ID: 1168904594

View in Genome Browser
Species Human (GRCh38)
Location 20:1392995-1393017
Sequence CTCAGCGTCCGCCGCCGCCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 151}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168904594_1168904603 5 Left 1168904594 20:1392995-1393017 CCATGGCGGCGGCGGACGCTGAG 0: 1
1: 0
2: 3
3: 17
4: 151
Right 1168904603 20:1393023-1393045 GGGCGGCGCGACGGGCGGCGTGG 0: 1
1: 1
2: 5
3: 77
4: 855
1168904594_1168904604 21 Left 1168904594 20:1392995-1393017 CCATGGCGGCGGCGGACGCTGAG 0: 1
1: 0
2: 3
3: 17
4: 151
Right 1168904604 20:1393039-1393061 GGCGTGGACCAACAGCGACCTGG 0: 1
1: 2
2: 1
3: 2
4: 46
1168904594_1168904605 24 Left 1168904594 20:1392995-1393017 CCATGGCGGCGGCGGACGCTGAG 0: 1
1: 0
2: 3
3: 17
4: 151
Right 1168904605 20:1393042-1393064 GTGGACCAACAGCGACCTGGCGG 0: 2
1: 1
2: 0
3: 3
4: 88
1168904594_1168904602 0 Left 1168904594 20:1392995-1393017 CCATGGCGGCGGCGGACGCTGAG 0: 1
1: 0
2: 3
3: 17
4: 151
Right 1168904602 20:1393018-1393040 CGGGCGGGCGGCGCGACGGGCGG 0: 1
1: 3
2: 5
3: 54
4: 472
1168904594_1168904606 27 Left 1168904594 20:1392995-1393017 CCATGGCGGCGGCGGACGCTGAG 0: 1
1: 0
2: 3
3: 17
4: 151
Right 1168904606 20:1393045-1393067 GACCAACAGCGACCTGGCGGCGG 0: 2
1: 1
2: 0
3: 6
4: 69
1168904594_1168904601 -3 Left 1168904594 20:1392995-1393017 CCATGGCGGCGGCGGACGCTGAG 0: 1
1: 0
2: 3
3: 17
4: 151
Right 1168904601 20:1393015-1393037 GAGCGGGCGGGCGGCGCGACGGG 0: 1
1: 1
2: 6
3: 42
4: 318
1168904594_1168904600 -4 Left 1168904594 20:1392995-1393017 CCATGGCGGCGGCGGACGCTGAG 0: 1
1: 0
2: 3
3: 17
4: 151
Right 1168904600 20:1393014-1393036 TGAGCGGGCGGGCGGCGCGACGG 0: 1
1: 1
2: 2
3: 16
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168904594 Original CRISPR CTCAGCGTCCGCCGCCGCCA TGG (reversed) Exonic
900349669 1:2228499-2228521 CGCCGCGCCCGCCGCCGCCCGGG - Intergenic
901628974 1:10639029-10639051 CGCCGCCTCCGCCGCCGCCTCGG + Exonic
902385572 1:16073646-16073668 CGCAGTGCCCGCCGCTGCCAGGG + Intergenic
902985031 1:20149831-20149853 CTCAGGGTCAGCAGCCTCCACGG + Exonic
913209259 1:116570004-116570026 CTCAGCGTCCGCTGCCTGCCCGG - Intronic
913469030 1:119171776-119171798 CTGAGCCTCCCCCGCCTCCATGG + Intergenic
914073870 1:144322737-144322759 TTCACCCTCCGCCGCCGCCGCGG + Intergenic
914105284 1:144643623-144643645 TTCACCCTCCGCCGCCGCCGCGG - Intergenic
916059624 1:161089627-161089649 CTCAGCAGCCACCGCCCCCATGG + Intergenic
918015859 1:180632066-180632088 CTCCTCCTCCGCCGCCGCCGAGG - Exonic
923171552 1:231421885-231421907 CGCCGCCGCCGCCGCCGCCATGG - Exonic
1062899599 10:1132832-1132854 CTCAGCCTCAGCCACAGCCACGG - Intergenic
1067772118 10:49134094-49134116 CTCAGCCTCTGCCCTCGCCATGG - Intergenic
1070257922 10:74826669-74826691 CACCGCTGCCGCCGCCGCCAGGG - Exonic
1073122532 10:101131495-101131517 CGCAGCGAGCGCCGCCGCCCGGG + Exonic
1073196269 10:101694620-101694642 CTCCCCGGCCGCCGCCGCCATGG + Exonic
1073266369 10:102230681-102230703 CTCGGCCGCCGCCGCCGCCGCGG - Exonic
1074814504 10:117134310-117134332 CGCAGCCGCCGCCGCCGCCCCGG - Exonic
1075519686 10:123136187-123136209 CTAAGCCTCAGCCGCCCCCACGG + Exonic
1077394246 11:2313354-2313376 CTCTGCGTCCGCCTCCGCTGTGG - Intronic
1078514062 11:12008338-12008360 CTCAGAGCCCCGCGCCGCCAGGG + Intronic
1081492586 11:43579628-43579650 GTCTGCGCCCGCCGCCGCCGCGG - Intronic
1081936395 11:46906879-46906901 CTCAGCGTCCGCTGCAGTGAAGG + Intronic
1083890237 11:65592339-65592361 CCCGGCGTCCGCCGCCGCCCCGG + Exonic
1084452932 11:69250799-69250821 CTCCTCGTCCGCAGCAGCCATGG - Intergenic
1085597010 11:77820164-77820186 CTCCCCTTCCCCCGCCGCCAAGG + Intronic
1088859931 11:113790103-113790125 CTCAGGGTCCACGGCCACCATGG + Intergenic
1089207082 11:116772961-116772983 CTCTGCCCCCGCCGCTGCCATGG - Exonic
1089452080 11:118605879-118605901 CTCAGCATCCACTGCCTCCATGG + Intergenic
1095465330 12:42483412-42483434 CTCAGGGGCCGGCGCCGCGAGGG - Intronic
1096491418 12:52015025-52015047 CCCCGCCTCCGCCCCCGCCAGGG - Exonic
1096778208 12:53976479-53976501 CTCCTCCTCCGCCGCTGCCATGG - Exonic
1097155133 12:57006619-57006641 CGCAGCGCCCCCCGCCGCCCGGG + Intergenic
1104534521 12:129606398-129606420 CTCAGAGTCTGCCGCAGCCCCGG + Intronic
1105015822 12:132786393-132786415 CTCCGCGTCCGCAGCCTCCTTGG + Exonic
1105243661 13:18628853-18628875 CCAGGCGGCCGCCGCCGCCAGGG + Intergenic
1107467839 13:40665925-40665947 CGCCGCCACCGCCGCCGCCACGG + Exonic
1113656115 13:112068545-112068567 CGCCGCCGCCGCCGCCGCCACGG - Exonic
1114612527 14:24052135-24052157 CTCAGCAGCAGCGGCCGCCATGG + Exonic
1115320742 14:32077123-32077145 CCCAGCGCCCGCCGCCGCGCCGG - Intronic
1115399235 14:32939123-32939145 CGCCGCCGCCGCCGCCGCCACGG + Intronic
1117920819 14:60723882-60723904 CGCCGCGACCGCTGCCGCCAGGG - Exonic
1122558296 14:102592970-102592992 CGCCGCCTCCGCCGCCGCCTCGG + Exonic
1122940254 14:104978065-104978087 CTCCGAGTCCCCCGCCCCCAAGG + Intronic
1123487634 15:20755778-20755800 CCGGGCGGCCGCCGCCGCCAGGG - Intergenic
1123544126 15:21324836-21324858 CCGGGCGGCCGCCGCCGCCAGGG - Intergenic
1123997610 15:25729740-25729762 CTCAGCTTCTGCCGCCTTCAGGG + Intronic
1124355676 15:28993180-28993202 CTCAGAGTCAGCTGCCCCCAGGG + Intronic
1124652506 15:31484004-31484026 CGCCGCCGCCGCCGCCGCCACGG - Exonic
1129260823 15:74366166-74366188 CCCAGCGCACGCCGCCGCCCGGG - Intronic
1202952468 15_KI270727v1_random:52109-52131 CCGGGCGGCCGCCGCCGCCAGGG - Intergenic
1132877959 16:2148664-2148686 CGCCGCCGCCGCCGCCGCCAGGG + Exonic
1132950271 16:2557881-2557903 CCCAGCCTCCGCCGCAGCCTCGG + Exonic
1132964075 16:2642289-2642311 CCCAGCCTCCGCCGCAGCCTCGG - Intergenic
1133769883 16:8861680-8861702 CTCAGCTACAGCCGCGGCCAAGG + Intronic
1134843059 16:17416730-17416752 CTCAGCGGCTGCCTCCACCAGGG + Intronic
1137290244 16:47047580-47047602 CTCAGCACCAGCCGCCACCATGG + Intergenic
1139484720 16:67249049-67249071 CTCTTCGGCCGCCCCCGCCAGGG - Exonic
1141642303 16:85348399-85348421 CTCAGCTTCCTCCTCCGCAAAGG - Intergenic
1142352615 16:89587005-89587027 GTCAGCGTCCACCCCCGCCAGGG - Intronic
1142586853 17:979436-979458 CTCGGGCTCCGCCGCCGCCCCGG + Exonic
1144626181 17:16845480-16845502 CTCAGTGTCGGCCTCCTCCAGGG + Intergenic
1144880252 17:18427240-18427262 CTCAGTGTCGGCCTCCTCCAGGG - Intergenic
1145151981 17:20517147-20517169 CTCAGTGTCGGCCTCCTCCAGGG + Intergenic
1146183103 17:30709533-30709555 CCGAGCCTCCGCCGCCGCGAGGG + Intergenic
1148611945 17:48970493-48970515 CTCCTCCTCTGCCGCCGCCATGG + Intergenic
1151778657 17:76226999-76227021 CTCAGGGTCCACGGCCACCATGG - Intronic
1152262375 17:79274051-79274073 GTCAGCGTCCGCCCCTGCCCTGG - Intronic
1152914148 17:83024261-83024283 CTCAGCGGCAGCCTCCGCCCGGG + Intronic
1152924392 17:83080535-83080557 CGCAGCGCGCGCCGCGGCCAAGG - Intronic
1154445281 18:14431032-14431054 CCAGGCGGCCGCCGCCGCCAGGG - Intergenic
1160736161 19:663295-663317 CTCAGCGGCCACCGTCGCCCGGG - Intergenic
1160765672 19:806456-806478 CGCAGCTGCCGCCGCCGCCGAGG - Exonic
1161761397 19:6175539-6175561 CTCACCGTCCCCCACCCCCATGG - Intronic
1162531399 19:11238254-11238276 CTCAACTTCAGCAGCCGCCAGGG - Exonic
1162577158 19:11505742-11505764 CTCAGCCTCCGCCTCCGCCTCGG + Exonic
1162975691 19:14206235-14206257 CCGAGCCTCCGCCGCCGCGAGGG - Intergenic
1163583703 19:18153176-18153198 CCCCGCCTCCGCCGCCGCCACGG - Exonic
1163847029 19:19643614-19643636 CGCAGCCGCCGCCGCCGCCTCGG + Exonic
1165143916 19:33719540-33719562 CTCAGCGCCTGCCACCTCCAGGG - Intronic
1165158851 19:33804165-33804187 CTCAGCGTCTGAGGCTGCCAAGG - Intronic
1165459592 19:35936659-35936681 GTCAGCCTCCGCCGCAGCCCAGG + Intronic
1165837966 19:38770860-38770882 CTCAGAGCCCGCCTCCGCCTCGG + Intergenic
1165841599 19:38791837-38791859 CTCAGAGCCCGCCTCCGCCTCGG - Intergenic
1167744028 19:51340575-51340597 CTCCGATTCCGCCGCCTCCAGGG + Exonic
1168234217 19:55051806-55051828 CACAGCAACCTCCGCCGCCAGGG + Intronic
1168614487 19:57826775-57826797 CCCAGCATCGGCCGCCGCCATGG - Intronic
932553199 2:72793946-72793968 CTCAGCATCCACCGAAGCCATGG + Intronic
932728317 2:74198853-74198875 CTCAGCGGCCACCACCGCCGGGG - Intronic
937933205 2:127221321-127221343 CTCAGCAACCTCCGCCCCCAGGG + Intergenic
944154283 2:196593724-196593746 CTCAGGCTCCGCCGCAGCCTCGG - Intergenic
946375773 2:219308341-219308363 CTCTGAGTCTGGCGCCGCCAAGG + Intronic
946966439 2:225042278-225042300 CGCCGCGTCCGCCGCCGCGGTGG - Exonic
947549688 2:231037526-231037548 CTCTGCGGCCGCCGCGGCCCGGG - Exonic
948696190 2:239734113-239734135 TTCAGCCTCAGCCGCCACCAAGG - Intergenic
1168904594 20:1392995-1393017 CTCAGCGTCCGCCGCCGCCATGG - Exonic
1171452866 20:25248160-25248182 CTCCGCCTCCGCCGGCGCGATGG + Exonic
1174317454 20:49713740-49713762 CTCCCCGTCCGCCGCCTCCTGGG + Exonic
1175429373 20:58891237-58891259 CCCAGCCGCCGCCGCCGCCGCGG + Intronic
1175429537 20:58891708-58891730 CGCCGCCGCCGCCGCCGCCATGG + Intronic
1175847481 20:62066135-62066157 CTCCCCGTCCGCCACCGCCCCGG - Intergenic
1176024468 20:62978704-62978726 CTCAGCCTCCGCCCCCTCCATGG + Intergenic
1176450710 21:6858831-6858853 CCAGGCGGCCGCCGCCGCCAGGG + Intergenic
1176828879 21:13723849-13723871 CCAGGCGGCCGCCGCCGCCAGGG + Intergenic
1178839872 21:36130054-36130076 CTCCGCGCCCGCCCCCGCCGCGG - Intergenic
1180014710 21:45074595-45074617 CGCCGCCGCCGCCGCCGCCACGG - Intronic
1180051146 21:45331594-45331616 CTGAGCGGCTGCCCCCGCCAAGG - Intergenic
1181680940 22:24495396-24495418 CTCAGCGCCCGCCATGGCCACGG - Exonic
1183713537 22:39520629-39520651 CTCAGGGTCCACGGCCACCATGG + Exonic
1184674201 22:46031712-46031734 CTCAGCTACCGCCTCCTCCAGGG - Intergenic
950625353 3:14242668-14242690 CTCAGCCTCCGCTGACACCAAGG + Intergenic
960628387 3:119703245-119703267 CTCCGCGTCCGTCGCCTCCTAGG + Intronic
961676989 3:128573638-128573660 CTCAGCGTCTCCCGCCTCCAGGG - Exonic
963778517 3:149464111-149464133 CCCAGCGTCCGCAGCCGCCATGG - Intergenic
968084268 3:195867534-195867556 CCCAGCCCCCGCCGCCCCCACGG - Exonic
968481953 4:837176-837198 CTCGGCCTCCACCGCAGCCAAGG + Intergenic
968671837 4:1856189-1856211 CTCAGCGCCCGCCGCTGGCCAGG + Exonic
969346940 4:6575745-6575767 CTCAGCGTCCTCCGCCCCCCAGG + Intronic
971257813 4:25030434-25030456 CCCTGCGTCCGCCGCCGCGAGGG - Intronic
976390043 4:84497805-84497827 CTCCGCCTCTGCCGCCGCCGCGG - Exonic
981713616 4:147732283-147732305 CGCAGCGACCGCTGCCGTCATGG + Exonic
984639374 4:182144859-182144881 CCCCGCGTCCGCCGCCTCCCGGG - Intronic
985565337 5:612506-612528 CCCACGGTCCGCCGCCGCCCCGG - Intronic
988437531 5:31193807-31193829 CTCCGCCGCCGCCGCCGCCGCGG - Exonic
989375419 5:40755712-40755734 CTCAGCTTCCACCGCCGACCGGG + Intronic
991913880 5:71587337-71587359 CTCAGCTTCCGCCCCAGCCAGGG + Exonic
992487431 5:77210396-77210418 CTCCGCGGCCGCAGCCGCCCGGG - Intergenic
998236491 5:140402395-140402417 CACCGCGGCCACCGCCGCCATGG - Intronic
1003645544 6:7910674-7910696 CCCAGCGCCCGCCGCCGCCATGG + Exonic
1006547514 6:34792123-34792145 CACAGCCGCCGCCGCCGCCATGG - Exonic
1009396983 6:63211538-63211560 CTCGGCGTCGGCCGCCGCCATGG + Exonic
1011449047 6:87473306-87473328 CTCCGGGTCCGCCGCAGCCCCGG - Intronic
1013524111 6:110958768-110958790 CTCGTCCGCCGCCGCCGCCATGG - Exonic
1014947585 6:127516033-127516055 CTCCGCAGCCGCCGCCGCCCAGG - Exonic
1016010739 6:139135482-139135504 CGCCGCGCCCGCCGCTGCCAGGG - Exonic
1017163953 6:151390917-151390939 CTCACCGGCCGCCGCCGCCCAGG + Intronic
1019922371 7:4171217-4171239 CTGATCGTCTGCCGCCGCCTCGG + Intronic
1020461749 7:8435328-8435350 CTCAGTGTGCTCCGCCGCCTGGG + Intronic
1022101095 7:27169613-27169635 CGCCGCTGCCGCCGCCGCCAAGG + Intronic
1023618481 7:42045420-42045442 CTCAGCTGCCACCGCCGGCACGG - Exonic
1029567322 7:101347692-101347714 CTCAGCGATCGCCGGGGCCATGG + Intergenic
1029709384 7:102291281-102291303 CTCAGCCTTTGCCACCGCCACGG - Intronic
1035169498 7:157009829-157009851 CGCAGCCGCCGCCGCCGCCGCGG + Exonic
1035369655 7:158371945-158371967 CTCAGCGTCCGTCGTGGCCCCGG + Intronic
1037980057 8:23246876-23246898 CTGAGCCACAGCCGCCGCCAGGG + Exonic
1038147693 8:24913674-24913696 CTCCTCGGCCGCCGCCTCCACGG + Exonic
1042271525 8:66961418-66961440 CCCGGCGTCCGCCGGCGCCTCGG + Exonic
1047262300 8:123274127-123274149 CGCAGAGTCCGCGGCCGGCACGG - Exonic
1049050497 8:140191079-140191101 CTCAGCATCTGCCCCCACCAAGG + Intronic
1049589228 8:143448580-143448602 CTCAGCCAGCTCCGCCGCCATGG + Intronic
1049643814 8:143727349-143727371 CTCAGTGGCCGCCGCAGCCCCGG + Exonic
1049694115 8:143975349-143975371 CTCAGCGTCCTCACCCGACATGG + Intronic
1051809288 9:21031586-21031608 CCCATGGGCCGCCGCCGCCAGGG + Exonic
1055514207 9:77020319-77020341 CGCCGCCGCCGCCGCCGCCACGG - Exonic
1057596124 9:96417663-96417685 CTCGGCCTCCGCCGCCGCCTCGG - Exonic
1057922005 9:99105204-99105226 AGCAGCGACCGCCGCCTCCATGG - Exonic
1058885685 9:109320200-109320222 CTCCGCCGCCGGCGCCGCCAAGG - Exonic
1060278319 9:122198741-122198763 CTCCGCGTCCACCACCGGCATGG + Intronic
1060700635 9:125747009-125747031 CTCGGCCGCCGCCGCCGCCTCGG - Intergenic
1060700682 9:125747181-125747203 CTCCGCCTCCGCCACCGCCGCGG + Intergenic
1061449664 9:130661250-130661272 CTCCGCTGCCGCCGCCGCCCGGG - Intergenic
1203518472 Un_GL000213v1:25686-25708 CCAGGCGGCCGCCGCCGCCAGGG - Intergenic
1186207686 X:7217176-7217198 CTCAGCCTCCACCACCCCCAGGG - Intergenic
1187464461 X:19515181-19515203 CTCAGTGCCCGCCGCCGCCGGGG - Exonic
1190474402 X:50813133-50813155 CGCCGCCGCCGCCGCCGCCAGGG - Intronic
1192657070 X:73003311-73003333 CTCTGCTTCCGCCTCCGCCACGG - Intergenic
1192665050 X:73079690-73079712 CTCTGCTTCCGCCTCCGCCACGG + Intergenic
1195896338 X:109749422-109749444 CTGAGCCTCCGCCCCCTCCATGG - Intergenic
1199679586 X:150215701-150215723 CTCAGGGACCGCCCCCGCCCCGG + Intergenic
1199695645 X:150341348-150341370 CTCAGGGACCGCCCCCGCCCCGG - Intergenic
1200074043 X:153542534-153542556 CTCAGCCTCCACCTCCACCAGGG + Intronic
1201577744 Y:15478682-15478704 CTCAGCTTTCACCTCCGCCAGGG - Intergenic