ID: 1168904985

View in Genome Browser
Species Human (GRCh38)
Location 20:1395890-1395912
Sequence TCTCTCTCATGGCTCTGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168904976_1168904985 30 Left 1168904976 20:1395837-1395859 CCGTTTTCCCTGAAGCCTAGCAG No data
Right 1168904985 20:1395890-1395912 TCTCTCTCATGGCTCTGAATTGG No data
1168904979_1168904985 22 Left 1168904979 20:1395845-1395867 CCTGAAGCCTAGCAGAATAAGGC No data
Right 1168904985 20:1395890-1395912 TCTCTCTCATGGCTCTGAATTGG No data
1168904977_1168904985 23 Left 1168904977 20:1395844-1395866 CCCTGAAGCCTAGCAGAATAAGG No data
Right 1168904985 20:1395890-1395912 TCTCTCTCATGGCTCTGAATTGG No data
1168904980_1168904985 15 Left 1168904980 20:1395852-1395874 CCTAGCAGAATAAGGCTTGCCTC No data
Right 1168904985 20:1395890-1395912 TCTCTCTCATGGCTCTGAATTGG No data
1168904982_1168904985 -4 Left 1168904982 20:1395871-1395893 CCTCACATTCATCCTGTGGTCTC No data
Right 1168904985 20:1395890-1395912 TCTCTCTCATGGCTCTGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168904985 Original CRISPR TCTCTCTCATGGCTCTGAAT TGG Intergenic
No off target data available for this crispr