ID: 1168904591

View in Genome Browser
Species Human (GRCh38)
Location 20:1392986-1393008
Sequence CGCCGCCGCCATGGGAGTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 3, 2: 0, 3: 11, 4: 87}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168904591_1168904601 6 Left 1168904591 20:1392986-1393008 CCTGCACTCCCATGGCGGCGGCG 0: 1
1: 3
2: 0
3: 11
4: 87
Right 1168904601 20:1393015-1393037 GAGCGGGCGGGCGGCGCGACGGG 0: 1
1: 1
2: 6
3: 42
4: 318
1168904591_1168904600 5 Left 1168904591 20:1392986-1393008 CCTGCACTCCCATGGCGGCGGCG 0: 1
1: 3
2: 0
3: 11
4: 87
Right 1168904600 20:1393014-1393036 TGAGCGGGCGGGCGGCGCGACGG 0: 1
1: 1
2: 2
3: 16
4: 196
1168904591_1168904598 -6 Left 1168904591 20:1392986-1393008 CCTGCACTCCCATGGCGGCGGCG 0: 1
1: 3
2: 0
3: 11
4: 87
Right 1168904598 20:1393003-1393025 GCGGCGGACGCTGAGCGGGCGGG 0: 1
1: 0
2: 4
3: 18
4: 209
1168904591_1168904597 -7 Left 1168904591 20:1392986-1393008 CCTGCACTCCCATGGCGGCGGCG 0: 1
1: 3
2: 0
3: 11
4: 87
Right 1168904597 20:1393002-1393024 GGCGGCGGACGCTGAGCGGGCGG 0: 1
1: 0
2: 1
3: 28
4: 281
1168904591_1168904599 -3 Left 1168904591 20:1392986-1393008 CCTGCACTCCCATGGCGGCGGCG 0: 1
1: 3
2: 0
3: 11
4: 87
Right 1168904599 20:1393006-1393028 GCGGACGCTGAGCGGGCGGGCGG 0: 1
1: 0
2: 6
3: 17
4: 242
1168904591_1168904602 9 Left 1168904591 20:1392986-1393008 CCTGCACTCCCATGGCGGCGGCG 0: 1
1: 3
2: 0
3: 11
4: 87
Right 1168904602 20:1393018-1393040 CGGGCGGGCGGCGCGACGGGCGG 0: 1
1: 3
2: 5
3: 54
4: 472
1168904591_1168904603 14 Left 1168904591 20:1392986-1393008 CCTGCACTCCCATGGCGGCGGCG 0: 1
1: 3
2: 0
3: 11
4: 87
Right 1168904603 20:1393023-1393045 GGGCGGCGCGACGGGCGGCGTGG 0: 1
1: 1
2: 5
3: 77
4: 855
1168904591_1168904604 30 Left 1168904591 20:1392986-1393008 CCTGCACTCCCATGGCGGCGGCG 0: 1
1: 3
2: 0
3: 11
4: 87
Right 1168904604 20:1393039-1393061 GGCGTGGACCAACAGCGACCTGG 0: 1
1: 2
2: 1
3: 2
4: 46
1168904591_1168904596 -10 Left 1168904591 20:1392986-1393008 CCTGCACTCCCATGGCGGCGGCG 0: 1
1: 3
2: 0
3: 11
4: 87
Right 1168904596 20:1392999-1393021 GGCGGCGGCGGACGCTGAGCGGG 0: 1
1: 0
2: 4
3: 79
4: 631

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168904591 Original CRISPR CGCCGCCGCCATGGGAGTGC AGG (reversed) Exonic