ID: 1168904600

View in Genome Browser
Species Human (GRCh38)
Location 20:1393014-1393036
Sequence TGAGCGGGCGGGCGGCGCGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 1, 2: 2, 3: 16, 4: 196}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168904594_1168904600 -4 Left 1168904594 20:1392995-1393017 CCATGGCGGCGGCGGACGCTGAG 0: 1
1: 0
2: 3
3: 17
4: 151
Right 1168904600 20:1393014-1393036 TGAGCGGGCGGGCGGCGCGACGG 0: 1
1: 1
2: 2
3: 16
4: 196
1168904586_1168904600 24 Left 1168904586 20:1392967-1392989 CCTGGGGAGATGGTTTCCACCTG 0: 2
1: 2
2: 2
3: 44
4: 879
Right 1168904600 20:1393014-1393036 TGAGCGGGCGGGCGGCGCGACGG 0: 1
1: 1
2: 2
3: 16
4: 196
1168904589_1168904600 8 Left 1168904589 20:1392983-1393005 CCACCTGCACTCCCATGGCGGCG 0: 2
1: 2
2: 1
3: 6
4: 113
Right 1168904600 20:1393014-1393036 TGAGCGGGCGGGCGGCGCGACGG 0: 1
1: 1
2: 2
3: 16
4: 196
1168904585_1168904600 30 Left 1168904585 20:1392961-1392983 CCGTCTCCTGGGGAGATGGTTTC 0: 2
1: 0
2: 2
3: 20
4: 199
Right 1168904600 20:1393014-1393036 TGAGCGGGCGGGCGGCGCGACGG 0: 1
1: 1
2: 2
3: 16
4: 196
1168904593_1168904600 -3 Left 1168904593 20:1392994-1393016 CCCATGGCGGCGGCGGACGCTGA 0: 1
1: 0
2: 2
3: 2
4: 45
Right 1168904600 20:1393014-1393036 TGAGCGGGCGGGCGGCGCGACGG 0: 1
1: 1
2: 2
3: 16
4: 196
1168904591_1168904600 5 Left 1168904591 20:1392986-1393008 CCTGCACTCCCATGGCGGCGGCG 0: 1
1: 3
2: 0
3: 11
4: 87
Right 1168904600 20:1393014-1393036 TGAGCGGGCGGGCGGCGCGACGG 0: 1
1: 1
2: 2
3: 16
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168904600 Original CRISPR TGAGCGGGCGGGCGGCGCGA CGG Exonic
900413910 1:2526411-2526433 TGCGGGGGCGGGCGGGGCGCCGG - Intronic
900633625 1:3651573-3651595 GGAGCAGGCGGGCGGGGCGGCGG + Intronic
900796283 1:4710647-4710669 GAAGCGGGTGGGGGGCGCGAGGG - Intronic
901049601 1:6419702-6419724 TCTGCGGACGGGCGGCGCGGTGG + Exonic
901317384 1:8318199-8318221 AGAGCGGGCGGAGGGCGCGGAGG - Intronic
902916742 1:19644283-19644305 CGGGCGGGCGCGCGGCGCGGGGG - Intronic
904013440 1:27403388-27403410 TGAGCAGGCGGGTGGAGCAAAGG + Intergenic
904245097 1:29181843-29181865 GCAACGGGCGGGCGGCGGGACGG + Exonic
904296374 1:29522115-29522137 TGAGTGGGCGGGCGGGGGAATGG - Intergenic
905174035 1:36125218-36125240 GGAGTGGGCGGGCGGCAGGAGGG + Exonic
905390868 1:37634663-37634685 GGAACGGGCGGGCGGAGCGCAGG - Exonic
906650348 1:47508418-47508440 GCTGCGGGCGGGCGGCGCGGGGG + Intergenic
908523388 1:64966119-64966141 GGAGCCGGCGGGCGGCGAGGAGG - Intronic
910145715 1:84078033-84078055 AGAGAGGGCGGACCGCGCGAAGG + Intergenic
911527520 1:99004702-99004724 CGAGCGGGCGGTCGACGCGGTGG + Exonic
913017841 1:114757495-114757517 TGTCCCGGCGGGCGGGGCGAGGG - Intronic
915549678 1:156624903-156624925 TGGGCGGGCGGGCGGGCTGATGG - Intronic
921217729 1:212951449-212951471 TGTGCGCGCGGGCGCGGCGAGGG - Exonic
922372994 1:224929877-224929899 TCGGCGGGCGGGCGGCGCGTGGG + Intronic
922496603 1:226062522-226062544 GGAGGGAGCGGGCGGCGCGCGGG + Intronic
924289510 1:242523995-242524017 TGAGCGCGCGCGGGGCGCGGGGG - Intronic
924527146 1:244863301-244863323 GCCGCGGGCGGGCGGCGGGAGGG - Intronic
1063664885 10:8055203-8055225 TGGGCGGGCGGGCGGCGCGAGGG + Intronic
1064552782 10:16520452-16520474 AGCGCGGGCGGGCGGCGGGGAGG - Intronic
1066464409 10:35640358-35640380 TGGGGGCGCGGGCGGCGCGGCGG - Exonic
1069674003 10:70234100-70234122 GGAGGGGGCGGGGGGCGCGGGGG - Intergenic
1069836818 10:71314523-71314545 GGGGCGGGGGGGCGGTGCGACGG - Intergenic
1069962365 10:72086704-72086726 TGAGTGGCCGGGCCCCGCGATGG - Intronic
1070162238 10:73873724-73873746 TGGGGGGGCGGGCGGGGCGGGGG + Intronic
1070257601 10:74825422-74825444 CGGGCTGGCGGGCGGCGCGGGGG + Intergenic
1073057885 10:100713895-100713917 AGAGGGGGCGGGCGGAGCGGGGG - Intergenic
1074923738 10:118046582-118046604 CGGGCGGGCGGGAGGCGCGGAGG - Exonic
1076776535 10:132701065-132701087 TGAGCGGGCCTTCGGCGTGAGGG + Intronic
1076916339 10:133424540-133424562 GGAGCGGGCGGGCGGCGGCGCGG + Exonic
1076936446 10:133569335-133569357 GGAGCGGGCGGGCGGCGGCGCGG + Intronic
1077124469 11:926215-926237 TGAGGGTGCGGGCGGCGCTCGGG + Intronic
1077948372 11:6926960-6926982 CGAGGGGGTGGGCGGCGGGACGG + Intronic
1078164556 11:8871040-8871062 AGAGAGGGCGGGCGGCGGGCAGG + Intronic
1079076747 11:17389214-17389236 CGAGCGCCCGGGCGGCGGGAGGG - Intronic
1079237054 11:18698689-18698711 TGAGCGGGCGGGAGCCGGGGGGG - Intronic
1082767401 11:57180473-57180495 CGAGAGGGCGCGGGGCGCGAGGG + Intergenic
1084147901 11:67274831-67274853 TGAGCTGGCGTGTGGCCCGAAGG + Intronic
1084151460 11:67289624-67289646 TGAGCGGGCGGGGGGGGGGGGGG - Intronic
1094040249 12:26114401-26114423 GGCGCTGGCGGGCGGCGGGATGG - Intergenic
1095440997 12:42238453-42238475 TTAGCCGGCGGGCGGTGCGGGGG + Intronic
1097267661 12:57755328-57755350 CGAGCGGGCTGGCGGCCCGGGGG - Exonic
1101371942 12:104138296-104138318 CGGGCGCGCGGGCGGCGCGGAGG - Intergenic
1102466994 12:113135757-113135779 TGGGCGGGCAGGGGGCGGGAGGG + Intronic
1113082790 13:106535411-106535433 CGAGCGCGCGGGCGCCGCGTCGG + Intergenic
1115906988 14:38211212-38211234 GTGGCGGGCGGGCGGCGAGAGGG - Exonic
1117119665 14:52553478-52553500 TGAGCGGGCGGCCGGAGCAAGGG - Exonic
1117302297 14:54441441-54441463 TGAGAGGGCTGGCGCCGCGGCGG - Intergenic
1119441901 14:74634205-74634227 TGGGAGGGGGGGCGGCGGGAGGG - Intergenic
1121226111 14:92323136-92323158 GCAGCGGGCGGGAGGCGCCACGG + Intronic
1121453886 14:94026569-94026591 GGAGCGGGCAGGGGGCGCGGTGG + Intronic
1122231111 14:100306638-100306660 TGGGCGCGCGGGCGGGGCGCGGG + Intergenic
1122602930 14:102930235-102930257 TGGGCTGGCGGGCGGCGTGGCGG + Exonic
1122779165 14:104136399-104136421 TGAACGCGCGGGCGGGGCGGCGG + Intergenic
1124109419 15:26772847-26772869 TGGGCCGGCGGGCGGCGGGCAGG - Intronic
1124427043 15:29570938-29570960 CCGGCGGGCGGGCGGCGCGGCGG - Intergenic
1124652367 15:31483453-31483475 CGAGCGCGCGGTCGGCGCGTCGG + Exonic
1126767055 15:52019609-52019631 CGGGCGGGCGGGCGGCGGGCTGG + Intronic
1127165817 15:56243942-56243964 TGTGCGGGCCGCGGGCGCGACGG + Intergenic
1132111436 15:99105008-99105030 TGGGCGGGCGGCCTGGGCGAGGG - Intronic
1132178487 15:99733619-99733641 TAGGCGGGTGGGCGGGGCGAGGG - Intergenic
1132670055 16:1098820-1098842 TGAGTGCGCGGCCGGCGCGGAGG + Intergenic
1133024193 16:2980562-2980584 TGAGCGGCGGGGCGGCTCGGCGG - Intergenic
1133784504 16:8963764-8963786 GGAGCGGGCGGGCGACGGGCCGG + Intronic
1136519513 16:30786865-30786887 GGGGCGGGCGGGGGGCGCGGAGG - Intronic
1138591231 16:58000672-58000694 CGGACGGGCGGGCGGCGCGGGGG + Intronic
1139433806 16:66925133-66925155 GGAGCGGGCGGGAGCCGCGGTGG - Exonic
1139954316 16:70685988-70686010 GGGGCTGGCGGGCGGCGCGGGGG + Exonic
1141961533 16:87412401-87412423 TGGGCGGACGGGCGGCGTGGAGG + Exonic
1142287158 16:89176152-89176174 TGAGTGGGCGGGGGCCGGGAAGG - Intronic
1142293144 16:89201777-89201799 TGTGGGGGCGGGCGGTGTGAGGG + Intergenic
1142513151 17:410510-410532 GGAGCGGGAGGGCGGCGCCGCGG + Exonic
1143702588 17:8672401-8672423 TGAGGGTGAGGGCGGCGGGAGGG - Intergenic
1144756041 17:17681401-17681423 CGGGCGGGCGGGCGACGCGCGGG - Intergenic
1144952970 17:19004038-19004060 TGCCCGGGCAGGCGGCGCCATGG - Exonic
1145884425 17:28372269-28372291 GAAGCAGGCGGGCGGCGCGCGGG + Exonic
1146888281 17:36486864-36486886 GGAGCGGGCGGGCTGCTGGAGGG + Intronic
1148095903 17:45052086-45052108 TGGGCGGGAGGGCGGCCGGACGG + Intronic
1148130839 17:45261925-45261947 TGAGAGGGGGAGGGGCGCGAAGG - Intronic
1148146901 17:45371781-45371803 GGAGCGGGTGGGCGGCGGGCAGG - Intergenic
1148337560 17:46851724-46851746 GGAGCGGGCGGGGGGCGCGGCGG - Intronic
1148735488 17:49862659-49862681 TGAGGGGTGGGGCGGCGGGATGG - Intergenic
1152175154 17:78782334-78782356 GGCGCGGGCGGGCGGGGCGCGGG - Intergenic
1152208601 17:78990754-78990776 AGGGCGTGCGGGCGGCACGAGGG + Intergenic
1152413921 17:80146769-80146791 TGAGCGGGCGCGGGCCGCGGGGG - Intronic
1155284245 18:24271977-24271999 AGCGCGGGCGGGCGGCGGCAAGG + Intronic
1155392747 18:25352380-25352402 CGGCCGGGCGGGCGGCGCGAGGG - Intergenic
1157801786 18:50627043-50627065 TGAGTGGGCGGGGGGCGGGGTGG - Intronic
1159040597 18:63320097-63320119 CGGGCGGGCAGGCGGCGCGGAGG + Exonic
1159369989 18:67516940-67516962 TGAGCAGGCCGGCGGCGGGCGGG + Exonic
1159743943 18:72209216-72209238 TGAGCGGACGGCCGGCCCGCCGG + Intergenic
1160763677 19:797867-797889 GGAGCGGACGGGAGGCGGGAAGG - Intronic
1160813874 19:1026637-1026659 CTGGCGGGCGGGCGGCGGGACGG - Exonic
1160873156 19:1286064-1286086 CGAGCGGGCGGGCGGAGGGCGGG - Intergenic
1161064763 19:2232163-2232185 TGGGTGGGCGGGCGGCGCCTGGG + Exonic
1161494920 19:4581486-4581508 TGCGCGGGCGGGAGGCGCGAGGG + Intergenic
1161664648 19:5568017-5568039 TGTCCGGGCGGGCGGAGCGCGGG - Intergenic
1161911555 19:7198205-7198227 TGAGCGCGAGGGCGGCGCTGCGG - Intronic
1162339997 19:10086497-10086519 GGAGCGGCCGGGAGGCGCGGAGG + Intronic
1162909034 19:13839764-13839786 TGGGAGGGCGGGTGGCGCGGCGG - Intergenic
1163666701 19:18606898-18606920 CGGGCGGGCGGGCGGCGGGGAGG - Intronic
1166883047 19:45940526-45940548 TGAGAAGGCGGGCAGCGCGGCGG + Exonic
1167040602 19:47020772-47020794 CGCGCTGGCGGGCGGCGCGGGGG + Intronic
1167056029 19:47112194-47112216 AGAGCGGGCGAGCGCCGCGAGGG + Intronic
1167258321 19:48443760-48443782 TGCGCGCAGGGGCGGCGCGAGGG - Exonic
1167622797 19:50568446-50568468 GGAGCGGGCGGGCGGAGGGAGGG + Intergenic
1167641807 19:50686593-50686615 GGAGAGGGCGGGCGGAGGGAGGG + Intronic
1168536101 19:57172080-57172102 CGAGGGGGCGGGGCGCGCGAGGG + Intergenic
1168536108 19:57172097-57172119 CGAGGGGGCGGGGCGCGCGAGGG + Intergenic
1168536115 19:57172114-57172136 CGAGGGGGCGGGGCGCGCGAGGG + Intergenic
1168536122 19:57172131-57172153 CGAGGGGGCGGGGCGCGCGAGGG + Intergenic
1168536129 19:57172148-57172170 CGAGGGGGCGGGGCGCGCGAGGG + Intergenic
1168536136 19:57172165-57172187 CGAGGGGGCGGGGCGCGCGAGGG + Intergenic
1168536143 19:57172182-57172204 CGAGGGGGCGGGGCGCGCGAGGG + Intergenic
1168536150 19:57172199-57172221 CGAGGGGGCGGGGCGCGCGAGGG + Intergenic
1168614494 19:57826794-57826816 TGGGTGGGCGGGTAGCGCGACGG + Intronic
932341142 2:70963239-70963261 CGAGCGGGCGGGCCGCGTGGAGG + Exonic
932574491 2:72955277-72955299 TGAACGGGCGGGCGGCGGGCGGG - Intronic
934655872 2:96116622-96116644 GGAGCGGGCGGGAGGCGGGGCGG + Intergenic
935275795 2:101474385-101474407 GGAGCGCGCGGGGGGCGCGCGGG + Intronic
937325650 2:120988434-120988456 TGTGCGGGCGGCCGGCGCCCAGG - Exonic
942278230 2:174337609-174337631 CGAGCGAGCGGGAGGCGGGAGGG + Exonic
944428072 2:199604127-199604149 CGAGCGGGCGGGGTGCGCGCCGG - Intergenic
944743840 2:202635969-202635991 CGGGCGGGCGGGCGGGGCGTAGG - Intronic
946855442 2:223945339-223945361 TGGGCGGGCGGGGGACGCGCCGG + Exonic
947593077 2:231395963-231395985 TGGGCGGGCGGGCGCGGCGGCGG + Intronic
948468709 2:238164223-238164245 CAAGCGGGCGGGCGGCGGGGTGG - Intronic
949014530 2:241702017-241702039 TGCGCGGGCGGGCGGTGCCGCGG - Intronic
949032039 2:241801903-241801925 TGAGCCGGCGGGCAGCGCCACGG - Exonic
1168904600 20:1393014-1393036 TGAGCGGGCGGGCGGCGCGACGG + Exonic
1170889036 20:20364056-20364078 GGCCCGGGCGGGCGGCGGGAAGG - Intergenic
1173251527 20:41366442-41366464 AGCGCGGGCGGGCGGCGGGCGGG - Intronic
1175429662 20:58892098-58892120 TGAGCGGGCAGGCCGGGGGAGGG - Intronic
1175470220 20:59222280-59222302 TGCCCGGGCGGGCGGCGGGGTGG + Intronic
1175856156 20:62122173-62122195 TGAGCGGGCGGGGGGAGGGGTGG - Intergenic
1175932742 20:62500381-62500403 TGTGCGGGAGGGCGGGGGGAGGG + Intergenic
1179511893 21:41878996-41879018 CCGGCGGGCGGGCGGCGCGCAGG + Exonic
1179995810 21:44973568-44973590 GGAGAGGGTGGGCGGGGCGAGGG - Intronic
1179995837 21:44973654-44973676 GGAGAGGGTGGGCGGGGCGAGGG - Intronic
1180559184 22:16601837-16601859 CGGGCGGGCGGGCGGCGTGAGGG - Intergenic
1184086605 22:42269837-42269859 TGGGCGGGAGGGCGCCGCGCTGG - Intronic
1184146507 22:42614623-42614645 TGGGCGGGCGGTCGGGGCCACGG + Intronic
1184164799 22:42720836-42720858 CCGGCGGGCGGGCGGCGCGGCGG + Intronic
1184190866 22:42893514-42893536 TGAGCGGGCGCGCATCGAGAAGG - Exonic
949709861 3:6861152-6861174 TGAGCGCGAGCGCGGCGCGCCGG + Exonic
950510008 3:13420325-13420347 TGAGCGCGGGGGCGGGGCGAGGG + Intergenic
951613999 3:24521943-24521965 TGAGCGGGCGGGCGAGGAGCGGG + Intergenic
953618162 3:44510529-44510551 TGAGCGGCCCGGCGGGGCGCGGG - Intronic
954150949 3:48656733-48656755 GGAGCCTGCGCGCGGCGCGAGGG - Exonic
954617196 3:51975168-51975190 TGAGCGGGCGGGCCCCGCCCAGG - Exonic
956628034 3:71286312-71286334 TGTGCTGGCGGGCGGGGCGGGGG - Intronic
962575494 3:136752047-136752069 CGAGCGGGCGGGCCGGGCGCGGG - Intronic
963081935 3:141402523-141402545 CGATCGGGCTGGCGGCGCCACGG - Intronic
963778523 3:149464130-149464152 TGGGTGGGCAGGCAGCGCGAGGG + Intergenic
964771210 3:160225761-160225783 TGAGCTGGCGTGCGGCGAGCGGG + Exonic
968063981 3:195748022-195748044 GGAGGGGGCGGGCGGAGCGCGGG - Intronic
968556544 4:1248835-1248857 CGCGCGGGCGGGGGGCGCGGGGG - Intronic
968573690 4:1355247-1355269 TGAGTGGGCAGGCGGCGAGCGGG + Intronic
968651939 4:1763600-1763622 AGGGCGGGCGGGCGGGGCGCCGG + Intergenic
968701223 4:2059130-2059152 GGGGCGGCCGGGCAGCGCGAGGG - Intergenic
976146231 4:82044555-82044577 AGAGCGGGCGGCCGGGGCGGGGG + Intergenic
976812439 4:89111416-89111438 CGAGCGGGCGGGAGGGGCGGGGG - Intergenic
990323190 5:54649288-54649310 TGAGCGGGCGGCCGGCCTGCTGG - Intergenic
990545599 5:56817019-56817041 TCAGCGGGCGGCCCGCGCCAGGG - Intronic
992529161 5:77638821-77638843 CGAGCGGGCGGGCGGAGTGGGGG - Exonic
995008682 5:107232789-107232811 TGGGCGGGTGGGGGGCGGGAAGG - Intergenic
1001395931 5:171419693-171419715 TGAGCCGGCGGGCGCCCAGACGG + Exonic
1001529951 5:172454599-172454621 GGGGCGGGCCGGCGGCGCGGGGG - Intergenic
1002259888 5:177985653-177985675 CGGGCGGGCGGGCGGCGAGAAGG + Intergenic
1002430690 5:179202272-179202294 GGAGGGGGCAGGCGGCGCCAAGG - Intronic
1002695446 5:181085474-181085496 GGAGCGGGCGGGCTGGGGGAGGG - Intergenic
1003290772 6:4776601-4776623 AGTGCGGGCCGGCGGCGCGGCGG - Exonic
1003624201 6:7727480-7727502 TGAGCGGGTGCGCGGCGCCCGGG - Exonic
1004614963 6:17281090-17281112 GAAGCGGGCGGGGGGCGCGGCGG - Intergenic
1006634469 6:35452289-35452311 TGAACGTGAGGCCGGCGCGAGGG - Intergenic
1007465856 6:42050502-42050524 TGCGCGAGCGCGGGGCGCGATGG - Exonic
1009396976 6:63211519-63211541 CGAGCGGGCGGGCAGCGCGACGG - Exonic
1010249875 6:73696299-73696321 TGGGCGCGCGGGGGGCGCGCGGG + Intronic
1013576019 6:111483738-111483760 AGGGCGGGCGGGCGGCGGAACGG + Intergenic
1014079572 6:117270970-117270992 CGAGCCGGCGGGCGCCGCGTGGG + Exonic
1018046413 6:159969578-159969600 TGCGCAGGCGGGGGGCGCGGGGG + Intronic
1019298219 7:290099-290121 GAAGCCGGCGGGCGGCGCGGAGG + Intergenic
1019693965 7:2434156-2434178 TGAGCGTGCGGGCGCCGGGAGGG + Exonic
1020262243 7:6536912-6536934 TGGGCGGGGGGGCGGCGGGGAGG + Intronic
1023810359 7:43906653-43906675 GGAGCGGGCGGGCGGCCGGCGGG - Exonic
1023858453 7:44201104-44201126 TGGGCAGGCGGGCGGCCTGAGGG + Exonic
1024252883 7:47519683-47519705 TGAGCTGGCTGGAGGGGCGAGGG + Intronic
1025916994 7:65873591-65873613 GGAGCGGCCGAGCGGGGCGAGGG + Intronic
1027001555 7:74657933-74657955 CGAGCGGACGGGAGGCGAGAGGG - Intronic
1027374634 7:77537493-77537515 CGGGCGGGCGGGCGGCGGGGGGG + Exonic
1028985629 7:97006459-97006481 TGAGCGGGCGGGCGGGGTAGGGG - Intronic
1029449592 7:100633384-100633406 CGCGCGGGCGGGGGGCGCGCGGG - Intronic
1032174557 7:129612301-129612323 CGGGCGGGCGGGCGGCGCGGTGG + Intronic
1034618101 7:152436092-152436114 CGGGCGGGCGGGCGGCGTGAGGG + Intergenic
1040080105 8:43276202-43276224 TGTGGGGGCGGGCGGGGTGAGGG + Intergenic
1042533216 8:69834815-69834837 TGAGCGCCCGGGCAGCGCGGCGG - Intronic
1044832190 8:96261572-96261594 GGAGCCGGCGTGCGGCGCGGCGG - Exonic
1049090782 8:140511929-140511951 GGAAGGGGCGGGCGGAGCGAAGG - Intronic
1051414880 9:16828983-16829005 TGAGCAGGGGGGCGGCGGGGTGG + Intronic
1052968792 9:34363729-34363751 TGAGCAGGATGGCGGCGGGAGGG - Intergenic
1052982275 9:34458180-34458202 TGAGGGGGCGGGCGGCGGGCAGG - Intronic
1060991952 9:127854458-127854480 GGAGCAGGCGGCCGGAGCGACGG + Exonic
1062413065 9:136434444-136434466 TGAGCGGGAGGGCGGCCAGCGGG - Intronic
1062462015 9:136666068-136666090 CGGGCGGGCGGGCGGCGCGGCGG + Intronic
1186669847 X:11757878-11757900 AGAGCGGGCGCTCGGGGCGACGG + Intergenic
1187900649 X:24024930-24024952 TGGGCGGTCGGGCGCCGGGACGG + Exonic
1190298682 X:49043355-49043377 TGCGCGGGCGGGCGGCGTCGGGG + Exonic
1193123987 X:77851895-77851917 TCAGGGGGCGGGCGGCGGGGCGG - Intronic
1196765169 X:119236275-119236297 TGAGCGAGCGAGTGGCGCGCGGG - Exonic
1197754435 X:129984103-129984125 GGGGCGGGCGGGCGGGGCGTGGG + Intronic
1198398931 X:136251265-136251287 TGAGCGGGCGGGTGGCTCCCGGG - Intronic
1199772590 X:150984024-150984046 CGGGCGGGCGGGAGGCGAGAGGG - Intronic