ID: 1168906390

View in Genome Browser
Species Human (GRCh38)
Location 20:1407388-1407410
Sequence GCTCCCTCTGGGGGTCCTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168906390_1168906398 -2 Left 1168906390 20:1407388-1407410 CCCCTAGGACCCCCAGAGGGAGC No data
Right 1168906398 20:1407409-1407431 GCATAGCCCTGGCAACGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168906390 Original CRISPR GCTCCCTCTGGGGGTCCTAG GGG (reversed) Intergenic
No off target data available for this crispr