ID: 1168909418

View in Genome Browser
Species Human (GRCh38)
Location 20:1435227-1435249
Sequence GGGCAAGCCAATGCAAACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168909418_1168909424 29 Left 1168909418 20:1435227-1435249 CCTCAGTTTGCATTGGCTTGCCC No data
Right 1168909424 20:1435279-1435301 TATGTGAGTATACAGTTGCCAGG No data
1168909418_1168909422 3 Left 1168909418 20:1435227-1435249 CCTCAGTTTGCATTGGCTTGCCC No data
Right 1168909422 20:1435253-1435275 AATTTGCATGTAATTAAAAATGG No data
1168909418_1168909423 4 Left 1168909418 20:1435227-1435249 CCTCAGTTTGCATTGGCTTGCCC No data
Right 1168909423 20:1435254-1435276 ATTTGCATGTAATTAAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168909418 Original CRISPR GGGCAAGCCAATGCAAACTG AGG (reversed) Intergenic
No off target data available for this crispr