ID: 1168904977

View in Genome Browser
Species Human (GRCh38)
Location 20:1395844-1395866
Sequence CCTTATTCTGCTAGGCTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168904977_1168904986 24 Left 1168904977 20:1395844-1395866 CCCTGAAGCCTAGCAGAATAAGG No data
Right 1168904986 20:1395891-1395913 CTCTCTCATGGCTCTGAATTGGG No data
1168904977_1168904981 0 Left 1168904977 20:1395844-1395866 CCCTGAAGCCTAGCAGAATAAGG No data
Right 1168904981 20:1395867-1395889 CTTGCCTCACATTCATCCTGTGG No data
1168904977_1168904983 12 Left 1168904977 20:1395844-1395866 CCCTGAAGCCTAGCAGAATAAGG No data
Right 1168904983 20:1395879-1395901 TCATCCTGTGGTCTCTCTCATGG No data
1168904977_1168904987 30 Left 1168904977 20:1395844-1395866 CCCTGAAGCCTAGCAGAATAAGG No data
Right 1168904987 20:1395897-1395919 CATGGCTCTGAATTGGGTATCGG No data
1168904977_1168904985 23 Left 1168904977 20:1395844-1395866 CCCTGAAGCCTAGCAGAATAAGG No data
Right 1168904985 20:1395890-1395912 TCTCTCTCATGGCTCTGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168904977 Original CRISPR CCTTATTCTGCTAGGCTTCA GGG (reversed) Intergenic
No off target data available for this crispr