ID: 1168904982

View in Genome Browser
Species Human (GRCh38)
Location 20:1395871-1395893
Sequence GAGACCACAGGATGAATGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168904982_1168904987 3 Left 1168904982 20:1395871-1395893 CCTCACATTCATCCTGTGGTCTC No data
Right 1168904987 20:1395897-1395919 CATGGCTCTGAATTGGGTATCGG No data
1168904982_1168904985 -4 Left 1168904982 20:1395871-1395893 CCTCACATTCATCCTGTGGTCTC No data
Right 1168904985 20:1395890-1395912 TCTCTCTCATGGCTCTGAATTGG No data
1168904982_1168904986 -3 Left 1168904982 20:1395871-1395893 CCTCACATTCATCCTGTGGTCTC No data
Right 1168904986 20:1395891-1395913 CTCTCTCATGGCTCTGAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168904982 Original CRISPR GAGACCACAGGATGAATGTG AGG (reversed) Intergenic
No off target data available for this crispr