ID: 1168904604

View in Genome Browser
Species Human (GRCh38)
Location 20:1393039-1393061
Sequence GGCGTGGACCAACAGCGACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 2, 2: 1, 3: 2, 4: 46}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168904591_1168904604 30 Left 1168904591 20:1392986-1393008 CCTGCACTCCCATGGCGGCGGCG 0: 1
1: 3
2: 0
3: 11
4: 87
Right 1168904604 20:1393039-1393061 GGCGTGGACCAACAGCGACCTGG 0: 1
1: 2
2: 1
3: 2
4: 46
1168904593_1168904604 22 Left 1168904593 20:1392994-1393016 CCCATGGCGGCGGCGGACGCTGA 0: 1
1: 0
2: 2
3: 2
4: 45
Right 1168904604 20:1393039-1393061 GGCGTGGACCAACAGCGACCTGG 0: 1
1: 2
2: 1
3: 2
4: 46
1168904594_1168904604 21 Left 1168904594 20:1392995-1393017 CCATGGCGGCGGCGGACGCTGAG 0: 1
1: 0
2: 3
3: 17
4: 151
Right 1168904604 20:1393039-1393061 GGCGTGGACCAACAGCGACCTGG 0: 1
1: 2
2: 1
3: 2
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168904604 Original CRISPR GGCGTGGACCAACAGCGACC TGG Exonic
900589007 1:3451249-3451271 GCCAGGGACCAACAGCGACCAGG - Intergenic
901328070 1:8381042-8381064 GGGGTGGGCCAGCAGCAACCAGG - Intronic
906271031 1:44478874-44478896 GGAGTGCACCAACAGCCACGGGG - Intronic
906953959 1:50357374-50357396 GGCGTTGAGCAAGAGCGAGCTGG - Intergenic
907300264 1:53482578-53482600 GAGGTGGACCAACAAGGACCTGG - Intergenic
914463713 1:147908306-147908328 GGCGGGGACTAACGGCGGCCCGG + Exonic
922122387 1:222685406-222685428 GGCTTGGACCAACAGATAACTGG - Intronic
1065945955 10:30605681-30605703 GGCCTGGCCCGACAGTGACCAGG + Intergenic
1070302024 10:75210679-75210701 CACGTGGACCGACAGCGCCCCGG - Intronic
1081536086 11:43997209-43997231 GGCGTGGACCAACATGTAGCAGG + Intergenic
1090360355 11:126168020-126168042 GGTGTGGAGCCACAGGGACCTGG - Intergenic
1108529310 13:51314265-51314287 GGAGTGGAACAACAGACACCGGG + Intergenic
1125759104 15:42085002-42085024 GGTGTGGACCAGCAGGGACAAGG - Intronic
1128549874 15:68591149-68591171 GGCGTGGAACAGCAGTGACAGGG + Intronic
1131310753 15:91287916-91287938 GCCGTGGAGCAAGAGCTACCTGG + Intronic
1131508574 15:93036487-93036509 GGCCGGGACCACCAGGGACCAGG - Intronic
1138553295 16:57758642-57758664 GGCCTGGGCCATCAGCGAACTGG - Exonic
1140195465 16:72851214-72851236 GGTGGGGACCAACAGATACCAGG + Intronic
1151069819 17:71196059-71196081 AGAGGGGACCAACAGCCACCAGG - Intergenic
1151563063 17:74881092-74881114 GGGGTGGGCCAACAGGGATCTGG + Exonic
1156338253 18:36188081-36188103 TGCGTGGACCGCCAGCGCCCGGG + Intronic
1159166808 18:64713163-64713185 GGTGTGGAGCAACACAGACCTGG - Intergenic
1159954648 18:74510635-74510657 GGCCTGGAGCCACAGCGGCCTGG + Intronic
1160777625 19:863211-863233 GGCCTGGATCGACAGCGTCCTGG + Exonic
1162470725 19:10871025-10871047 GGCGTGGCCCAGCCGCGACGAGG - Intergenic
1168614498 19:57826819-57826841 GGTGTGGACCAACAGCGACCTGG + Intronic
942605274 2:177683821-177683843 GGTTTGGACCCACACCGACCTGG + Intronic
945660899 2:212683985-212684007 GGAAGGGACCAACAGGGACCAGG + Intergenic
1168904604 20:1393039-1393061 GGCGTGGACCAACAGCGACCTGG + Exonic
1172742332 20:37179032-37179054 GGCCTGGCCCAACCGCGTCCCGG + Exonic
1178197618 21:30366512-30366534 GGCGTTGACCCACAGTTACCAGG + Intronic
952776767 3:37053907-37053929 GGAGATGACCAACAGCCACCTGG - Exonic
962472629 3:135725877-135725899 GGCAGGGAACAACAGAGACCAGG - Intergenic
963778527 3:149464155-149464177 GGCGTGGACTCACAGCGACCTGG + Intergenic
967017739 3:185496963-185496985 GGAGGGGAACCACAGCGACCTGG + Exonic
968101764 3:195971077-195971099 GGAGTGGACTAACAGAGACTGGG + Intergenic
968645352 4:1737870-1737892 AGCCTGGACCCTCAGCGACCTGG - Intronic
969826298 4:9761235-9761257 GGCCTGGAGAAACACCGACCTGG + Intergenic
976751078 4:88451875-88451897 GGCGTCCACCAACAACCACCTGG - Intergenic
986928995 5:12795065-12795087 GGGGTGGCCCCACAGCGGCCTGG - Intergenic
998253495 5:140568020-140568042 GGCGTTGACCACCAGCGAGCAGG - Exonic
1009396972 6:63211494-63211516 GGCGTGGACCGACAGCGACCTGG - Exonic
1029456103 7:100673398-100673420 GGCGTGGCCCAACCGGGAACTGG + Intergenic
1034495156 7:151416465-151416487 GGCAGTGACCAACAGAGACCAGG - Intergenic
1035315089 7:157992663-157992685 GGGGTGGCCCAACAGAGAGCAGG + Intronic
1038197176 8:25378997-25379019 GGGGTGTACCAACAGGGAGCAGG + Intronic
1038315835 8:26483673-26483695 AGCGTGGACAAACAATGACCAGG - Intronic
1052263529 9:26545720-26545742 GGAGTGGAACAACAGCCACTGGG + Intergenic
1187064313 X:15818387-15818409 GACCTGGACCAACAGGGATCAGG + Intronic
1189348340 X:40259145-40259167 GGCAGGGAGCAACAGCAACCAGG - Intergenic
1192852671 X:74974156-74974178 GGAGGGGAACAACAGCCACCAGG + Intergenic
1199760655 X:150901823-150901845 GGCATGGATAAACAGCCACCAGG + Intergenic