Intergenic
1057345445 9:94246753-94246775 TTGACACTGTGGAAGGAGGAGGG - Intergenic
1057545773 9:96019853-96019875 GTGAGAGAGAGGAAGGGGGACGG + Intergenic
1057904636 9:98974494-98974516 CTGACAAAGGGCAAGGAGGAGGG + Intronic
1057972051 9:99567830-99567852 TTTAAAAAGGGGAAGAAGGCTGG + Intergenic
1058164848 9:101607550-101607572 GTGAGCAGGGAGAAGGAGGAGGG + Intronic
1058346530 9:103970190-103970212 GTGAGAGAGGGGAAGGTGGGGGG - Intergenic
1058522742 9:105828367-105828389 TTGAGGAAAGGGGAGGGGGAAGG - Intergenic
1058561434 9:106233138-106233160 AGGAGAAAGGAGGAGGAGGAAGG - Intergenic
1058561440 9:106233161-106233183 AGGAGAAAGGAGAAGGAAGAAGG - Intergenic
1058719085 9:107747341-107747363 ATGAGAAAGGAGGATGAGGAGGG + Intergenic
1058736712 9:107900481-107900503 GAAAGAAAGGGGAAGAAGGAGGG - Intergenic
1058766765 9:108189468-108189490 AGGAGAAGGGGGTAGGAGGAAGG + Intergenic
1058802327 9:108556774-108556796 TTGAGAAAGGAGAATGACTAGGG + Intergenic
1058876998 9:109252925-109252947 TTTGGAAAGGGGAAGGGGGCAGG + Intronic
1058897590 9:109413576-109413598 TGAAGAAAGGGGCAGGATGAGGG + Intronic
1059599357 9:115759624-115759646 TTGAGAAACAGGACGGATGATGG + Intergenic
1059765247 9:117377994-117378016 GTGAGAAAGGGGATGCAGAATGG + Intronic
1059903042 9:118950239-118950261 GAGAGAAATGGAAAGGAGGAAGG + Intergenic
1059929361 9:119245664-119245686 TTTAGGAAGAGGAAAGAGGAAGG - Intronic
1060024540 9:120160183-120160205 ATGAGAAAGGGAAAGTTGGAGGG + Intergenic
1060040655 9:120297552-120297574 TTAAGAGAGGGGAAGAAGGCAGG - Intergenic
1060120275 9:120982347-120982369 TTGAGAAATGGGAAGCAGGAAGG - Intronic
1060258532 9:122053629-122053651 GGGAGAAAGGGGAGGGAGCATGG + Intronic
1060515439 9:124262831-124262853 TTTGGACAGGGGAAGGGGGAGGG + Intronic
1060634409 9:125189153-125189175 CTGAGGAAGGGGAAGGCGGTGGG - Intronic
1060714182 9:125906484-125906506 TAGAGAAAAGGGAAAGAAGATGG + Intronic
1060967669 9:127720871-127720893 GGGAGGAAGGGGAAGGGGGAGGG - Intronic
1060993247 9:127860941-127860963 TTGAGAAAGAGCAAGGAGCTGGG - Intergenic
1061244773 9:129395854-129395876 ATGAGAAGGTGGAAGGAGGATGG + Intergenic
1062080852 9:134622623-134622645 AAGAGAAAGAGGAGGGAGGAGGG - Intergenic
1062080883 9:134622722-134622744 AAGAGAAAGAGGAGGGAGGAGGG - Intergenic
1062080914 9:134622823-134622845 AAGAGAAAGAGGAGGGAGGAGGG - Intergenic
1062128607 9:134880483-134880505 CTGAGAACGGGGAACAAGGAAGG - Intergenic
1062151653 9:135022445-135022467 ATGAGAAAGGCCGAGGAGGAAGG - Intergenic
1062259586 9:135654797-135654819 TTGGGAAAGGGGCGGGAGGAAGG - Intergenic
1062523749 9:136970070-136970092 TCCAGGATGGGGAAGGAGGAAGG + Intronic
1062638390 9:137503515-137503537 AGGAGGAAGGAGAAGGAGGAGGG + Intronic
1203376847 Un_KI270442v1:383398-383420 TAGAGAAAGGGAAAGGGTGAGGG - Intergenic
1185552037 X:990217-990239 TTGACAAAGAGGAGGGAAGATGG - Intergenic
1186508122 X:10110226-10110248 TTGACAAGGGGGAAGGAGTGAGG + Intronic
1186772417 X:12830974-12830996 TGGAGAAACGGGAGGGAGGTTGG + Intergenic
1186799979 X:13083194-13083216 CTGTGAAATGGGAAAGAGGAAGG - Intergenic
1187135162 X:16540968-16540990 GAGAGAGAGGGAAAGGAGGAAGG + Intergenic
1187495539 X:19792602-19792624 TAGAGAAAGGGGAAGAAGACAGG + Intronic
1187572625 X:20520394-20520416 TTGAGAAAAATGAAGGGGGAAGG - Intergenic
1187852208 X:23602203-23602225 TTGTGAAAGGGGATGGAGGAAGG - Intergenic
1188128778 X:26404189-26404211 ATGATAAAGGAGAAGGAGCAAGG + Intergenic
1188158744 X:26774973-26774995 CTCAGAAAGGGGAAGGTGGGAGG + Intergenic
1188165040 X:26852135-26852157 TTGACAGAGGGCAAGTAGGATGG - Intergenic
1188694334 X:33171264-33171286 TTGAGAAAGGGGAAGTAGTAGGG + Intronic
1189177189 X:38969585-38969607 TGTAGAAAGGGGCAGCAGGAAGG - Intergenic
1189224796 X:39403623-39403645 TGGAGAATCTGGAAGGAGGAAGG - Intergenic
1189338596 X:40186951-40186973 TTGAGACAGGGCAGGGAGGAAGG + Intergenic
1189385229 X:40531553-40531575 TGGAGGAAGGGGAAGGGGGTTGG + Intergenic
1189524503 X:41805630-41805652 TGGGGAAAGGGGAAAGAGAAAGG + Intronic
1189700929 X:43715917-43715939 TTTAGAAAGGTGTAGCAGGATGG + Intronic
1189818416 X:44846794-44846816 ATTAGAAAGGGGAAGCATGAGGG - Intergenic
1190469991 X:50769212-50769234 GGAAGAAAGGGGAAGGAGGGAGG + Intronic
1190480571 X:50872721-50872743 CTGAGAAAGGGGAATGACCAAGG - Intergenic
1190509035 X:51158143-51158165 TTAAGAAAGGTGAAGAAAGAGGG - Intergenic
1190561947 X:51694974-51694996 ATGGGGAAGGGGAAGGAGAAGGG + Intergenic
1190720003 X:53139856-53139878 AGGAGGAAGGGGGAGGAGGAAGG + Intergenic
1190735768 X:53255256-53255278 ATGAGAAAGGAGAAGGAGAGAGG + Intronic
1190801882 X:53796710-53796732 TGAAGTAAGGGGAAGGTGGAGGG - Intergenic
1190845098 X:54183581-54183603 TGGAGGAAGGGGAGCGAGGAGGG + Intergenic
1191054984 X:56232309-56232331 CTGAGAAGGAGGAGGGAGGAAGG - Intergenic
1191108379 X:56786596-56786618 AGGAGAAAGAAGAAGGAGGAGGG - Intergenic
1191850568 X:65582924-65582946 TGGAGAAAGGGAGAGCAGGAGGG + Intergenic
1192139249 X:68633559-68633581 AGGAGAAAGGGGAAGGACAAAGG + Intergenic
1192143953 X:68668206-68668228 AAGAGAAAGAAGAAGGAGGAGGG - Intronic
1192161409 X:68790864-68790886 AGGAGAAAGGGAGAGGAGGATGG - Intergenic
1192185181 X:68941831-68941853 AGGAGAAAGGAGGAGGAGGAAGG + Intergenic
1192234180 X:69285615-69285637 TGGAGAAGGGGGAAGGAGGAGGG + Intergenic
1192243043 X:69349851-69349873 AGGAGAAGGGGGAAGGAGGGAGG - Intergenic
1192367317 X:70484795-70484817 TTGAGACAGACAAAGGAGGAAGG + Intronic
1192797457 X:74435880-74435902 TTGAGAAAGGGGAAGGGACTTGG - Intronic
1192899884 X:75485576-75485598 TTGGGAAAGGCAAAGGAGGATGG + Intronic
1193679631 X:84502297-84502319 GTGAGAAGGGCGAAGGAGGGAGG - Intronic
1193743959 X:85252644-85252666 TTCAGAAATGGGGAGGAGGTGGG - Intronic
1194268077 X:91779294-91779316 GGGAGAAAGGGGAAGGAAGGGGG - Intronic
1194379998 X:93179626-93179648 TGGTGAATGGGGAAGCAGGAGGG + Intergenic
1194820209 X:98496641-98496663 TTGGGAGAGGGGGAGAAGGAAGG - Intergenic
1195112827 X:101664657-101664679 TAGGGGGAGGGGAAGGAGGAAGG - Intergenic
1195202719 X:102565505-102565527 TGGACAAAGGGGAGGGAGGGAGG + Intergenic
1195316934 X:103688163-103688185 ATCAGAAAGGGGAGGGGGGAGGG - Intergenic
1195319477 X:103710031-103710053 TAGAGAATGGGGAATGAAGAGGG + Intronic
1195992898 X:110700521-110700543 TTGAGAAAAGGGAAGAAAAATGG + Intronic
1196005886 X:110836761-110836783 ATGAAAAAGAGGAATGAGGAGGG + Intergenic
1196087862 X:111705905-111705927 TTGAGGAAGGGAATGGGGGAAGG - Intronic
1196367986 X:114944513-114944535 TTGAGAAAACTGAAGCAGGAAGG - Intergenic
1196404861 X:115350485-115350507 ATGAGAAAGAGAGAGGAGGAAGG + Intergenic
1196657333 X:118232206-118232228 GGGAGGAAGAGGAAGGAGGAGGG + Intergenic
1196681705 X:118476117-118476139 TTGAGAAAGAGCAAGGAAGCTGG + Intergenic
1197230554 X:123999428-123999450 GAGAGAAGGGGGAGGGAGGAGGG - Intronic
1197399925 X:125977754-125977776 TTGAGAAAAGGGCGGGCGGAGGG + Intergenic
1197436510 X:126434845-126434867 TAGAGGAGGGGGAAGGAGGAAGG + Intergenic
1197816262 X:130501747-130501769 TAGAGAAATGGAAAGAAGGAAGG - Intergenic
1197860961 X:130969700-130969722 TTGAGAAATGTGAATGAGAAGGG + Intergenic
1198960287 X:142175420-142175442 TGGGAAAAGGGGCAGGAGGAGGG - Intergenic
1199036122 X:143052996-143053018 TTTGGAAAGGGGAAGGAAGAGGG - Intergenic
1199297049 X:146171219-146171241 AGGAGAAAGGAGAAGGAGGAAGG - Intergenic
1199507921 X:148586948-148586970 TATGGAAGGGGGAAGGAGGATGG - Intronic
1199617744 X:149671374-149671396 TTGGGGAAGTGGATGGAGGAGGG + Intergenic
1199624898 X:149731875-149731897 TTGGGGAAGTGGATGGAGGAGGG - Intergenic
1199637519 X:149827168-149827190 TAGGGAAAGGGGAAGGAGAGGGG + Intergenic
1199951364 X:152708678-152708700 TTGGGGAAGAGGATGGAGGAGGG + Intergenic
1199954011 X:152727902-152727924 TTGGGGAAGAGGATGGAGGAGGG + Intronic
1199958319 X:152759783-152759805 TTGGGGAAGAGGATGGAGGAGGG - Intergenic
1200585280 Y:5000215-5000237 GGGAGAAAGGGGAAGGAAGGGGG - Intronic
1201300168 Y:12498411-12498433 GAGAGAAAGAGGAAGGAGGGAGG - Intergenic
1201300241 Y:12498750-12498772 GGGAGGAGGGGGAAGGAGGAGGG - Intergenic
1201568233 Y:15388457-15388479 ATCAAAAAGGGGAAGGAGAAGGG - Intergenic
1201710941 Y:16990914-16990936 TGGGGTGAGGGGAAGGAGGAGGG + Intergenic
1201973065 Y:19817058-19817080 TAGACAAAGAGGAAGGGGGAGGG - Intergenic