ID: 1168904591

View in Genome Browser
Species Human (GRCh38)
Location 20:1392986-1393008
Sequence CGCCGCCGCCATGGGAGTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 3, 2: 0, 3: 11, 4: 87}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168904591_1168904596 -10 Left 1168904591 20:1392986-1393008 CCTGCACTCCCATGGCGGCGGCG 0: 1
1: 3
2: 0
3: 11
4: 87
Right 1168904596 20:1392999-1393021 GGCGGCGGCGGACGCTGAGCGGG 0: 1
1: 0
2: 4
3: 79
4: 631
1168904591_1168904598 -6 Left 1168904591 20:1392986-1393008 CCTGCACTCCCATGGCGGCGGCG 0: 1
1: 3
2: 0
3: 11
4: 87
Right 1168904598 20:1393003-1393025 GCGGCGGACGCTGAGCGGGCGGG 0: 1
1: 0
2: 4
3: 18
4: 209
1168904591_1168904604 30 Left 1168904591 20:1392986-1393008 CCTGCACTCCCATGGCGGCGGCG 0: 1
1: 3
2: 0
3: 11
4: 87
Right 1168904604 20:1393039-1393061 GGCGTGGACCAACAGCGACCTGG 0: 1
1: 2
2: 1
3: 2
4: 46
1168904591_1168904602 9 Left 1168904591 20:1392986-1393008 CCTGCACTCCCATGGCGGCGGCG 0: 1
1: 3
2: 0
3: 11
4: 87
Right 1168904602 20:1393018-1393040 CGGGCGGGCGGCGCGACGGGCGG 0: 1
1: 3
2: 5
3: 54
4: 472
1168904591_1168904597 -7 Left 1168904591 20:1392986-1393008 CCTGCACTCCCATGGCGGCGGCG 0: 1
1: 3
2: 0
3: 11
4: 87
Right 1168904597 20:1393002-1393024 GGCGGCGGACGCTGAGCGGGCGG 0: 1
1: 0
2: 1
3: 28
4: 281
1168904591_1168904601 6 Left 1168904591 20:1392986-1393008 CCTGCACTCCCATGGCGGCGGCG 0: 1
1: 3
2: 0
3: 11
4: 87
Right 1168904601 20:1393015-1393037 GAGCGGGCGGGCGGCGCGACGGG 0: 1
1: 1
2: 6
3: 42
4: 318
1168904591_1168904600 5 Left 1168904591 20:1392986-1393008 CCTGCACTCCCATGGCGGCGGCG 0: 1
1: 3
2: 0
3: 11
4: 87
Right 1168904600 20:1393014-1393036 TGAGCGGGCGGGCGGCGCGACGG 0: 1
1: 1
2: 2
3: 16
4: 196
1168904591_1168904603 14 Left 1168904591 20:1392986-1393008 CCTGCACTCCCATGGCGGCGGCG 0: 1
1: 3
2: 0
3: 11
4: 87
Right 1168904603 20:1393023-1393045 GGGCGGCGCGACGGGCGGCGTGG 0: 1
1: 1
2: 5
3: 77
4: 855
1168904591_1168904599 -3 Left 1168904591 20:1392986-1393008 CCTGCACTCCCATGGCGGCGGCG 0: 1
1: 3
2: 0
3: 11
4: 87
Right 1168904599 20:1393006-1393028 GCGGACGCTGAGCGGGCGGGCGG 0: 1
1: 0
2: 6
3: 17
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168904591 Original CRISPR CGCCGCCGCCATGGGAGTGC AGG (reversed) Exonic
900162837 1:1232443-1232465 CGCCGCCTTCCTGGCAGTGCTGG + Exonic
900492513 1:2959375-2959397 CTCCTCCTCCATGGGAGTGCTGG + Intergenic
900966254 1:5960775-5960797 CCCAGCAGCCATGGGAGTGTTGG - Intronic
901610789 1:10496330-10496352 CGAGGCCACCGTGGGAGTGCTGG - Intronic
905137147 1:35808407-35808429 CGCCGCCGCCATGGAGGCGCTGG + Exonic
905891525 1:41521396-41521418 TGCCCCCGCCACGGGGGTGCAGG + Intronic
908401135 1:63774062-63774084 CGCCGCCGCCGAGGGAGCCCCGG + Exonic
910678976 1:89843486-89843508 CGCCACGGCCAGGGGAGCGCTGG + Intronic
918597331 1:186307716-186307738 AGCCGCTGCCTTGGGAGTGGTGG - Exonic
920002207 1:202807862-202807884 CGGCGGTGCCATGGGAGGGCCGG - Intronic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
1074146860 10:110724613-110724635 CCCTGCAGCCATGGGCGTGCTGG + Intronic
1075129545 10:119726234-119726256 CGCCGCCTCCCTGGGCGCGCGGG + Exonic
1076692311 10:132230131-132230153 CGAGGCCGCCTTGGGAGGGCGGG + Intronic
1076859733 10:133135163-133135185 CTCTGCCTCCAAGGGAGTGCGGG + Intergenic
1077404632 11:2377540-2377562 CCGCGCCGCCATGGGAGTGGAGG + Exonic
1079122460 11:17695746-17695768 GGCCGCGGCCGTGGGGGTGCTGG + Intergenic
1079353688 11:19713650-19713672 CGCCGCTGCCAGGGACGTGCTGG + Exonic
1082658043 11:55874572-55874594 GGCCGCCGGCATGGTACTGCTGG - Intergenic
1083333670 11:61910951-61910973 CTCGGCCCCCATGGGAGGGCCGG - Intronic
1083617968 11:64035782-64035804 CGCCGCCGCGAGGGGAGAGGCGG + Intronic
1083669476 11:64292063-64292085 CCCGGCCCCCATGGGCGTGCCGG - Intronic
1084946902 11:72643202-72643224 CGCCGCCGCGATGGGACGGCAGG - Intronic
1090978391 11:131695037-131695059 CGCCGCCGCCGGGAGGGTGCAGG + Intronic
1091750895 12:3020678-3020700 CGGCCCTGCCATGGGGGTGCCGG - Exonic
1096134587 12:49188795-49188817 CGCCGCCGCAGTGCGGGTGCAGG - Intronic
1101641374 12:106587492-106587514 CCCCGCCGCTGTGTGAGTGCTGG + Intronic
1105290911 13:19052884-19052906 CGCCGACACCATGGGGGTGTGGG - Intergenic
1119500927 14:75126909-75126931 GGCCGCCGCCATGTCGGTGCTGG - Exonic
1120398426 14:83997693-83997715 CGCCTTCCCCATGTGAGTGCTGG + Intergenic
1122957090 14:105075937-105075959 CGACGCCCCCACGGGAGGGCTGG + Intergenic
1132878047 16:2148930-2148952 CACCGCCGCCAAGCGAGGGCCGG - Exonic
1133012946 16:2925051-2925073 CAGCTGCGCCATGGGAGTGCAGG - Intronic
1133924761 16:10183299-10183321 CGTCGCCGCCGAGGGACTGCGGG - Intergenic
1135698036 16:24607416-24607438 CGCCACCACCATGGCACTGCAGG - Intergenic
1136779114 16:32885984-32886006 CGCCGCCGCCACCGGAGTCTCGG - Intergenic
1136891503 16:33975534-33975556 CGCCGCCGCCACCGGAGTCTCGG + Intergenic
1137872900 16:51967706-51967728 AGCAGCCGCTGTGGGAGTGCTGG - Intergenic
1141972454 16:87492764-87492786 CGTCGCCGCCTGGGGAGCGCTGG + Intergenic
1203081528 16_KI270728v1_random:1148072-1148094 CGCCGCCGCCAACGGAGTCTCGG - Intergenic
1142673393 17:1498029-1498051 CGCCGGCGGTATGGGAGTGTCGG + Exonic
1142803502 17:2359658-2359680 GGCCACCCCGATGGGAGTGCTGG + Intronic
1143966770 17:10761130-10761152 CTCCCCCGCCGTGTGAGTGCCGG - Intergenic
1145210688 17:21011120-21011142 CGCCCCCGCCGTGTGGGTGCAGG + Intronic
1148648050 17:49230457-49230479 CGCCGCCCCCACGTGAGTCCTGG - Exonic
1152754262 17:82080586-82080608 CGCAGCTGCAATGGCAGTGCCGG + Exonic
1154356147 18:13624470-13624492 GGCCTCCGCCAGGGGACTGCAGG - Intronic
1160841124 19:1147484-1147506 GGCTGCGGCCATGGGGGTGCAGG - Intronic
1161063728 19:2227620-2227642 CGGCGCCGCCAGGCGTGTGCGGG - Intronic
1161532877 19:4800715-4800737 CGCCGCCCCCATGGAATTGCAGG + Exonic
1162378247 19:10317498-10317520 CGCCGAGGCCCTGGGAGTGCTGG + Exonic
1163607150 19:18281597-18281619 AGCCGCCGCCAGTGGAGGGCCGG - Exonic
1167037833 19:47004407-47004429 CGGCTCCGCCACGGGAGGGCTGG - Exonic
1168614484 19:57826766-57826788 GGCCGCCGCCATGGGAGTGCAGG - Intronic
1168695471 19:58401566-58401588 CGCCAGCGCCATCGGAGTGCTGG - Intronic
926821460 2:16855417-16855439 CGCCGGCGACATGGCAGAGCTGG - Intergenic
936795338 2:116196493-116196515 CGAAGCAGCCAAGGGAGTGCTGG - Intergenic
948806063 2:240453807-240453829 CGTCGCCGCCCTGGGGGTCCCGG - Intronic
1168904591 20:1392986-1393008 CGCCGCCGCCATGGGAGTGCAGG - Exonic
1171156298 20:22877836-22877858 GGCACCCACCATGGGAGTGCTGG + Intergenic
1171176126 20:23051574-23051596 CGGTGCCGCCATGGGGGTGAGGG + Intergenic
1171447740 20:25216779-25216801 CCACACCGCCATGGGGGTGCAGG + Intronic
1171455807 20:25271577-25271599 CGCCCCCGCCAGGGGACTGCAGG + Intronic
1176192986 20:63822316-63822338 CGTCTCCCCCATGGGTGTGCTGG - Intronic
1180115854 21:45704484-45704506 CGCCTCTGCCAGGGGAGAGCAGG - Intronic
1183050688 22:35258006-35258028 GGCCGCGGCCACGGGAGGGCTGG + Intronic
1184287370 22:43479120-43479142 GGCCGGCGCCAGGGGAGTGGAGG - Intronic
1184865021 22:47197451-47197473 CGCCCCCGCCCTGTGGGTGCCGG + Intergenic
1184921712 22:47609957-47609979 CCGCGCAGCCAGGGGAGTGCTGG - Intergenic
1185333524 22:50261815-50261837 GGCCGCCGCCGGGGGAGGGCCGG + Exonic
950168026 3:10816206-10816228 CGCCGCCGCCCCGGGCGAGCTGG - Exonic
963778513 3:149464102-149464124 CGCAGCCGCCATGGGAGTGCAGG - Intergenic
982712211 4:158768951-158768973 CGCCGCCGCCGTGGGGCTGCGGG + Intergenic
985152591 4:186961424-186961446 GGCAGGCGACATGGGAGTGCTGG + Intergenic
985152747 4:186962303-186962325 GGCAGGCGACATGGGAGTGCTGG + Intergenic
985153526 4:186966867-186966889 GGCAGGCGACATGGGAGTGCTGG + Intergenic
985153965 4:186969385-186969407 GGCAGGCGACATGGGAGTGCTGG + Intergenic
985154466 4:186972310-186972332 GGCAGGCGACATGGGAGTGCTGG + Intergenic
996196402 5:120611952-120611974 CTCCGCCCCCATGGCTGTGCAGG - Intronic
996779759 5:127172497-127172519 CACCACCTCCAGGGGAGTGCGGG + Intergenic
996862877 5:128084506-128084528 CGCCGCCGCCGCCGGAGTGCAGG - Exonic
997980832 5:138466466-138466488 AGCCGCGGCCATGGGGGTGCTGG + Intronic
1002055123 5:176594335-176594357 CACCCCAGCCATGGGAGAGCAGG - Intronic
1002055721 5:176597038-176597060 CGGCGCCGCCATGGAGGTGGAGG - Exonic
1002591080 5:180291990-180292012 CGCCGCCGCAGTGGGTGTGAGGG + Exonic
1013073285 6:106748607-106748629 AGCCGCCACCAGGGGAGGGCAGG - Intergenic
1014947495 6:127515673-127515695 CGCCGCCGCCATTGGGGAGGCGG + Exonic
1018631160 6:165824109-165824131 TGCCTCCTCCATGGGAGTGTAGG + Intronic
1019143277 6:169961651-169961673 CGCCACAGCCACGTGAGTGCTGG + Intergenic
1024248119 7:47485651-47485673 CGCCTCCACCATGGGAGGGACGG - Intronic
1027111553 7:75443688-75443710 CGCCTCCGCCTTCGAAGTGCTGG - Intronic
1027283784 7:76628221-76628243 CGCCTCCGCCTTCGAAGTGCTGG - Intergenic
1033200012 7:139360252-139360274 CGCCGCCGCCATGTCGGCGCAGG + Exonic
1049589230 8:143448589-143448611 CTCCGCCGCCATGGCTCTGCAGG + Intronic
1051898249 9:22010602-22010624 TGCCACCACCATGGAAGTGCTGG + Intronic
1055240869 9:74184072-74184094 CGCTGCTGCCCTTGGAGTGCTGG - Intergenic
1057245619 9:93451906-93451928 CGCCGCCGCCATGGGCGTGCAGG + Exonic
1057730130 9:97601324-97601346 GGCAGCCACCATGGCAGTGCTGG + Exonic
1061059795 9:128244698-128244720 CACCGCCGCCACTGGAGAGCTGG - Intronic
1061134259 9:128724159-128724181 CGCCGCCGCCCGGGGACTGGTGG + Intergenic
1190055836 X:47180466-47180488 GGCCGCAGCAATGGCAGTGCTGG - Exonic
1190181666 X:48197609-48197631 CGCCGCAGCCCTGGGACTACAGG + Intronic