ID: 1168904603

View in Genome Browser
Species Human (GRCh38)
Location 20:1393023-1393045
Sequence GGGCGGCGCGACGGGCGGCG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 939
Summary {0: 1, 1: 1, 2: 5, 3: 77, 4: 855}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168904593_1168904603 6 Left 1168904593 20:1392994-1393016 CCCATGGCGGCGGCGGACGCTGA 0: 1
1: 0
2: 2
3: 2
4: 45
Right 1168904603 20:1393023-1393045 GGGCGGCGCGACGGGCGGCGTGG 0: 1
1: 1
2: 5
3: 77
4: 855
1168904594_1168904603 5 Left 1168904594 20:1392995-1393017 CCATGGCGGCGGCGGACGCTGAG 0: 1
1: 0
2: 3
3: 17
4: 151
Right 1168904603 20:1393023-1393045 GGGCGGCGCGACGGGCGGCGTGG 0: 1
1: 1
2: 5
3: 77
4: 855
1168904591_1168904603 14 Left 1168904591 20:1392986-1393008 CCTGCACTCCCATGGCGGCGGCG 0: 1
1: 3
2: 0
3: 11
4: 87
Right 1168904603 20:1393023-1393045 GGGCGGCGCGACGGGCGGCGTGG 0: 1
1: 1
2: 5
3: 77
4: 855
1168904589_1168904603 17 Left 1168904589 20:1392983-1393005 CCACCTGCACTCCCATGGCGGCG 0: 2
1: 2
2: 1
3: 6
4: 113
Right 1168904603 20:1393023-1393045 GGGCGGCGCGACGGGCGGCGTGG 0: 1
1: 1
2: 5
3: 77
4: 855

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168904603 Original CRISPR GGGCGGCGCGACGGGCGGCG TGG Exonic
900091750 1:923866-923888 CCCCGGCGCGGCGGGCGGCGCGG - Intergenic
900145550 1:1157461-1157483 GGGCGGGGCTGCGGGCGGGGCGG - Intergenic
900159668 1:1217486-1217508 GGGCGGCGCGGGGCGCGGCCGGG + Exonic
900176470 1:1293519-1293541 GGGCGTCGGGCCGGGCGGGGTGG + Exonic
900204949 1:1427731-1427753 GGGCGCCCCGGGGGGCGGCGGGG - Exonic
900226287 1:1535010-1535032 GGGCGGCGAGGCGCGCGGCCCGG - Intergenic
900342189 1:2194544-2194566 GGGTGGGGCGACGGGCGTGGGGG + Intronic
900410585 1:2510845-2510867 GGGCAGCGTGACGGGCAGCAGGG - Intronic
900658703 1:3772563-3772585 GGGCGGGGCGAGAGGGGGCGGGG - Intergenic
900786929 1:4655230-4655252 CGGCGGCGCGCCGGCCGGCATGG + Exonic
901022209 1:6261142-6261164 GGGCGGGCCGAGGGGCGGTGCGG - Intergenic
901086327 1:6614180-6614202 GGGCGGCGCTCCGGGCGACCGGG - Intronic
901086711 1:6615127-6615149 GGCCGGGGGGGCGGGCGGCGTGG + Intronic
901489408 1:9589063-9589085 GGGCGGCGCAGAGGGCCGCGTGG - Intronic
902214293 1:14924588-14924610 GCGGGGCGGGGCGGGCGGCGCGG + Intronic
902336733 1:15758607-15758629 GGGCGGCGCGGGGCGCGGCCGGG + Intronic
902444390 1:16452769-16452791 GGGCGGGGCGGCGGGCGGGGGGG - Intronic
902586176 1:17439743-17439765 GCGCGGCGGGGCGGGAGGCGCGG + Intergenic
903184741 1:21622601-21622623 GGGCGGCACGGCGCGGGGCGGGG + Intronic
903199160 1:21719187-21719209 GGGCGGAGGGACGGGGGGCGGGG + Intronic
903413786 1:23168150-23168172 GGGCCGCGGGCCGGGCGGGGAGG - Intronic
903466391 1:23554971-23554993 GGGCGCCGGGAGGGGCGGGGCGG + Intergenic
903468398 1:23568214-23568236 GGGCTGCGCGGGGGGCGGAGAGG - Intergenic
903573415 1:24322583-24322605 CGGCGGCGGCCCGGGCGGCGCGG + Intronic
903634001 1:24799660-24799682 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
903750161 1:25616657-25616679 GGGCCGCGCGTCCGGGGGCGGGG - Intergenic
903925227 1:26826914-26826936 GGCGGGGGCGGCGGGCGGCGCGG - Exonic
904006470 1:27365921-27365943 GGGCGGGGCGGGGAGCGGCGCGG - Intronic
904029984 1:27527891-27527913 GGGCGGCGCTGGGGCCGGCGAGG - Intergenic
904077558 1:27853432-27853454 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
904077721 1:27853805-27853827 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
904077812 1:27854003-27854025 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
904078033 1:27854507-27854529 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
904181369 1:28668904-28668926 GGGCCGCGCGGCGGCCGGCGAGG + Intronic
904211221 1:28887772-28887794 GGCTGGCGCGACGGCCGGGGGGG - Intronic
904245137 1:29182014-29182036 GGGCGCGCCGACGTGCGGCGGGG + Intergenic
904542010 1:31239640-31239662 GCTGGGCGCGCCGGGCGGCGGGG + Intergenic
904751064 1:32741765-32741787 GGGCGGGGCGCAGGCCGGCGGGG - Intergenic
904837780 1:33349971-33349993 GGGCCGCGGGAGGGGCGGGGCGG + Intronic
906044501 1:42817320-42817342 GGGCCGCGCGCCGGGGGGAGGGG + Intronic
906299887 1:44674218-44674240 GGGCGGCCCGAGGGAGGGCGGGG + Intronic
906517508 1:46448320-46448342 GGGAGGCGCGGCAGGCGGGGCGG - Intergenic
906627042 1:47333885-47333907 GGCCGGCGCGGCGCGGGGCGGGG - Exonic
907069180 1:51518929-51518951 CAGCGGCGCGGAGGGCGGCGAGG + Intronic
907160539 1:52365969-52365991 GGGCGGCGCGTCCCGCAGCGCGG - Intronic
907188989 1:52633259-52633281 GGCAGGCGGGGCGGGCGGCGGGG - Intergenic
907767359 1:57424148-57424170 GGCGGGCGCGGGGGGCGGCGGGG - Intronic
907880700 1:58546784-58546806 GGGCGGAGCGAAGGGCGCCCCGG - Exonic
911208580 1:95117392-95117414 GGCGGGCGCGACGGCCGCCGCGG + Exonic
911486487 1:98512391-98512413 GGGCGGCTGGCCGGGCGGCGGGG + Intergenic
911725553 1:101238008-101238030 GGGGGGCGCGGGGGGAGGCGGGG + Intronic
912174774 1:107141537-107141559 GGGTGGGGCGGGGGGCGGCGGGG - Intronic
912454393 1:109788056-109788078 GGGCGGCGCGGGGGGAGGCTGGG + Intergenic
912808351 1:112774347-112774369 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
912881959 1:113424193-113424215 GGGCGGGGGGGCAGGCGGCGGGG - Intronic
912993427 1:114510899-114510921 GGCCGGCGCTGAGGGCGGCGCGG - Exonic
914197335 1:145454426-145454448 GGGCGGCGGGGCCGGCGGGGCGG - Intergenic
914255328 1:145957772-145957794 GGGCGGTGCGGGAGGCGGCGGGG + Exonic
914392248 1:147233432-147233454 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
914428461 1:147599777-147599799 GGGCGGGGCGGCGGGAGGTGCGG + Intronic
914869123 1:151458819-151458841 GCGCGCCGCGGCGGGCGCCGGGG + Intronic
914875577 1:151511163-151511185 GGGCGGGGCGGCGAGGGGCGCGG - Intronic
915127921 1:153678891-153678913 GGGGGGCGCGCAGGGCGCCGCGG - Exonic
915165619 1:153946356-153946378 TGGCGGGCCGGCGGGCGGCGGGG + Exonic
915302845 1:154961502-154961524 GGGCGGCGCAGGGGGCGGTGCGG + Exonic
915485378 1:156216645-156216667 GGGCGGCGGGGAAGGCGGCGAGG + Intronic
915531004 1:156502018-156502040 GGGAGGCGGGAGGGGAGGCGAGG - Intergenic
915559223 1:156676758-156676780 GGGAGGCCCGCGGGGCGGCGCGG + Exonic
915572364 1:156751514-156751536 GGGCCGCGCGAGGGCCGGAGCGG - Intronic
916174137 1:162023774-162023796 GCGCGCCGGGACGGGCGGCGGGG + Exonic
916179300 1:162070071-162070093 GGGCGCGGCGACGCGTGGCGGGG - Exonic
916651742 1:166839799-166839821 GGGAGGCGGGCCGGGCGGAGGGG + Intronic
917375552 1:174349029-174349051 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
917375630 1:174349206-174349228 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
918255099 1:182741337-182741359 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
919640981 1:200042908-200042930 GGCCGCCACGACGCGCGGCGCGG - Intronic
920367728 1:205456922-205456944 GGGGGGCGCGGAGGGCGGGGTGG - Intergenic
920630241 1:207645223-207645245 GGGAGGCGCCATGAGCGGCGCGG - Exonic
920805620 1:209231585-209231607 GGGCGGGGCGCAGGGCGGCGCGG - Intergenic
921237977 1:213151500-213151522 GGGCGGCTGGACGGGCAGAGGGG + Intronic
922925149 1:229342202-229342224 CGCCGGCTCTACGGGCGGCGGGG + Exonic
922958615 1:229626002-229626024 GGGCGGCGGGGCGCGGGGCGCGG - Exonic
923107916 1:230868577-230868599 GGGCGGGGCTCCGGGTGGCGCGG - Exonic
923490296 1:234478471-234478493 GGGCGGCGCTGCGGGCCGTGTGG - Exonic
923631056 1:235649825-235649847 GGGAGGCGCGGCGCGGGGCGGGG - Exonic
923711001 1:236387207-236387229 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
923744316 1:236686445-236686467 CGGCCACGTGACGGGCGGCGCGG + Exonic
923785094 1:237058796-237058818 GGGCGGGGGGCCGGGGGGCGGGG + Intronic
924539793 1:244970473-244970495 CGGGGTCGCGGCGGGCGGCGAGG - Exonic
924539848 1:244970622-244970644 GGGCGGAGCGGCGGGCCGGGCGG - Exonic
1062874066 10:931440-931462 GGGCGGCCGGTCGGGCGGGGCGG - Exonic
1063418230 10:5890281-5890303 GGGCTGAGCGGCCGGCGGCGCGG + Intronic
1063438856 10:6055811-6055833 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
1063664535 10:8053573-8053595 GGGCGGGGCGAGCGGGGGCGGGG - Intergenic
1063944637 10:11165034-11165056 GGGCGGTGGGGCGGGGGGCGGGG + Intronic
1064086474 10:12349501-12349523 GGGGAGCGCGGCGGGCGGCAGGG + Exonic
1064552777 10:16520443-16520465 GGGCGGCGGGGAGGGCGGGGAGG - Intronic
1065012267 10:21430586-21430608 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
1066047118 10:31603708-31603730 GGGCGGGGCCCCGGGCGACGGGG - Intergenic
1066464406 10:35640349-35640371 GGGCGGCGCGGCGGCGGGCGCGG - Exonic
1068783266 10:60944083-60944105 GGGCGGCGCGCCGCGCGCAGGGG - Exonic
1069438554 10:68407344-68407366 GAGCGGCGCCCCGGGCGGGGCGG + Intergenic
1069741013 10:70687035-70687057 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
1069836815 10:71314514-71314536 GGGCGGTGCGACGGGCGGAGCGG - Intergenic
1070162524 10:73874614-73874636 GCGGGGCGGGGCGGGCGGCGCGG - Intergenic
1070257598 10:74825419-74825441 GGGCGGGCTGGCGGGCGGCGCGG + Intergenic
1070800666 10:79242978-79243000 GGGCGGCGGGCTGGGGGGCGGGG + Intronic
1070877202 10:79825810-79825832 GGGCGGCGGGACGGTGGGTGGGG + Intergenic
1071643698 10:87341854-87341876 GGGCGGCGGGACGGTGGGTGGGG + Intergenic
1072421115 10:95291108-95291130 GGGCGGGAGGACGGGCGGGGCGG - Intergenic
1072648838 10:97277020-97277042 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1072999857 10:100277667-100277689 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1073386386 10:103129636-103129658 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1073386515 10:103129941-103129963 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1074152044 10:110767191-110767213 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
1074377501 10:112951650-112951672 GCGGGGCCCGGCGGGCGGCGCGG - Intronic
1074772438 10:116742640-116742662 GGGCGGGGCGCCGGGCGGGCCGG - Intergenic
1075699840 10:124462059-124462081 GGGCGGGGCGGCAGGGGGCGGGG + Intronic
1077008304 11:369353-369375 AGGCGGGGCGAGGGGAGGCGGGG - Intergenic
1077008524 11:369991-370013 GGGCGGCGCGGGGGGCGCGGGGG + Intronic
1077051410 11:568569-568591 GGGCCGCGCGGCGGTGGGCGGGG - Intergenic
1077079932 11:720778-720800 GGGCGGGGCGCGGCGCGGCGGGG - Intronic
1077228952 11:1450243-1450265 GGGCGGCTCGGGGGGCGGTGGGG - Intronic
1077404605 11:2377483-2377505 GGGCGGCGGGCGGGCCGGCGCGG - Exonic
1077581858 11:3422376-3422398 GGGCGGCGGGGCGAGCGGAGAGG - Intergenic
1078090776 11:8263196-8263218 GGGCGGCGCGCTGGGGGCCGGGG - Intronic
1079039661 11:17050209-17050231 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1080383974 11:31799735-31799757 GGGCGGCGCGCGGGACTGCGAGG - Intronic
1080606576 11:33869396-33869418 AGGCGGGGTGCCGGGCGGCGGGG + Exonic
1080836292 11:35944017-35944039 GGACGGCGCGGCGAGGGGCGGGG + Intronic
1081699978 11:45146813-45146835 GAGCGGCCCGGCGGGCGGCTCGG - Intronic
1081774049 11:45665698-45665720 GGGCGGCGCGGGGGGCGGGAAGG - Intergenic
1081872995 11:46391682-46391704 GGCCGGCGGGGCGGGCGGCCGGG + Intergenic
1083171176 11:60924750-60924772 GGCCGGGGCGAGGGGCGGCCGGG + Intronic
1083382724 11:62279718-62279740 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
1083442839 11:62688248-62688270 GCGCGGCGGGTCGGGCGGCTGGG + Exonic
1083609675 11:63998923-63998945 GGGCGGGCCGTGGGGCGGCGCGG + Intronic
1083645629 11:64171322-64171344 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1083747707 11:64744854-64744876 GGGCGGGGCGGCGGGGAGCGGGG - Intronic
1083816377 11:65134570-65134592 CGGCGGCGCGGGGCGCGGCGTGG + Intergenic
1083885634 11:65572300-65572322 GGGCGGGGCGGGGCGCGGCGGGG + Intronic
1084238767 11:67805193-67805215 GGGCGGCGGGGCGAGCGGAGAGG - Intergenic
1084385721 11:68841717-68841739 GGGCGGCCCTGCGGGCTGCGGGG - Intronic
1084516977 11:69642659-69642681 GGGCCGCGGAACGGGCCGCGGGG - Intronic
1084517015 11:69642761-69642783 GGGCGGCGTGCGCGGCGGCGCGG - Intronic
1084888131 11:72223846-72223868 GCGGGGCGGGGCGGGCGGCGCGG + Intronic
1085011161 11:73142408-73142430 GGGCGCTGCGCCGCGCGGCGAGG - Intergenic
1085043999 11:73343085-73343107 TGGCGGCGGGGCGGGGGGCGGGG - Intronic
1085111893 11:73896956-73896978 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
1085566575 11:77520007-77520029 GGGTGGAGCCACGGGCGGAGGGG - Intronic
1087057059 11:93946695-93946717 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1087118002 11:94544548-94544570 GGGCGGCGCGGGTGGCGCCGAGG + Exonic
1089078914 11:115760353-115760375 GGGCGGCGGGAGGGTGGGCGTGG - Intergenic
1089346977 11:117796967-117796989 GGGTGGCGCGGCTGGCGGCGAGG - Intronic
1089622194 11:119728566-119728588 GTCCGGCGAGAGGGGCGGCGAGG + Exonic
1090238259 11:125165060-125165082 GAGCAGCGCGAGGGGCGGCGAGG + Intronic
1090323317 11:125863927-125863949 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
1091124478 11:133082733-133082755 CAGCGGCGGGACGGGCCGCGGGG - Intronic
1091616189 12:2052895-2052917 GGGCGGGCGGGCGGGCGGCGCGG + Intronic
1091718118 12:2794516-2794538 GGCCGTCACCACGGGCGGCGTGG - Intergenic
1091759479 12:3077462-3077484 GGCCCGGGCGGCGGGCGGCGAGG + Intronic
1092270451 12:7018955-7018977 GGGGCGCGCGAAAGGCGGCGCGG - Intronic
1092409456 12:8242825-8242847 GGGCGGCGGGGCGAGCGGAGAGG - Intergenic
1094041113 12:26122623-26122645 CGGCGGCCCGGGGGGCGGCGCGG - Exonic
1094338966 12:29389535-29389557 GGGAGACGCGGCGGCCGGCGGGG - Intergenic
1095068548 12:37814444-37814466 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1096022090 12:48332670-48332692 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1096674379 12:53218778-53218800 GGGCGGGGCGGCGGGCGCTGGGG - Intronic
1096771562 12:53939011-53939033 AGGCGGCGGCACGGGCGGAGCGG + Exonic
1096981219 12:55729028-55729050 GGGCCGCGCGGCAGGCGGGGCGG - Intronic
1097127985 12:56789483-56789505 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1097155010 12:57006241-57006263 GGGCCAAGCGAGGGGCGGCGGGG + Intronic
1097155103 12:57006554-57006576 GCGCTGCGGGCCGGGCGGCGGGG - Intergenic
1097190406 12:57216829-57216851 GAGCGGCGGGAGCGGCGGCGCGG - Exonic
1097675914 12:62602758-62602780 TGGCGGCGCGGGGGGCGGCCTGG + Exonic
1097929424 12:65168209-65168231 GGGAGGCGGGGCGGGGGGCGGGG - Intergenic
1097990256 12:65825585-65825607 GGGAGCCGCGGCGGGCGGCCCGG + Intronic
1098255353 12:68610788-68610810 GGGCGGGGCGAGGGGAGCCGAGG - Intergenic
1100995059 12:100294410-100294432 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
1101393523 12:104323784-104323806 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
1102186225 12:110950746-110950768 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1102293957 12:111723298-111723320 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
1102310630 12:111842146-111842168 GGGCGGCAGGAGGGGCGGCCTGG + Intronic
1102578691 12:113872761-113872783 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1102578772 12:113872939-113872961 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1102681324 12:114692487-114692509 GGGCGGGGCGCGGCGCGGCGCGG + Intergenic
1102681329 12:114692509-114692531 GCGCGGCGCGGCGGGCTGCCCGG + Intergenic
1103591307 12:121993857-121993879 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1103591444 12:121994165-121994187 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1103641756 12:122357570-122357592 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1103918927 12:124389555-124389577 GGGTGGGGGGACGGGCGGCGGGG - Intronic
1104857447 12:131908771-131908793 GGTTGGCGCGGCGGCCGGCGGGG - Exonic
1104887417 12:132118844-132118866 GAGCTGCGCGGCGTGCGGCGTGG - Intronic
1105556125 13:21448477-21448499 GGGCGGCTGGCCGGGCGGCGGGG - Intronic
1107953314 13:45485386-45485408 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
1108330485 13:49378775-49378797 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1108330541 13:49378904-49378926 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1108330617 13:49379082-49379104 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1108484474 13:50910193-50910215 GGGCGGCGCGCCCGGGGTCGCGG - Intronic
1108577738 13:51804028-51804050 AGGCGGCGCGGCGGGGCGCGGGG - Intronic
1108608772 13:52064364-52064386 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1112216268 13:97434141-97434163 TGGAGGCGCGAGGGGCGGGGCGG + Intergenic
1112505128 13:99970755-99970777 GCGCGGCGCGAAGGGCGGTTCGG + Exonic
1112507857 13:99985577-99985599 CGGCGGCGGGGCGGGCGGCGGGG + Exonic
1113413604 13:110110984-110111006 GGGCTGCGTGGCGGGCTGCGTGG + Intergenic
1113542011 13:111115901-111115923 GGTCGGGGGGAGGGGCGGCGCGG + Intronic
1113654100 13:112057406-112057428 GGGAGCCGCGAGGGGCGGGGAGG - Intergenic
1113656733 13:112072526-112072548 GGACGGAGCGAGGGCCGGCGGGG + Intergenic
1113841579 13:113364207-113364229 GGGCGGGGGGAGGGGCGGCTGGG + Intergenic
1113874266 13:113584819-113584841 GTGCGGAGCGCGGGGCGGCGCGG - Exonic
1115217256 14:31026062-31026084 GAACGGAGCGGCGGGCGGCGGGG - Exonic
1116191485 14:41673423-41673445 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
1116273873 14:42805761-42805783 GGGCGGCGGGAGGAGCGGGGGGG + Intergenic
1117157032 14:52951254-52951276 GGGCGGGGCGGCGTGGGGCGGGG + Intronic
1117424639 14:55580905-55580927 GGGCAGCGGGAGGGGCGCCGGGG - Intronic
1118220951 14:63853715-63853737 GGGCGCGGGGACGGGCGGCCCGG + Intronic
1118610034 14:67532992-67533014 GGGCGGCAGGGAGGGCGGCGGGG - Intronic
1119539327 14:75428276-75428298 GGGCGCCGGGACGGGCGGGGCGG + Intronic
1119742945 14:77026194-77026216 CGACGGCGCGGCGGGCGGCAAGG + Exonic
1120881289 14:89416999-89417021 GCCCGGGGCGGCGGGCGGCGGGG + Intronic
1121042146 14:90758333-90758355 GGGCGGGGCGGGGCGCGGCGGGG + Intronic
1121052444 14:90828301-90828323 GGGCGGAGCGAGGCGGGGCGAGG + Intergenic
1121142792 14:91557317-91557339 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1121308665 14:92923277-92923299 GGGCGGCTGGACTGGCGGCCGGG - Exonic
1121342774 14:93115328-93115350 GCGGGGCGCGGCGGGCGGCCGGG + Intronic
1122265789 14:100546337-100546359 GGGCGGGGCGAGGGCCGGGGTGG - Intronic
1122265798 14:100546354-100546376 GGGCGGGGCGAGGGCCGGGGCGG - Intronic
1122265807 14:100546371-100546393 GGGCGGGGCGAGGGCCGGGGCGG - Intronic
1122265816 14:100546388-100546410 GGGCGGGGCGAGGGCCGGGGCGG - Intronic
1122265825 14:100546405-100546427 GGGCGGGGCGAGGGCCGGGGCGG - Intronic
1122265834 14:100546422-100546444 GGGCGGGGCGAGGGCCGGGGCGG - Intronic
1122265843 14:100546439-100546461 GGGCGGGGCGAGGGCCGGGGCGG - Intronic
1122265852 14:100546456-100546478 GGGCGGGGCGAGGGCCGGGGCGG - Intronic
1122265861 14:100546473-100546495 GGGCGGGGCGAGGGCCGGGGCGG - Intronic
1122445026 14:101761805-101761827 CGGGGGCGCGACGGCCGGGGCGG + Exonic
1122602887 14:102930110-102930132 CGGCGGGGCGAGGCGCGGCGGGG - Intronic
1122620948 14:103057440-103057462 GGGCGGGGCTGAGGGCGGCGGGG - Exonic
1122688806 14:103522133-103522155 GGGCTGCGTGGCGGGCGACGAGG - Exonic
1122917315 14:104865174-104865196 GGGCGGCGCGGGGTGCGGCGCGG + Intergenic
1123004467 14:105314713-105314735 GGGCGGGGCGCCGGGCGGGGCGG + Exonic
1124696659 15:31869986-31870008 CGGCGGTGCGCCGGGCCGCGGGG + Intronic
1124696858 15:31870694-31870716 GAGGGGCGCGAGGGGCGGAGCGG - Intronic
1124957226 15:34367319-34367341 GGGCGCCGCGGCGGGCGCGGAGG - Intergenic
1124971126 15:34490500-34490522 GGGCGGCGGGGGCGGCGGCGGGG - Intergenic
1126035004 15:44537367-44537389 GGGCGGCGGCACTGCCGGCGGGG + Exonic
1126109406 15:45166929-45166951 GGCTGGCGGGACGGGCCGCGGGG - Intergenic
1127165832 15:56243979-56244001 GCACGGCGCGGAGGGCGGCGCGG + Intergenic
1127819695 15:62644147-62644169 GGGCGGGGCGGTGGGTGGCGCGG - Intronic
1128139221 15:65286886-65286908 CGGCGGCGCGGCGGGAGGCGGGG - Intronic
1129221621 15:74134734-74134756 AGGCGGCGAGGCGGGCGGCGAGG + Exonic
1129274089 15:74434017-74434039 GGGCGGGGGGAGGGGCGGGGTGG - Exonic
1129287961 15:74541137-74541159 GGGCGGGGCCACAGGGGGCGGGG - Intergenic
1129334294 15:74843192-74843214 GGGCGGCGCTGGGGGCAGCGTGG - Exonic
1129644830 15:77420195-77420217 GGGCGGCGCGCGGGGCCGAGAGG - Intergenic
1129823590 15:78620374-78620396 GGGCAGGGCGACGGGCAGCGCGG + Intronic
1130010901 15:80152630-80152652 GGGCGGGGCGAGGGGAGGGGCGG + Intronic
1130010955 15:80152765-80152787 GGGCGGGGCCAGGGGCGGGGCGG + Exonic
1130040871 15:80404461-80404483 GGGGCGCGGGAGGGGCGGCGCGG - Exonic
1131001251 15:88941535-88941557 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1131001329 15:88941713-88941735 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1131515352 15:93073167-93073189 GGGGCGCGCGGGGGGCGGCGCGG - Intronic
1131888645 15:96948012-96948034 GCGCGGGGAGGCGGGCGGCGCGG - Intergenic
1132055343 15:98647747-98647769 GGGGCCCGCGAGGGGCGGCGGGG + Intergenic
1132128424 15:99251422-99251444 GGGCGGAGCGCCGGGCGTCGGGG - Exonic
1132275386 15:100559076-100559098 GGGCCGCGCGCTGGGAGGCGAGG - Intergenic
1132365090 15:101251464-101251486 CGGCGGCCCGGCGGGCGGAGCGG - Exonic
1132426810 15:101724554-101724576 GGGCGGGGCGCTGGGCGGGGAGG + Exonic
1132480667 16:164877-164899 GGGCGGGGCGCGGGGCGGGGCGG + Intronic
1132480697 16:164935-164957 GGGCGGGGCGCGGGGCGGGGCGG + Intronic
1132498861 16:275956-275978 GCGCGGCGCGGCGCGGGGCGGGG - Intronic
1132512649 16:352205-352227 GGGCAGCGGGACTGGCGGCGCGG - Intronic
1132552947 16:560753-560775 GGGGGGCGCGGGGGGCGGCCGGG + Intronic
1132584603 16:700759-700781 GGGTGGCGCGCCGGCCGGCGGGG - Intronic
1132588152 16:715136-715158 GGGCTGCGCGGCAGGCGGAGCGG + Exonic
1132683482 16:1153088-1153110 GGGCTGAGCGGCGGGGGGCGGGG - Intergenic
1132741338 16:1414768-1414790 GGGCGGGGCCGCGGGGGGCGTGG - Intergenic
1132741365 16:1414822-1414844 GGGCGGGGCTGCGGGGGGCGCGG - Intergenic
1132776923 16:1599662-1599684 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1132779518 16:1614818-1614840 CTGCGGCGCGCCGGGGGGCGCGG - Exonic
1132875706 16:2135945-2135967 GGACGGGGCGAGGGGGGGCGGGG + Intergenic
1132885135 16:2179144-2179166 GGGCGGCGTACCGGGCGGCTTGG + Exonic
1133188477 16:4116456-4116478 CGGCTGGGCGAGGGGCGGCGCGG - Intergenic
1133350432 16:5097619-5097641 GGGCGGCGGGGCGAGCGGAGAGG - Intronic
1133950298 16:10385917-10385939 GGGCGGGGCGAAGGGTCGCGAGG - Intronic
1134082669 16:11335740-11335762 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
1134519280 16:14911408-14911430 GGACGGGGCGAGGGGGGGCGGGG - Intronic
1134706950 16:16310063-16310085 GGACGGGGCGAGGGGGGGCGGGG - Intergenic
1134960590 16:18402061-18402083 GGACGGGGCGAGGGGGGGCGGGG + Intergenic
1136160652 16:28416896-28416918 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
1136160706 16:28417026-28417048 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
1136160786 16:28417203-28417225 GGGCGGCTCGCCGGGCAGGGGGG - Intergenic
1136165201 16:28448805-28448827 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
1136165225 16:28448855-28448877 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
1136197749 16:28666165-28666187 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1136197773 16:28666215-28666237 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1136202181 16:28697797-28697819 GGGCGGCTCGCCGGGCAGGGGGG + Intronic
1136202262 16:28697975-28697997 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
1136202316 16:28698104-28698126 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
1136207899 16:28737801-28737823 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1136214087 16:28780302-28780324 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1136214111 16:28780352-28780374 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1136258823 16:29060226-29060248 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1136258846 16:29060276-29060298 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1136413894 16:30092033-30092055 GGGCTGCGAGGCCGGCGGCGCGG + Intergenic
1136428185 16:30183191-30183213 GGGGGGCGCGAGGGGCGCGGGGG - Intronic
1137244891 16:46694467-46694489 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
1137303963 16:47181412-47181434 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1137303990 16:47181463-47181485 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1137304042 16:47181565-47181587 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1138016670 16:53434657-53434679 GGGCGACTCGGCAGGCGGCGCGG - Exonic
1138347974 16:56331576-56331598 GGGCGGCCCGAGAGGAGGCGGGG - Intronic
1138400255 16:56739501-56739523 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
1138591228 16:58000669-58000691 GGGCGGACGGGCGGGCGGCGCGG + Intronic
1138619104 16:58197781-58197803 CGGCGGCGCGGCGGGGGACGCGG + Exonic
1139575967 16:67842343-67842365 GGGCAGCCAGGCGGGCGGCGCGG + Exonic
1139774892 16:69311098-69311120 GGGCGGGGCCAGGGGCGGAGCGG - Intronic
1139885694 16:70205340-70205362 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
1140927621 16:79599293-79599315 GGCCGGCGCGCCCGGCGCCGCGG - Exonic
1141184714 16:81779210-81779232 GGGCGGGGCGAGGCGGGGCGAGG + Intronic
1141665343 16:85462819-85462841 GGGCGGCGTGAGCGGCTGCGGGG + Intergenic
1141972475 16:87492821-87492843 GGGACGCGCGGCGGGAGGCGCGG + Intergenic
1142120182 16:88383218-88383240 GGCCGGCGTGGCGGGCGGAGCGG + Intergenic
1142206476 16:88785334-88785356 CGGAGGCGGGACGGGCCGCGCGG - Intergenic
1142332423 16:89463060-89463082 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1142378985 16:89721339-89721361 GGGCGGGGCGGTGGGCGGAGGGG - Intronic
1142467394 17:144075-144097 GGGCGGGGCGGCGGGCGGGGCGG + Intergenic
1142467400 17:144087-144109 GGGCGGGGCGGCGGGCGGGGCGG + Intergenic
1142762362 17:2050056-2050078 GGGGGGCGGGCGGGGCGGCGGGG + Intergenic
1142836699 17:2593238-2593260 GGGAGGCGCGAGAGGCAGCGGGG - Intronic
1142848190 17:2692103-2692125 GGGAGGCGCGGCGCGGGGCGAGG + Intronic
1142852662 17:2711693-2711715 TAGTGGCGCGGCGGGCGGCGCGG - Intronic
1143063325 17:4222102-4222124 CGGCGGTGCGGCGGGCGGCCAGG + Intronic
1143492892 17:7294362-7294384 AGGCGGCGGGGCGGGCGGCGGGG - Exonic
1143548487 17:7614520-7614542 TGGCGGCGCCATGGGCGGCCTGG - Exonic
1144473380 17:15563604-15563626 GGGCGGGGCGAGCGGGGGCGGGG + Exonic
1144473387 17:15563619-15563641 GGGCGGGGCGAGCGGGGGCGGGG + Exonic
1144473394 17:15563634-15563656 GGGCGGGGCGAGCGGGGGCGGGG + Intergenic
1144473401 17:15563649-15563671 GGGCGGGGCGAGCGGGGGCGGGG + Intergenic
1144473408 17:15563664-15563686 GGGCGGGGCGAGCGGGGGCGGGG + Intergenic
1144473415 17:15563679-15563701 GGGCGGGGCGAGCGGGGGCGGGG + Intergenic
1144473422 17:15563694-15563716 GGGCGGGGCGAGCGGGGGCGGGG + Intergenic
1144482189 17:15637634-15637656 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1144565015 17:16353000-16353022 GTGCGGCGGGCCGGGGGGCGCGG - Intronic
1144847058 17:18225581-18225603 GGGCGGGGCGCCAGGCGGCCCGG - Exonic
1144923101 17:18781116-18781138 GGGCGGGGCGAGCGGGGGCGGGG - Exonic
1145047121 17:19627694-19627716 GGGCGGCTGGGCGGGCGGGGGGG + Intergenic
1145370818 17:22304817-22304839 CGGCGACACGACGGGCTGCGGGG - Intergenic
1145684577 17:26639185-26639207 GGGCGGCTGGCCGGGCAGCGGGG - Intergenic
1146054103 17:29572730-29572752 GGGCGACGCGAGGTGGGGCGGGG - Intronic
1146182941 17:30709085-30709107 GGGCGGCGCGGCCGGAGGGGGGG - Intergenic
1146281743 17:31549561-31549583 GGGCGGCGCGGCCGGGGGCGGGG - Intergenic
1146646820 17:34581584-34581606 AAGCGAGGCGACGGGCGGCGCGG - Intronic
1146793109 17:35764125-35764147 GGACAGCGCGACGGAGGGCGAGG + Exonic
1146955864 17:36936129-36936151 GGGCGGGGAGACCGGAGGCGCGG - Intergenic
1147015643 17:37489755-37489777 GGGCGGGGGGACGCGCGGGGCGG - Intergenic
1147015649 17:37489770-37489792 GGGGGACGCGACGCGGGGCGGGG - Intergenic
1147184382 17:38705584-38705606 GGGCGGGGGGCCGGCCGGCGGGG - Exonic
1147221066 17:38930791-38930813 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1147250788 17:39151534-39151556 TGGCGGAGGGGCGGGCGGCGAGG + Exonic
1147315485 17:39618167-39618189 GGGCCGCGCGCCGGGCGGGGCGG + Intergenic
1147702510 17:42404788-42404810 GGGCGGCGCGGAGCGCGGGGAGG - Exonic
1147785149 17:42973330-42973352 GGGCGGCTGGCCGGGCGGAGGGG - Intronic
1147792554 17:43022424-43022446 GGGCGGGGCGCCGGGCGAGGCGG + Intronic
1147907592 17:43833044-43833066 GGGCGCCGCGGCGGGAGGGGCGG - Intronic
1147934644 17:44004764-44004786 GCGCGCGGCGGCGGGCGGCGAGG + Exonic
1147994707 17:44354407-44354429 GGGCGGCGGGGGCGGCGGCGAGG - Exonic
1148090277 17:45019144-45019166 GCGGGGCGCGGGGGGCGGCGAGG + Intergenic
1148122715 17:45222156-45222178 GGGCGGCGCGGCGGGGCCCGCGG - Exonic
1148267508 17:46238186-46238208 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1148556618 17:48582307-48582329 GGGCGGCTCGGCGGCCGGCGGGG - Intronic
1148664173 17:49362158-49362180 GGCCGGCGGGGCGGGCAGCGCGG + Intronic
1149470861 17:56914101-56914123 GTGCGGGGGGGCGGGCGGCGAGG + Intergenic
1149624873 17:58073886-58073908 GGGCGGCTGGCCGGGCAGCGGGG + Intergenic
1150108507 17:62478895-62478917 GTGCGGCGCGGAGGGCGGGGGGG - Intronic
1150402970 17:64874438-64874460 GGGCGGCTGGCCGGGCGGAGGGG - Intronic
1150747339 17:67826018-67826040 GGGCGGCAGGACGGGGGGCGGGG + Exonic
1151919296 17:77141315-77141337 GAGGGGGGCGAGGGGCGGCGAGG - Intronic
1151990568 17:77571406-77571428 GGGAGGCGGGAGGGGAGGCGAGG + Intergenic
1152697570 17:81804502-81804524 GGGGGGCGCGGCTGGGGGCGGGG + Intronic
1152703911 17:81833208-81833230 GGGTGCGGCGCCGGGCGGCGGGG - Intronic
1152721881 17:81927470-81927492 GGGCGGCGCGGCGGGGGCGGCGG - Intronic
1152853006 17:82648611-82648633 GGGCGGGGCGAGGCGAGGCGAGG + Intergenic
1152853095 17:82648823-82648845 GGGCGGAGCGAGGCGGGGCGGGG + Intergenic
1153457192 18:5295191-5295213 GGGCGGAGCGGGGCGCGGCGCGG - Intronic
1153794369 18:8609385-8609407 GGGCGGGGCGGCTGGCCGCGAGG - Intergenic
1153900529 18:9614307-9614329 GGGCGTCGCGCCGGGCCCCGGGG - Intronic
1154241528 18:12657833-12657855 GGCTGGCCCGGCGGGCGGCGGGG - Exonic
1154241604 18:12658122-12658144 GGACGGCGCGAGGCGGGGCGGGG - Exonic
1155054518 18:22171858-22171880 AGGCGGCGCGGCTGGCGGCGGGG + Exonic
1155654292 18:28176922-28176944 GGGCCGGGCCACGGGCGGGGTGG - Intronic
1156253827 18:35376968-35376990 GGGAGGCGCGCGGCGCGGCGCGG - Intronic
1157492778 18:48136078-48136100 GGGCGGCGGGCAGGGGGGCGTGG + Intronic
1158259022 18:55587852-55587874 GGGCGGGGGGGCTGGCGGCGAGG + Intronic
1158436001 18:57435842-57435864 GGGCGGCGGCGGGGGCGGCGGGG + Exonic
1158436007 18:57435854-57435876 GGGCGGCGGGGGCGGCGGCGGGG + Exonic
1158649415 18:59272934-59272956 GGGCGCCGGGGCTGGCGGCGGGG + Exonic
1159670132 18:71212495-71212517 GGGAGGGGCGGCGGGGGGCGGGG + Intergenic
1159670144 18:71212515-71212537 GGGCGGGGCGGCGGGGGGCGGGG + Intergenic
1159670161 18:71212544-71212566 GGGCGGGGCGGCGGGGGGCGGGG + Intergenic
1159670173 18:71212564-71212586 GGGCGGGGCGGCGGGGGGCGGGG + Intergenic
1159670185 18:71212584-71212606 GGGCGGGGCGGCGGGGGGCGGGG + Intergenic
1160540372 18:79617438-79617460 GGGCGGCGTCCCGGGGGGCGGGG - Intergenic
1160567818 18:79798080-79798102 GGGCGGTGGGGCGGGGGGCGCGG + Intergenic
1160691092 19:460946-460968 GGGGGGCGCGGGGGGCGCCGGGG + Exonic
1160736082 19:663014-663036 GGCCGGGGCGGCGGGCGGCAGGG - Intronic
1160788699 19:913050-913072 GCGGGGCGCGGCGGGCGCCGGGG - Intronic
1160860448 19:1235246-1235268 GGGCCGCGGCACGGGCGGCCGGG + Intronic
1160864408 19:1250617-1250639 GGGCGGCCAGACAGGGGGCGGGG + Intronic
1160867137 19:1260935-1260957 GGGCCGCGCGACGCGCGGACGGG - Intronic
1160906809 19:1455516-1455538 GGGTGGCGCGGCGGTAGGCGGGG + Intronic
1160967715 19:1753875-1753897 GGGCAGCGCGGGCGGCGGCGCGG + Exonic
1160991894 19:1863511-1863533 GCGCGGCGCGGCGGGCGGAGCGG + Exonic
1160999844 19:1905185-1905207 GGGCGGCGGGAGGGGAGGAGAGG - Intergenic
1161072810 19:2270895-2270917 GGGCGGGGGGGCGGGCGGCCGGG + Intronic
1161210363 19:3062430-3062452 GAGCGGGGAGGCGGGCGGCGGGG - Intronic
1161265135 19:3360296-3360318 GGGCGGTGCGAGGGCAGGCGGGG - Intronic
1161304003 19:3557070-3557092 GGGCTGCCCGACAGGTGGCGGGG + Intronic
1161461946 19:4402843-4402865 GGGGGGCGCGGCGCGCGGCCTGG + Intronic
1161688951 19:5719829-5719851 CGGCGGCGCGGGGGGCAGCGCGG - Exonic
1162019568 19:7862553-7862575 GGGCGGTGCCACGGGCAGGGCGG - Intronic
1162176204 19:8832269-8832291 GGGCCGCGCGTGGGGCAGCGGGG - Exonic
1162372932 19:10289868-10289890 GGGCGGCGGCAGAGGCGGCGGGG - Intergenic
1162374429 19:10296361-10296383 GGGCGGCGCGGCGGGGGGCGCGG + Exonic
1162435379 19:10654787-10654809 CGGCGGCGCCACGCGCGGGGGGG + Intronic
1162714537 19:12621779-12621801 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1162909030 19:13839755-13839777 GGGTGGCGCGGCGGGCAGGGCGG - Intergenic
1162914292 19:13865767-13865789 GGGACGCGCGATGGGGGGCGTGG + Intronic
1163320520 19:16572092-16572114 GGGGCCCGAGACGGGCGGCGCGG + Exonic
1163320629 19:16572495-16572517 GGCTGGCGCGTCGGCCGGCGCGG - Intronic
1163469134 19:17486764-17486786 GGGCTTCGCGCCGGGCGACGTGG + Exonic
1163537225 19:17883776-17883798 GGGCGGGGCAAGGGGCGGGGAGG + Intronic
1163655605 19:18543367-18543389 GGGCGGGGCGAGGGGCCGCGGGG - Intronic
1163674146 19:18646953-18646975 GGGCGGGGGCAGGGGCGGCGGGG + Intronic
1163729537 19:18941166-18941188 GGGCGGCGTGGAGGGCGGCGCGG - Intronic
1164105999 19:22107651-22107673 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1164192341 19:22926709-22926731 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
1164192752 19:22927647-22927669 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
1164263978 19:23595044-23595066 GGGCGGCTGGCCGGGCGGGGAGG - Intronic
1164298405 19:23937115-23937137 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
1164639092 19:29811847-29811869 GGGCGGGGCGAGGGACGGGGCGG + Intergenic
1164643849 19:29844495-29844517 GGGCGGGGAGACGCGGGGCGGGG - Intergenic
1164958381 19:32405915-32405937 TGGCGGCGCGCCGGGACGCGCGG + Intronic
1165058523 19:33194126-33194148 GGGGAGCGCGGCGGGGGGCGCGG + Intronic
1165851457 19:38852226-38852248 GGGCGGCGCCGCGCGCGGCCGGG - Intronic
1165902544 19:39175437-39175459 GGGTGAGGGGACGGGCGGCGGGG + Exonic
1165916727 19:39265269-39265291 GGCGGGGGCGAGGGGCGGCGGGG - Intergenic
1166003453 19:39891919-39891941 GGGCGGCGCCCAGGGCTGCGGGG - Exonic
1166028149 19:40107787-40107809 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1166030055 19:40118651-40118673 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
1166030135 19:40118829-40118851 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
1166044738 19:40223332-40223354 GGCCGGCGCGAAGTGGGGCGTGG - Intronic
1166180318 19:41103446-41103468 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
1166199340 19:41226346-41226368 GGGCGGCCCGAGTGGGGGCGGGG - Intronic
1166367246 19:42284015-42284037 GGGCGGGGGGAGGCGCGGCGGGG + Intronic
1166367251 19:42284022-42284044 GGGAGGCGCGGCGGGGGGAGGGG + Intronic
1166544295 19:43625024-43625046 GGGCGGGGCGCCAGGTGGCGGGG - Intronic
1166547011 19:43639844-43639866 GGGGGGCGGGGCGGGCGGCGCGG - Intergenic
1166857989 19:45792726-45792748 GGGCGGCGCGGAGGGCGGCTCGG - Exonic
1166882939 19:45940210-45940232 GGGCGGCGGGGCGGGCGGAGGGG - Exonic
1166975045 19:46601060-46601082 GGGAGGCGGGGCGCGCGGCGAGG + Intronic
1167001039 19:46746035-46746057 GGCCGCCGGGACGGCCGGCGGGG - Exonic
1167299414 19:48670482-48670504 GGGCGGCACAGCGGGCAGCGTGG + Exonic
1167466268 19:49652374-49652396 GGGCGGCGGGGCGGGCGCCGGGG - Exonic
1167575282 19:50314877-50314899 GGGGAGCGCGGCGGGCGGCCCGG + Intronic
1168110831 19:54190566-54190588 GGGCGGGGCCACAGGCCGCGAGG + Intronic
1168315194 19:55481990-55482012 GGGCGGCGGGGCGGGAGGCGCGG - Exonic
1168614497 19:57826803-57826825 GGGTAGCGCGACGGGCGGTGTGG + Intronic
925610529 2:5697384-5697406 GGGAGGCGGGAAGGGCGCCGGGG - Exonic
925928339 2:8685882-8685904 GGGCAGCGCGGCTGGCGCCGCGG - Intergenic
926250886 2:11155122-11155144 GGGCGGGGCGAGGAGGGGCGGGG + Intergenic
926268295 2:11345026-11345048 GGGGGCCGCGGCGGGGGGCGCGG - Intronic
926801784 2:16665753-16665775 GCGCGGCGCGGCTGGGGGCGCGG - Intronic
927215854 2:20667449-20667471 CCGCGGCGCGGCGCGCGGCGCGG - Exonic
929033663 2:37671682-37671704 GGGCGGGGCGGCGCGGGGCGGGG + Exonic
929468625 2:42169329-42169351 GGGCGGGGCGGGGCGCGGCGCGG + Exonic
929468626 2:42169334-42169356 GGGCGGGGCGCGGCGCGGCGCGG + Exonic
929515801 2:42605191-42605213 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
929614708 2:43297835-43297857 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
930124351 2:47783895-47783917 GGGCGGGGCGGGGGGCGGGGTGG + Intronic
930201474 2:48555297-48555319 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
930762230 2:55049791-55049813 GGGGGGCGCGGCGGGAGCCGGGG + Exonic
930833870 2:55773718-55773740 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
931656014 2:64511699-64511721 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
932699894 2:73985194-73985216 GGGAGGGGCGGCGGGAGGCGCGG + Intergenic
932765248 2:74465144-74465166 GGGCGACGGGACGGCCGGGGCGG - Exonic
932780228 2:74554692-74554714 GGGAGGCGGGGCGGGAGGCGGGG - Exonic
932807482 2:74796098-74796120 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
932828006 2:74958965-74958987 GGGCGGGGCTTAGGGCGGCGTGG + Intronic
933666684 2:84970734-84970756 AGGCGGGGCTAGGGGCGGCGTGG + Intergenic
934703758 2:96462310-96462332 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
934703837 2:96462488-96462510 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
935265098 2:101387155-101387177 GGGTGGCGCGGGGGGCGGCCTGG + Exonic
936452765 2:112645864-112645886 GGCCGGCGCGAGGCGCGGCGGGG + Exonic
936452855 2:112646254-112646276 GGGCGGGCAGACGGGCGGAGTGG - Intronic
936561414 2:113542236-113542258 CGGCGGCGCGGCGGGAAGCGAGG - Intergenic
936572408 2:113627532-113627554 GGGGGGCGGGACGGGCAGCCTGG + Intronic
937045150 2:118847182-118847204 GGCCGGCGCGGCGGCCGGGGCGG - Exonic
937221670 2:120345925-120345947 GAGGGGCGCGCCGGGCGGGGCGG - Intergenic
937437639 2:121892984-121893006 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
937437717 2:121893162-121893184 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
937478241 2:122234150-122234172 GGGCGGGGGGGCGGGCGGCGGGG + Intergenic
937919362 2:127119508-127119530 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
938005709 2:127787818-127787840 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
938018207 2:127885422-127885444 GGGCGGCGGGACGGTGGGTGGGG + Intronic
939969660 2:148644962-148644984 CGGCGGCGGGGCGGGCGGGGAGG - Exonic
940300988 2:152176048-152176070 CGGCGGCGCGGCAGGGGGCGCGG + Intergenic
940774943 2:157875877-157875899 GGGCGGCGCGGGGCGGGGCGGGG + Intergenic
941602950 2:167563511-167563533 GGACGGGGCGGCTGGCGGCGGGG + Intergenic
941814770 2:169786446-169786468 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
941995622 2:171599573-171599595 GGGAGGCGCGACGGGCAGCAAGG - Intergenic
942277949 2:174336310-174336332 GGGCGGCCTGGCGGGCGGCTCGG + Exonic
942450998 2:176107939-176107961 TGGCGGCGCGGGTGGCGGCGGGG - Exonic
942565762 2:177264173-177264195 GAGCGGCCCGGTGGGCGGCGGGG - Intronic
942630533 2:177946519-177946541 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
944060760 2:195568113-195568135 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
944060881 2:195568384-195568406 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
944221750 2:197310514-197310536 GGGCGGCGCGGAGCCCGGCGGGG - Intronic
945114831 2:206400667-206400689 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
945225913 2:207530586-207530608 CGGGGGCGAGGCGGGCGGCGGGG - Intronic
946339975 2:219060583-219060605 CGGGGGCGCCATGGGCGGCGTGG + Intergenic
946340034 2:219060762-219060784 GCGGGGGGCGGCGGGCGGCGGGG + Intergenic
946751214 2:222896551-222896573 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
946751322 2:222896805-222896827 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
947549766 2:231037795-231037817 GGGCGGCGCGCGGGGCGCAGAGG + Exonic
947792466 2:232876115-232876137 GGGCGGCGGTACGGGCGGGGCGG + Exonic
948473836 2:238203758-238203780 GGGCGGGGCGGCTGGGGGCGGGG + Intergenic
948801511 2:240435537-240435559 GGGCGGGGCGGGGCGCGGCGCGG - Intergenic
948824629 2:240568362-240568384 GGCCGGGGCGCCGGGCGGGGAGG - Intronic
949014465 2:241701782-241701804 GGGCCGCACGCCGGGCGGTGGGG + Intergenic
949014525 2:241702008-241702030 GGGCGGTGCCGCGGGAGGCGGGG - Intergenic
1168814625 20:728251-728273 GGGCGGGGCGCCGGCCGGCTTGG + Intergenic
1168904603 20:1393023-1393045 GGGCGGCGCGACGGGCGGCGTGG + Exonic
1169065507 20:2692682-2692704 GGGCGGCGCGGCCGGCCGAGGGG - Intergenic
1169278461 20:4248807-4248829 GGGCGGCGTGCCGGGGGGCGCGG - Exonic
1170204698 20:13785310-13785332 GGGCGGCGGGGCGGGCGACGCGG + Intronic
1170524564 20:17226010-17226032 GGGCGCAGCGACGGGGGGCAGGG - Intergenic
1170756739 20:19212297-19212319 GGTCGGCGCGATGGGGGCCGGGG - Intergenic
1170870290 20:20199913-20199935 GGGCGGCAGGCAGGGCGGCGCGG + Intronic
1171452825 20:25248006-25248028 GGGCGGGGCCTCGGGGGGCGGGG - Intergenic
1171504792 20:25624351-25624373 GGGTGGCCGGGCGGGCGGCGCGG + Intergenic
1172245781 20:33443942-33443964 GGGCGGGGCGTCAGGGGGCGGGG + Intergenic
1172379214 20:34474771-34474793 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
1172721054 20:37000477-37000499 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1172848419 20:37944171-37944193 GGGCGGCGGGGCGGGCGCGGCGG - Exonic
1173852399 20:46227450-46227472 GGGCGGGGCCAGGGGCGGGGCGG - Intronic
1174607014 20:51768405-51768427 GGGCGGCGGCCCAGGCGGCGCGG - Exonic
1175199044 20:57265819-57265841 GGGCGGCGGGCCCGGCGGCCAGG - Exonic
1175210440 20:57350862-57350884 GGGCGGGGGGACGGGGGGCGGGG + Intergenic
1175267075 20:57709591-57709613 CGGCGGCGCGGCGCGGGGCGCGG + Exonic
1175847063 20:62064914-62064936 GGGCGGCACGGCGGGCGCGGCGG + Exonic
1175911464 20:62407199-62407221 GGTCGGCGCGGCGGGTGGCGGGG + Exonic
1175944308 20:62551571-62551593 GGGCGGCGAGGTGGGGGGCGGGG + Intronic
1175997151 20:62817009-62817031 GGGCGGCGCGCGGGCGGGCGGGG - Intronic
1176005759 20:62861613-62861635 GGCAGGCGCGGCAGGCGGCGAGG - Exonic
1176148081 20:63574272-63574294 GGGCGGGGCGGGGGGCGGTGAGG - Intergenic
1176169474 20:63690475-63690497 GGGTGGCGGAGCGGGCGGCGTGG + Intronic
1176194467 20:63830966-63830988 TGGCGGGGCGGCCGGCGGCGGGG + Intronic
1176234581 20:64048484-64048506 GAGCGGCGCCGCGGGGGGCGCGG + Exonic
1176234828 20:64049361-64049383 GGGCGGCGAGGCGGGCGCGGCGG + Exonic
1176234839 20:64049393-64049415 GGGCGGCGGGGCCGGCGGCGAGG + Exonic
1176238025 20:64063273-64063295 GGCGGGCGCGACGGGCGCGGGGG + Exonic
1176242129 20:64080033-64080055 GCGGGGCGCGGCGGGCGGGGCGG - Intergenic
1176376912 21:6091408-6091430 CGGTGGCGCGGCGGGAGGCGTGG + Intergenic
1176423386 21:6533364-6533386 GGGAGGGGCGAGGGGGGGCGAGG - Intergenic
1176546925 21:8206193-8206215 GGGCGGCGGGGAAGGCGGCGAGG + Intergenic
1176551772 21:8226189-8226211 GGGCGGGGCGAGGCGAGGCGAGG + Intergenic
1176554830 21:8250402-8250424 GGGCGGCGGGGAAGGCGGCGAGG + Intergenic
1176565876 21:8389240-8389262 GGGCGGCGGGGAAGGCGGCGAGG + Intergenic
1176570681 21:8409188-8409210 GGGCGGGGCGAGGCGAGGCGAGG + Intergenic
1176573751 21:8433427-8433449 GGGCGGCGGGGAAGGCGGCGAGG + Intergenic
1176578590 21:8453335-8453357 GGGCGGGGCGAGGCGAGGCGAGG + Intergenic
1177134125 21:17292118-17292140 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1177792281 21:25734604-25734626 GGGCGGCGCGGGGGGCAGGGAGG - Exonic
1179213750 21:39349146-39349168 GGGCGGCCCGGCCGGCGGGGAGG - Exonic
1179698880 21:43141680-43141702 GGGAGGGGCGAGGGGGGGCGAGG - Intergenic
1179746563 21:43446836-43446858 CGGTGGCGCGGCGGGAGGCGTGG - Intergenic
1179810187 21:43865186-43865208 GGGCGGCGGGATGGGGGCCGGGG + Intronic
1180014698 21:45074555-45074577 GGGCGGAGCCGCCGGCGGCGGGG + Intronic
1180095853 21:45555142-45555164 GGGCGGTGCAGGGGGCGGCGGGG + Intergenic
1180095868 21:45555175-45555197 GGGCGGTGCAGGGGGCGGCGGGG + Intergenic
1180095878 21:45555196-45555218 GGGCGGCGCAGGGGGCGGTGGGG + Intergenic
1180095920 21:45555288-45555310 GGGCGGCGCAGGGGGCGGCGGGG + Intergenic
1180110330 21:45644284-45644306 GGGCGGCGGGGCGGGGCGCGGGG + Intronic
1180177500 21:46097839-46097861 GGCGGGGGCGACGGGCGGCCGGG + Intergenic
1180614766 22:17120221-17120243 CGGCGGCGCGGGGGGCGGCCTGG - Exonic
1180620577 22:17159174-17159196 GGGCGGCGCGCGCGGCTGCGGGG - Exonic
1180782399 22:18528600-18528622 GGGAGGCGCGCGAGGCGGCGCGG + Exonic
1180801588 22:18634481-18634503 GCGCGGCGCGGGGGACGGCGCGG - Intergenic
1180852831 22:19030020-19030042 GCGCGGCGCGGGGGACGGCGCGG - Intergenic
1181239288 22:21467935-21467957 GGGAGGCGCGCGAGGCGGCGCGG + Intergenic
1181981915 22:26772805-26772827 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1182445555 22:30387400-30387422 GGGCGGGGCGCCGGGAGGGGCGG + Intronic
1183437031 22:37802356-37802378 GGGGGGCGCGACGGCTGCCGAGG + Intergenic
1183486400 22:38089483-38089505 CGGGGGCGCGAACGGCGGCGGGG + Intronic
1183683774 22:39350215-39350237 CGGCGGCGCGGCGGCGGGCGAGG + Intronic
1183739613 22:39662519-39662541 GGGCGGGCCCACGGGGGGCGTGG + Intronic
1183845267 22:40537026-40537048 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1183931381 22:41237912-41237934 GGGCCGCGCGGAGGGCCGCGCGG + Exonic
1184674839 22:46036047-46036069 CGAGGGCGCGACGCGCGGCGCGG - Intergenic
1184680744 22:46071199-46071221 GGGCGGCGGGAGGGGCCGCGGGG + Intronic
1184759405 22:46536466-46536488 GGCCGGCGCGACGGGCCCGGCGG - Exonic
1185055321 22:48576040-48576062 GGGCGGCGCGGGGGGGGGGGGGG - Intronic
1185088312 22:48752551-48752573 GGGCTGCGCCACGGGCTGCCTGG + Intronic
1185255086 22:49827442-49827464 GGGCGGCCCGCGAGGCGGCGGGG + Intronic
1185313934 22:50170696-50170718 GCGCGGCCCGGCGGGGGGCGCGG - Intergenic
1185333358 22:50261349-50261371 GGGCGGGGCGGCCGGCGGGGCGG - Intronic
1185338282 22:50280446-50280468 GAGCGGGGCCACGGGCGGGGCGG - Intronic
1185427781 22:50783347-50783369 GGGGGGCGGGACGGGCAGCCTGG - Intronic
1203251800 22_KI270733v1_random:122478-122500 GGGCGGCGGGGAAGGCGGCGAGG + Intergenic
1203256794 22_KI270733v1_random:143111-143133 GGGCGGGGCGAGGCGAGGCGAGG + Intergenic
1203259851 22_KI270733v1_random:167561-167583 GGGCGGCGGGGAAGGCGGCGAGG + Intergenic
951881339 3:27483979-27484001 GGGGGGCGCGGCGGGCGTCGCGG - Intronic
952908940 3:38165801-38165823 GGGTGGGGAGACGCGCGGCGAGG + Exonic
953652623 3:44821007-44821029 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
954048401 3:47952270-47952292 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
954162956 3:48734824-48734846 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
954176205 3:48847706-48847728 GAGCGGCGCGACGTGAGCCGGGG - Exonic
954599830 3:51858911-51858933 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
954702013 3:52455522-52455544 TGGCGGCGCAGCGCGCGGCGGGG + Exonic
954702020 3:52455538-52455560 GGCGGGGGCGACGGGCGGCGGGG + Exonic
954912861 3:54122973-54122995 GGGACCCGCGTCGGGCGGCGAGG + Intronic
955239206 3:57164872-57164894 GGCGGGCGTGAGGGGCGGCGGGG - Intronic
955394648 3:58549678-58549700 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
955699787 3:61671874-61671896 GGGCGGCTGGATGGGCGGGGGGG + Intronic
956270606 3:67444522-67444544 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
958808234 3:98836702-98836724 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
958808387 3:98837026-98837048 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
961013395 3:123449803-123449825 GGGCGGCGCGGGGGGCGGGGAGG - Intergenic
961300129 3:125916722-125916744 GGGCGGCGGGGCGAGCGGAGAGG + Intergenic
961599884 3:128052392-128052414 GCGCGGCGCGGCGCGGGGCGGGG - Exonic
961698982 3:128726733-128726755 GGGCACGGCGGCGGGCGGCGTGG - Intronic
961729604 3:128955333-128955355 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
961888378 3:130111352-130111374 GGGCGGCGGGGCGAGCGGAGAGG - Intronic
962112705 3:132470594-132470616 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
962245281 3:133785636-133785658 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
962738907 3:138348806-138348828 GGCCGGGGCGAGAGGCGGCGCGG - Intronic
962808999 3:138946176-138946198 GTGCGGCGTGGCGGGCGCCGGGG - Exonic
963778526 3:149464139-149464161 AGGCAGCGCGAGGGGCGGCGTGG + Intergenic
963827507 3:149970932-149970954 CGGCGGCGCGGGGGGAGGCGGGG + Exonic
965576435 3:170222606-170222628 GGGGGGCGCTTCGGGCGCCGTGG - Exonic
966808730 3:183825553-183825575 GAGCGGGGCGGCGGGCGCCGGGG - Exonic
966874610 3:184314995-184315017 GGGCGGCGGGCCGGGAGCCGTGG - Intronic
966886589 3:184380554-184380576 GCTCGGCGCGGCGGGCGGCCCGG + Intronic
967847914 3:194058529-194058551 GGGTGGCGGGGCGGGCAGCGGGG + Intergenic
967858188 3:194134097-194134119 AGGCGGCGGGAAGGGCGGAGGGG + Intergenic
967867848 3:194204602-194204624 GGGAGCCGGGAGGGGCGGCGGGG - Intergenic
968133692 3:196207630-196207652 GGGCGGGGCCAGGGGCGGGGCGG - Intronic
968133739 3:196207727-196207749 GGGCGGGGCCAGGGGCGGGGCGG - Intronic
968433857 4:575293-575315 GGTCGGCGCGGCAGGCGGAGGGG - Intergenic
968514288 4:1009851-1009873 GGGCGGGGCCAGGGGCGGAGCGG - Intergenic
968663372 4:1807991-1808013 GGGCGGGGCGTGGGGGGGCGTGG + Exonic
968667117 4:1828202-1828224 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
968674812 4:1871613-1871635 GGGAGGCCTGAGGGGCGGCGGGG + Intronic
968701376 4:2059648-2059670 GGGGGGCGCGGCGGCCGGCCCGG - Exonic
968965300 4:3766420-3766442 GGGCGGCGCGCCGGAGAGCGTGG - Exonic
968997529 4:3955299-3955321 GGGCGGCGGGGCGAGCGGAGAGG - Intergenic
969379107 4:6782805-6782827 GGGCGGCGCGGCGGCCGGCGGGG - Exonic
969559778 4:7939630-7939652 AGACGGCGCGACTGGCGGCAGGG - Exonic
969676301 4:8616277-8616299 GGGCGAGGGGAGGGGCGGCGTGG + Intronic
970319704 4:14863049-14863071 GGGCGGCGCGTGCGGGGGCGGGG - Intergenic
970333143 4:15004208-15004230 CTGCGGCGCCGCGGGCGGCGGGG - Exonic
971279826 4:25233986-25234008 GTGGGGCGCGGCCGGCGGCGAGG + Exonic
972765857 4:42151949-42151971 GTGCGGCGCGAAGGGCGGCGGGG + Exonic
973281222 4:48363369-48363391 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
973593720 4:52465616-52465638 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
974016786 4:56655756-56655778 GGGCAGCCCGGCGGGAGGCGCGG + Intronic
975870837 4:78776588-78776610 CGGCGGAGCGGCGGGTGGCGGGG + Exonic
977257615 4:94758152-94758174 GGGCAGAGCGAGGGGCGGCGCGG + Intronic
977574073 4:98658696-98658718 GGGCGGAGCTGCGGGCGGCGCGG - Intergenic
981524048 4:145693818-145693840 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
981524274 4:145694559-145694581 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
981550534 4:145937544-145937566 GGGCGGCCGGGCGGGGGGCGAGG - Intronic
981970839 4:150660492-150660514 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
983537871 4:168877818-168877840 CGGCGGCGGGAAGGGGGGCGAGG - Intronic
983537948 4:168878085-168878107 GGGCTGCGCGAAGGGCGGCACGG - Intronic
983649776 4:170026457-170026479 GTGCGGCTCGCCGGGCGGCGCGG + Intronic
983649799 4:170026524-170026546 GGGCAGCGGGGCGGGCGGTGCGG + Intronic
985630005 5:1009221-1009243 GGGCGAGCCGACGGGCGGGGCGG + Intronic
985837018 5:2278938-2278960 GGTGGGAGCGGCGGGCGGCGGGG + Intergenic
986152492 5:5140299-5140321 GTGCGGCGCGGGGGGCGGAGTGG - Intergenic
986330692 5:6714180-6714202 GGGCGACGCGGCGGGCAGCGCGG - Intergenic
986330706 5:6714216-6714238 GGGCAGCGCGGCGGGCGCGGTGG - Intergenic
986721841 5:10565283-10565305 GGGCGGCGCGAGGGGCCCAGGGG - Intronic
988552404 5:32209022-32209044 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
991371727 5:65926125-65926147 GGACGGCCCGACGGACGGCCCGG + Intergenic
992013872 5:72556977-72556999 GGACAGAGCGAAGGGCGGCGGGG + Intergenic
992320916 5:75612321-75612343 GGGCGGGGCGGAGGGCGGGGGGG - Intronic
992463568 5:76984598-76984620 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
992469575 5:77042560-77042582 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
992487422 5:77210363-77210385 GAGCGGCGGGAGGGGCGGAGGGG + Intergenic
992544234 5:77794970-77794992 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
992939918 5:81751432-81751454 GGGCGGCGCGGGGGGAGGGGTGG - Intronic
992964193 5:81983618-81983640 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
994353873 5:98774015-98774037 GGGCGGCGGCGCGGGCGCCGTGG - Exonic
995193638 5:109342210-109342232 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
995193863 5:109342713-109342735 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
995942315 5:117599859-117599881 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
997321583 5:132983000-132983022 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
997635186 5:135399318-135399340 GGCCGGGGCGCCGGGCGGCACGG - Exonic
998021763 5:138776828-138776850 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
998166588 5:139847892-139847914 GGGCGGAGGGGCGCGCGGCGGGG + Exonic
998369496 5:141651569-141651591 GGGTGGCGGGGCGGGCGGGGCGG + Intergenic
998431701 5:142075439-142075461 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
998431751 5:142075539-142075561 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
998431778 5:142075591-142075613 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
998431804 5:142075641-142075663 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
998583530 5:143403902-143403924 GCGCGGCGCACCGGGCGGGGCGG - Intronic
1000318895 5:160118692-160118714 GGGCGGGGCCCCGGGCAGCGGGG + Intronic
1000985776 5:167860250-167860272 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1001529935 5:172454566-172454588 GGGCGGTGCGGGGGGCGGTGCGG - Intergenic
1001529941 5:172454578-172454600 GGGCGGTGCGGGGGGCGGTGCGG - Intergenic
1001529947 5:172454590-172454612 CGGCGGCGCGGGGGGCGGTGCGG - Intergenic
1002029369 5:176416547-176416569 GGGCGCCGCGGCGGGAGGAGCGG + Exonic
1002061986 5:176630546-176630568 GGGCGGCGCGGCCGCCAGCGGGG - Intronic
1002116157 5:176962358-176962380 GGGCGGCTGGCCGGGCAGCGGGG - Intronic
1002349926 5:178576758-178576780 GGCCGGCGCGGCGGTCGCCGGGG - Intronic
1002512748 5:179733357-179733379 GGCCGGGGCGGCGGGCGCCGGGG - Exonic
1002638328 5:180618983-180619005 GCGGGGCGCCGCGGGCGGCGGGG - Intronic
1002771275 6:292445-292467 GAGCGGCGGGGCGGGCGGGGAGG - Exonic
1002888081 6:1313004-1313026 GGGCGGCGCGGGGAGCGGCGAGG + Exonic
1002926968 6:1610403-1610425 GTGGGGGGCGGCGGGCGGCGCGG + Exonic
1004216779 6:13711242-13711264 GGGCGGCGGCGGGGGCGGCGGGG + Exonic
1004262238 6:14118203-14118225 GGGAGGCGCGACGGGAGGCTGGG - Intronic
1004388377 6:15189650-15189672 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
1004388512 6:15189957-15189979 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
1004504713 6:16238615-16238637 GGGCGGCGCGGGGAGCGCCGGGG - Exonic
1004562481 6:16762579-16762601 TGGCGGCGAGACAGGCGGAGGGG - Intergenic
1004705742 6:18122285-18122307 GGGCGGCGCGATGGGCGGCCGGG + Exonic
1004874450 6:19939753-19939775 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
1004874476 6:19939803-19939825 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
1004874723 6:19940438-19940460 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
1004874748 6:19940488-19940510 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
1005644574 6:27827326-27827348 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1005968389 6:30742897-30742919 GGGCGGAGCGTGGCGCGGCGTGG - Intergenic
1006040009 6:31244689-31244711 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
1006128239 6:31853891-31853913 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1006231934 6:32594969-32594991 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1006232424 6:32596029-32596051 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1006320641 6:33317564-33317586 GGGCGGAGCGGGGGGGGGCGGGG - Intronic
1006351689 6:33525535-33525557 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
1006599704 6:35217242-35217264 GGGAGGCGCGGCGGGGGGGGGGG + Intronic
1007631479 6:43275571-43275593 GGGCAGCCCGACGGGCAGTGAGG - Intronic
1007775735 6:44223494-44223516 GGGCGGGGCCGCGGGCGTCGGGG + Intronic
1007778597 6:44238007-44238029 GGGCGGCGAGAGGTGCGACGGGG + Intergenic
1008112038 6:47505599-47505621 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
1008553573 6:52655687-52655709 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1009396973 6:63211510-63211532 GGGCAGCGCGACGGGCGGCGTGG - Exonic
1011405273 6:87010292-87010314 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
1011588145 6:88947614-88947636 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1011588346 6:88948192-88948214 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1011588424 6:88948371-88948393 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1013507710 6:110815908-110815930 GAGCAGCGGGACGGGGGGCGGGG - Intronic
1013514768 6:110875492-110875514 GCGCTGGGCGGCGGGCGGCGCGG + Intronic
1014556663 6:122848394-122848416 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1014724766 6:124961964-124961986 GGGTGGGGTGAGGGGCGGCGAGG + Intergenic
1015315028 6:131807962-131807984 GCGGGGCGGGGCGGGCGGCGCGG + Intergenic
1015773603 6:136792532-136792554 GCGCGGCGCGGCGGGTGGCGAGG - Intergenic
1016330256 6:142946518-142946540 GTGCGGCGCGCGGGGCGACGGGG + Intergenic
1016937253 6:149456612-149456634 GGGCGGCGGGGCGGGGGGCCGGG - Intronic
1016973471 6:149786190-149786212 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
1017206468 6:151808375-151808397 GGCCACCCCGACGGGCGGCGCGG - Intronic
1017842272 6:158231994-158232016 GGGCGGCGCGGCGGCCCGCGGGG + Intergenic
1017877643 6:158537215-158537237 GGGCGGCGAGGCGGGCGCGGGGG - Intronic
1017920734 6:158869863-158869885 GGCCGGCGCGACCGGCGGGGCGG + Intergenic
1018987382 6:168648308-168648330 GGGCGACGAGACAGGCGCCGGGG - Intronic
1019298132 7:289845-289867 GGGTGGTCCGACGGGCGGGGCGG - Intergenic
1019379090 7:712155-712177 GGGCGGCGTGGCGGGGGGCTGGG - Intronic
1019439608 7:1039248-1039270 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1019439689 7:1039429-1039451 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1019439744 7:1039559-1039581 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1019474375 7:1236838-1236860 GGGCGACGGCGCGGGCGGCGGGG - Exonic
1019475345 7:1241601-1241623 GGGCGGCGCCCCGGGCAGAGGGG - Intergenic
1019989550 7:4682244-4682266 CGGCGGCGCGGGGGGCGGGGAGG - Intergenic
1019989597 7:4682424-4682446 GGGCTGCGCGGGGGCCGGCGGGG - Exonic
1020023656 7:4883696-4883718 CGGCGGCGCAACGGGCGGGGCGG + Exonic
1020107207 7:5427713-5427735 GGTTGGCGCGACGGGTGGAGTGG - Intergenic
1020232519 7:6330757-6330779 GGGCGGCGAGACTGGCTGGGAGG - Exonic
1020284716 7:6671153-6671175 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1021510502 7:21427998-21428020 GCGCGGCGCGGGCGGCGGCGCGG - Intergenic
1022528272 7:31052197-31052219 GGGCGGTGCGGTGGGGGGCGCGG - Intergenic
1022723012 7:32957549-32957571 GGGCGGCGAGAAGAGTGGCGCGG - Exonic
1022973495 7:35537309-35537331 GGGCGGGGCGGGGGGCGGGGGGG + Intergenic
1023418278 7:39951290-39951312 CGGCGGCGGGATGGGCAGCGCGG + Exonic
1023918369 7:44607205-44607227 GGGCGGCGCCAAGGTCTGCGCGG - Intronic
1024639374 7:51316909-51316931 GGGCGGCGCTCCGGTGGGCGCGG - Intergenic
1024797447 7:53036148-53036170 GGGCGGCGGGGCGGCCTGCGGGG - Exonic
1024931150 7:54667658-54667680 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1026010041 7:66629219-66629241 GGGCGGCGGGCCGCGGGGCGTGG + Intronic
1026740568 7:72976069-72976091 GGGCGGCCGGGTGGGCGGCGGGG - Intergenic
1026797867 7:73377554-73377576 GGGCGGCCGGGCGGGCGGCGGGG - Intergenic
1026837378 7:73647815-73647837 GGGGCGGGCGGCGGGCGGCGGGG + Intergenic
1026932632 7:74232463-74232485 GGGTGGGGCGAGGGGGGGCGGGG + Intronic
1027103164 7:75389002-75389024 GGGCGGCCGGGTGGGCGGCGGGG + Intergenic
1027232610 7:76281560-76281582 AGGCCGCGCGGCGGGCGGGGCGG + Exonic
1027233031 7:76282893-76282915 GGCCGACGGGGCGGGCGGCGGGG + Intronic
1029068107 7:97872400-97872422 GGACAGCTTGACGGGCGGCGAGG + Exonic
1029168999 7:98617755-98617777 GGGCGGCAAGGCGCGCGGCGCGG + Exonic
1029611656 7:101629816-101629838 GGGCGGGGGGGCGGGGGGCGTGG + Intergenic
1031629728 7:124032550-124032572 GGGCGGCGGGGCGGGGGTCGCGG - Exonic
1032174556 7:129612298-129612320 GGGCGGGCGGGCGGGCGGCGCGG + Intronic
1032291280 7:130591484-130591506 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1033253220 7:139777873-139777895 GGGCGGCCGGGCGGGCGGAGCGG + Intronic
1034234022 7:149554431-149554453 GGGCGGCTGGCCGGGCGGTGGGG - Intergenic
1034470468 7:151251931-151251953 GGGCGGAGGGAGGGGCGGCGCGG - Intronic
1034560621 7:151877322-151877344 CCGCGGCGCGGCGGGGGGCGAGG - Intergenic
1034963087 7:155374352-155374374 GGGCGGCCCGGCGGGCGGGCCGG + Intergenic
1035168592 7:157005750-157005772 GGGCGCGGGGAAGGGCGGCGCGG - Exonic
1035169517 7:157009900-157009922 TGGGGGCGCGCAGGGCGGCGCGG - Exonic
1035169754 7:157010783-157010805 GGGCGGGGCGGCGGGCGGCCGGG - Intergenic
1035264861 7:157685068-157685090 GCGAGGGGCGAGGGGCGGCGAGG - Intronic
1035264889 7:157685148-157685170 AAGCGGCGCGACCGGCGGAGGGG + Intronic
1035476070 7:159144967-159144989 GGGCGGAGCGGCGGGGCGCGTGG - Intergenic
1035717065 8:1763378-1763400 GCGCGGCGCGGCGGGCGCTGTGG - Intronic
1035717070 8:1763400-1763422 GCGGGGCGCGGCGGGGGGCGGGG - Intronic
1035717079 8:1763417-1763439 GCGGGGCGCGGCGGGGGGCGGGG - Intronic
1035717088 8:1763434-1763456 GCGGGGCGCGGCGGGGGGCGGGG - Intronic
1035717097 8:1763451-1763473 GCGGGGCGCGGCGGGGGGCGGGG - Intronic
1035717106 8:1763468-1763490 GCGGGGCGCGGCGGGGGGCGGGG - Intronic
1035717115 8:1763485-1763507 GCGGGGCGCGGCGGGGGGCGGGG - Intronic
1035717124 8:1763502-1763524 GCGGGGCGCGGCGGGGGGCGGGG - Intronic
1035717133 8:1763519-1763541 GCGGGGCGCGGCGGGGGGCGGGG - Intronic
1035717142 8:1763536-1763558 GCGGGGCGCGGCGGGGGGCGGGG - Intronic
1035717151 8:1763553-1763575 GCGGGGCGCGGCGGGGGGCGGGG - Intronic
1035717160 8:1763570-1763592 GCGGGGCGCGGCGGGGGGCGGGG - Intronic
1035717169 8:1763587-1763609 GCGGGGCGCGGCGGGGGGCGGGG - Intronic
1035717187 8:1763623-1763645 GAGGGGCGCGGCGGGGGGCGGGG - Intronic
1035747839 8:1974337-1974359 GGGCGGCGGGACCCTCGGCGGGG - Intronic
1036379725 8:8228703-8228725 GGGCGGCGGGGCGAGCGGAGAGG + Intergenic
1036454179 8:8893361-8893383 GCGCCGCGCGGCGGGCGGAGAGG - Exonic
1036723649 8:11200751-11200773 GGGCGGCGGGCTGGGCGCCGTGG - Exonic
1036789478 8:11708611-11708633 GCGCGGCGACACCGGCGGCGGGG - Exonic
1036849842 8:12193950-12193972 GGGCGGCGGGGCGAGCGGAGAGG - Intronic
1036871206 8:12436223-12436245 GGGCGGCGGGGCGAGCGGAGAGG - Intronic
1037825301 8:22156822-22156844 GGGGCGCGCGCGGGGCGGCGCGG + Exonic
1037886702 8:22599531-22599553 GGGCGGGGCGGTGGGGGGCGTGG - Intronic
1038644384 8:29350501-29350523 GGGCGGCGCGCAGAGCGGAGGGG + Exonic
1039153164 8:34528814-34528836 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1039212647 8:35235220-35235242 GGGCTGGGAGTCGGGCGGCGGGG - Intergenic
1039468067 8:37797584-37797606 GGGAGGCGAGACGGGAGGGGTGG + Intronic
1039531756 8:38269043-38269065 GGGCGGCGGGTCGGGCAGTGGGG - Intronic
1041066259 8:54085729-54085751 GGGCGGCTGGCCGGGCGGAGGGG - Intronic
1041281017 8:56211373-56211395 GGGCGGGCCGACGGGAGGCGGGG - Intergenic
1041676823 8:60547681-60547703 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
1041796343 8:61752531-61752553 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1042962700 8:74320884-74320906 GAGCGGCGTAACGGGCGGCTCGG - Intronic
1043388067 8:79767691-79767713 GGTCGGCGCGGCGGGCAGGGAGG + Exonic
1043985830 8:86694054-86694076 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
1045098847 8:98825724-98825746 GGGCGGGGCGGCCGGGGGCGGGG - Intronic
1045098859 8:98825744-98825766 GGGCGGGGCGGCCGGGGGCGGGG - Intronic
1045098871 8:98825764-98825786 GGGCGGGGCGGCCGGGGGCGGGG - Intronic
1045098883 8:98825784-98825806 GGGCGGGGCGGCCGGGGGCGGGG - Intronic
1045098895 8:98825804-98825826 GGGCGGGGCGGCCGGGGGCGGGG - Intronic
1045098907 8:98825824-98825846 GGGCGGGGCGGCCGGGGGCGGGG - Intronic
1045098919 8:98825844-98825866 GGGCGGGGCGGCCGGGGGCGGGG - Intronic
1045098932 8:98825864-98825886 GGCCGGCGCGGCCGGGGGCGGGG - Intronic
1045524133 8:102928473-102928495 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1045524254 8:102928719-102928741 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1047687581 8:127317143-127317165 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
1047782000 8:128118598-128118620 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1047847836 8:128825915-128825937 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1048009278 8:130443345-130443367 GGGCGCCGGGACGGGGCGCGGGG - Intronic
1049179127 8:141212131-141212153 GGGCGGGCGGGCGGGCGGCGGGG - Intronic
1049396390 8:142403047-142403069 GGGCCGGGCGTGGGGCGGCGAGG - Intronic
1049585367 8:143430427-143430449 CCGCGCCCCGACGGGCGGCGTGG + Intergenic
1049645443 8:143733820-143733842 GGCAGGAGCGACGGGCGGGGCGG - Intergenic
1049891272 9:73104-73126 CGGCGGCGCGGCGGGAAGCGAGG + Intergenic
1050151257 9:2621727-2621749 GGGAGGCGCGGCGGGCGGGCGGG - Intergenic
1052942029 9:34137900-34137922 GGGCGGCCGGCCGGGCGGGGGGG - Intergenic
1053149165 9:35732095-35732117 GGGCGGCGGGCCGGCGGGCGGGG - Exonic
1053457600 9:38242976-38242998 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
1054695721 9:68357406-68357428 CGGCGGCGCGGCGGGAAGCGAGG - Intronic
1055137265 9:72840910-72840932 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1055948713 9:81711333-81711355 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
1056166865 9:83948437-83948459 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1056670924 9:88626413-88626435 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
1057629402 9:96707574-96707596 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1057643785 9:96854188-96854210 GCCCGGCGCGAGCGGCGGCGGGG - Exonic
1057708043 9:97412049-97412071 GGGCGGGGCGAAGCGGGGCGGGG + Exonic
1057781914 9:98056972-98056994 GGGCGCCGGGAGGGGCGGGGCGG + Intronic
1058659482 9:107256625-107256647 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1058661663 9:107272475-107272497 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
1058686851 9:107487892-107487914 GGGCGTGGCGCCGGGCGGCACGG - Exonic
1058991231 9:110256588-110256610 GGGCGCAGCGACGGGCGCGGAGG - Exonic
1059121257 9:111641818-111641840 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1059211376 9:112515094-112515116 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1060208985 9:121699096-121699118 GGGCGACGTGGCGGGCGGGGTGG + Intronic
1060249198 9:121971456-121971478 GGGCGGCTGGCCGGGCGGGGGGG - Intronic
1060468629 9:123929839-123929861 GGGCCGGGCGCGGGGCGGCGAGG - Intronic
1060811664 9:126614051-126614073 GGGCGGCCCCGCGGGCCGCGGGG - Intergenic
1061242760 9:129383899-129383921 GGGCGTCCCGCCGGGCGTCGCGG + Intergenic
1061317152 9:129803435-129803457 GGTCGGCGCTGCGGGGGGCGCGG + Intronic
1061559588 9:131394079-131394101 GAGCGGCGAGACAGGCGCCGAGG + Intronic
1061737409 9:132670676-132670698 GGGCGGCGAGGCGGGCGGGAAGG + Exonic
1061802759 9:133121179-133121201 GGCCGGCCCGGCGCGCGGCGGGG + Intronic
1061828329 9:133275269-133275291 AGTCGGGGCGGCGGGCGGCGCGG - Intergenic
1061916795 9:133759706-133759728 GGGCGGAGCGAGGGGAGGGGCGG + Intergenic
1061975886 9:134067895-134067917 GCGCGGGGCGGCGGGCGGCGCGG - Intronic
1062230613 9:135479830-135479852 CGGCGGCGCGCGGGGAGGCGGGG + Exonic
1062230680 9:135479989-135480011 GGTCCGCGCGGCGGGCGGCGGGG + Exonic
1062467441 9:136687458-136687480 GGGCGGGGCGGGGCGCGGCGTGG + Intergenic
1062537717 9:137028201-137028223 CAGCGGCGCGGCGGGCTGCGGGG - Intronic
1062556214 9:137114417-137114439 GGGCGGCGGGACGGCGGGGGCGG + Intronic
1062594940 9:137295395-137295417 GGGAGGCGGGGCGGGCGCCGGGG - Intergenic
1062696347 9:137877999-137878021 GGGCGGCGGGGCCGGCGGGGCGG + Exonic
1203468202 Un_GL000220v1:105629-105651 GGGCGGCGGGGAAGGCGGCGAGG + Intergenic
1203472951 Un_GL000220v1:124793-124815 GGGCGGGGCGAGGCGAGGCGAGG + Intergenic
1203476023 Un_GL000220v1:149601-149623 GGGCGGCGGGGAAGGCGGCGAGG + Intergenic
1203405825 Un_KI270539v1:941-963 GGGCGGCTGGCCGGGCAGCGGGG - Intergenic
1203562732 Un_KI270744v1:71857-71879 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
1185508272 X:644482-644504 GGGCAGCCCGAAGGGCGGCGGGG - Exonic
1185510814 X:663930-663952 TGGCGGTGTGACGGGTGGCGTGG + Intergenic
1186200075 X:7147985-7148007 GGGCGTGGGGACGGTCGGCGCGG - Intronic
1186901990 X:14066385-14066407 GGGGGGGGGGGCGGGCGGCGGGG - Intergenic
1187464409 X:19515024-19515046 GGGCGGCGCGGCCGGCGGCCCGG - Exonic
1187974730 X:24693811-24693833 GGGCGGAGCGCGGCGCGGCGCGG + Intergenic
1189137090 X:38561449-38561471 GGGCGGGGCGGCGCGGGGCGGGG - Exonic
1189331360 X:40146680-40146702 GGCGGGCGCGGCGGGCGGGGAGG - Intronic
1190324887 X:49200221-49200243 GGGCGGCGCGGGGCGCGGCGGGG + Exonic
1191010010 X:55748971-55748993 GGGCGGCCGGCCGGGCGGGGGGG - Intronic
1191617994 X:63189397-63189419 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1192393269 X:70753207-70753229 GGGCGGCGAGGGGGGCGGGGAGG + Intronic
1192584060 X:72306434-72306456 GGGCGCCGGGCTGGGCGGCGGGG - Intronic
1192739940 X:73882517-73882539 GGGCGGCTGGCCGGGCGGAGGGG - Intergenic
1192969777 X:76218118-76218140 GGGCGGCTGGCCGGGCGGGGGGG + Intergenic
1193654958 X:84187818-84187840 CGGCGGCGCGAGCAGCGGCGAGG - Exonic
1195036105 X:100972642-100972664 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
1195888958 X:109671376-109671398 GGGCGGCTGGCCGGGCGGAGGGG - Intronic
1197195912 X:123700504-123700526 GGGCGGGGCTGGGGGCGGCGGGG + Intronic
1197241727 X:124128602-124128624 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
1197736143 X:129851110-129851132 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
1197736192 X:129851209-129851231 GGGCGGCTGGCCGGGCGGGGGGG - Intergenic
1198321358 X:135521414-135521436 GCCCGGCGGGGCGGGCGGCGAGG + Intronic
1199622207 X:149711941-149711963 GGGCGGGGCGAGGCGAGGCGGGG - Intronic
1199622215 X:149711961-149711983 GGGCGGGGCGAGGCGAGGCGGGG - Intronic
1200068759 X:153517742-153517764 GGGCGGCCTGGCCGGCGGCGCGG - Intronic
1200084886 X:153599190-153599212 GGGCGGGGCGGCGAGGGGCGGGG - Intronic
1200084896 X:153599210-153599232 GGGCGGGGCGGCGAGGGGCGGGG - Intronic
1200280576 X:154773909-154773931 GGGCGGCTGGCCGGGCGGGGGGG + Intronic
1200310283 X:155071174-155071196 GGGCGTCAGGCCGGGCGGCGGGG - Exonic