ID: 1168904976

View in Genome Browser
Species Human (GRCh38)
Location 20:1395837-1395859
Sequence CTGCTAGGCTTCAGGGAAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168904976_1168904985 30 Left 1168904976 20:1395837-1395859 CCGTTTTCCCTGAAGCCTAGCAG No data
Right 1168904985 20:1395890-1395912 TCTCTCTCATGGCTCTGAATTGG No data
1168904976_1168904981 7 Left 1168904976 20:1395837-1395859 CCGTTTTCCCTGAAGCCTAGCAG No data
Right 1168904981 20:1395867-1395889 CTTGCCTCACATTCATCCTGTGG No data
1168904976_1168904983 19 Left 1168904976 20:1395837-1395859 CCGTTTTCCCTGAAGCCTAGCAG No data
Right 1168904983 20:1395879-1395901 TCATCCTGTGGTCTCTCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168904976 Original CRISPR CTGCTAGGCTTCAGGGAAAA CGG (reversed) Intergenic
No off target data available for this crispr