ID: 1168910644

View in Genome Browser
Species Human (GRCh38)
Location 20:1444097-1444119
Sequence GGTTGTTGGTGTTTATCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 190}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168910644_1168910646 -6 Left 1168910644 20:1444097-1444119 CCTTGAGATAAACACCAACAACC 0: 1
1: 0
2: 0
3: 17
4: 190
Right 1168910646 20:1444114-1444136 ACAACCCTACTGTGTTCCCAAGG 0: 1
1: 0
2: 0
3: 10
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168910644 Original CRISPR GGTTGTTGGTGTTTATCTCA AGG (reversed) Intronic
903943147 1:26945431-26945453 TCTTCTTGGTGTTGATCTCAGGG - Exonic
904306698 1:29594591-29594613 GGTCTTTTGTGTTTATCTCCTGG + Intergenic
906368816 1:45234959-45234981 GGTGGAAGGTGTTTATATCATGG + Intronic
908047797 1:60190351-60190373 GGTAGGTGGTGTTTAGGTCATGG + Intergenic
908455593 1:64301573-64301595 TCTTGTAGTTGTTTATCTCAAGG - Intergenic
909453720 1:75827386-75827408 TGTTGTTGGTGTTTATATTATGG - Intronic
912894661 1:113574286-113574308 GGTTGTTGGTCTTTATATTTTGG + Intronic
913011625 1:114689107-114689129 GGTTGGTGGAGTTTTTCTGATGG + Intronic
913303271 1:117396187-117396209 TATTGTTGGTGTTTATGACATGG + Intronic
913599978 1:120413787-120413809 GGTTGTTGGTTTTTTTTTTAGGG - Intergenic
916190461 1:162172730-162172752 GTTTGTTTGTTTTCATCTCAAGG + Intronic
918561159 1:185868866-185868888 TGTTGTTAGTGTTTCTCTCCTGG + Intronic
918574367 1:186038642-186038664 GGATCTTGGTGTTTTTCTAAGGG + Intronic
920274715 1:204795515-204795537 AGTTGTTCTTGTTTCTCTCATGG - Intergenic
922299913 1:224289633-224289655 CTTTGTTGGTGCTGATCTCATGG - Exonic
923016581 1:230131048-230131070 GGTTGTTGATTTCTTTCTCAAGG - Intronic
923794399 1:237139640-237139662 GGTACTTGGTGTCTATCTCATGG + Intronic
923926856 1:238638679-238638701 GCTTGTTTGGGTTTATCTCTAGG - Intergenic
924781681 1:247154921-247154943 TGTTGTTGAAGTTTTTCTCATGG - Intronic
1065941224 10:30565643-30565665 GGTTGTAGGTGTTTTCTTCAGGG - Intergenic
1066241725 10:33542917-33542939 GGTGATTGGTGTTTATAGCATGG + Intergenic
1066260117 10:33721327-33721349 GTTTGTTTGTTTTTTTCTCAAGG + Intergenic
1067664749 10:48267618-48267640 GATTGTTGGTGTTTTTGTTAAGG - Intronic
1071201663 10:83226265-83226287 TGTTGTTTGTTTTTATTTCAGGG + Intergenic
1071230836 10:83582618-83582640 GCTTGTTGGTGTTTGCCTCTGGG - Intergenic
1071249500 10:83802713-83802735 TGTTGCTGGTGATAATCTCAAGG + Intergenic
1072178909 10:92960001-92960023 GCTTCTTGGTATTTATCCCAAGG + Intronic
1075740735 10:124694518-124694540 AGATGTTGGTCTTTATTTCAAGG - Intronic
1078299002 11:10106316-10106338 GTTTTTTGGTGTGTATCTAAAGG - Intronic
1078606346 11:12779409-12779431 GGTTGTTGGGGTTTAAATCCTGG + Intronic
1079063304 11:17268555-17268577 TGTTGTTGTTGTTTTTATCAAGG - Intronic
1081243093 11:40730935-40730957 GGTGGGAGGTGTTTGTCTCAAGG + Intronic
1082318457 11:50762487-50762509 AGATGTTTGTGTTCATCTCATGG - Intergenic
1085183413 11:74555558-74555580 TGTTGTTGGTGTTTTTCTTTTGG + Intronic
1085285453 11:75357059-75357081 GATTGTTGGTATTTATCACTAGG + Intergenic
1087000487 11:93414961-93414983 GGTTGTTGTTGTTGCTATCAAGG - Intronic
1087574864 11:99976890-99976912 GGTTTTTCTTTTTTATCTCATGG + Intronic
1087655213 11:100914503-100914525 TGTTGTTGTTGTTGTTCTCAAGG - Intronic
1087842228 11:102932292-102932314 GGTTGTTGGTATATTTCTCAGGG - Intergenic
1090809319 11:130222681-130222703 ACTTTTTGGTGTTTCTCTCAGGG + Intergenic
1090923660 11:131230899-131230921 GGAAGTTTGTGTTTATCTCTGGG - Intergenic
1091080864 11:132666440-132666462 GGTTGGGGGTGTTTAGGTCATGG - Intronic
1093743760 12:22716478-22716500 GGTTGTTTGTCTTTTTCTCAAGG + Intergenic
1095239451 12:39839487-39839509 GATTGCTGGTGGTTGTCTCATGG + Intronic
1095808699 12:46349098-46349120 GGTGCTTAATGTTTATCTCAGGG + Intergenic
1096786950 12:54022218-54022240 GGTTGTTGGGTTTTAAATCAGGG + Intronic
1097034449 12:56113679-56113701 GGTTCTTGGTTTTTCTTTCATGG - Exonic
1098306450 12:69107435-69107457 GGTGGGGGGTGTTTGTCTCACGG - Intergenic
1098510070 12:71301370-71301392 GGCTGATGTTGTTTACCTCACGG + Intronic
1098578907 12:72075686-72075708 GCTTGTTGGTGTTGATTACATGG + Intronic
1099065678 12:77975569-77975591 TGTTGTCGGTGAATATCTCAGGG + Intronic
1099215416 12:79847105-79847127 TGTTGATAGTGTTTATCTCTGGG - Intronic
1099370772 12:81826993-81827015 GGTTTTTAGTCTTTATATCATGG - Intergenic
1099785681 12:87260292-87260314 GGAAGTTTGTGTTTTTCTCAAGG - Intergenic
1101083458 12:101211714-101211736 GGATATTGGTTTTTATCTCACGG + Intergenic
1103469412 12:121168039-121168061 GGTTGTTATTGATTATTTCAGGG - Intronic
1104274846 12:127317190-127317212 GCTTGCTGGTGCTTCTCTCAGGG + Intergenic
1105934200 13:25083875-25083897 GATTGTTGGTTTTTTTCTTATGG - Intergenic
1106747971 13:32724121-32724143 TGTTGTTGTTGTTTGTGTCAGGG + Intronic
1110757365 13:79191375-79191397 TGTTGTTGTTGTTTTTCTTATGG - Intergenic
1111934215 13:94542827-94542849 GGTTTTTTGGGTTTATTTCAGGG - Intergenic
1116203209 14:41825620-41825642 AGTTGTTGGTGTATATTTCCAGG + Intronic
1116717126 14:48441596-48441618 GTTTGTTTGTTTTTATGTCATGG - Intergenic
1116881602 14:50175767-50175789 TGTGGTTGGTGTTTTTCTTATGG - Intronic
1118179372 14:63476261-63476283 TGTTGTTGTTGTTGTTCTCATGG + Intronic
1119150615 14:72356209-72356231 GGTGGTAGGTGATTAGCTCATGG + Intronic
1121717601 14:96087360-96087382 TGTTGGTGGTTTTTATCTCCTGG + Exonic
1123043950 14:105502468-105502490 AGTGGTTCCTGTTTATCTCATGG + Intergenic
1127409419 15:58691000-58691022 GGTGGTTGGGGTTGATCTCCAGG + Intronic
1128284849 15:66428333-66428355 GGTTATTGATGTTTATTTTAGGG + Intronic
1130949830 15:88577084-88577106 GGTTTTTTGTGTCTATGTCATGG - Intergenic
1138518931 16:57559285-57559307 GGGTGCAGGTGTTTATCTCTCGG + Intronic
1141291150 16:82719132-82719154 GGTTGTTGCTGTTTTTCTGCTGG + Intronic
1141383994 16:83602601-83602623 GGTGGTTGGTGTTTGGCACAGGG - Intronic
1149373269 17:56018077-56018099 GGTTGTGTGTGTCTATCTCTGGG + Intergenic
1149521016 17:57318358-57318380 GGTTGTCTGTGTCTCTCTCATGG + Intronic
1151186718 17:72370122-72370144 TGCTGTTGGTGTTTGTTTCAGGG - Intergenic
1153175007 18:2361804-2361826 TGTTGTTTTTGTTTATCTCAGGG + Intergenic
1158218382 18:55124292-55124314 GGCTTTTGGTGTTTGTCTCCTGG - Intergenic
1159262055 18:66026873-66026895 GGTTATGGGTCTTTATCTGATGG + Intergenic
1161091406 19:2361527-2361549 GGTTGTTGGTATTTGCCTGAGGG + Intergenic
1161881349 19:6955662-6955684 GGGTGTTGGTGATTATATGATGG + Intergenic
1162635405 19:11963998-11964020 GTTTGAGGGTGTTTGTCTCATGG + Intronic
1164579645 19:29426718-29426740 TGTTGTTGTTGTTTAGATCAGGG + Intergenic
1164954753 19:32372721-32372743 GGATGTTGGTGTTTTTCTCTCGG - Intronic
1168598225 19:57696164-57696186 GGTTGTTGGGGACTTTCTCAAGG + Intronic
927219325 2:20692613-20692635 TGTTGTTGGTGTTAACCTTATGG + Intronic
931683238 2:64769908-64769930 GGTTGTAGGTTTTTCTGTCATGG - Intergenic
931875040 2:66503254-66503276 GGTTGTGGGTGTTCATCCCTAGG - Intronic
935173819 2:100630615-100630637 GGTTGCTGTTTCTTATCTCAAGG - Intergenic
936279497 2:111124937-111124959 GGTTGTAGGTTTTTATTTCAGGG + Intronic
936759839 2:115763799-115763821 GGATGTTGGTCTTTATCTGAAGG - Intronic
937110665 2:119364867-119364889 TGTTGTTGGTCTTGATCTCCTGG - Intronic
939569782 2:143827152-143827174 TGTTGTTGTTGTTCATGTCATGG - Intergenic
940067549 2:149646913-149646935 GGTGGTTGGTGTTTCTCTTCTGG - Intergenic
941643336 2:168012736-168012758 GGTTGTTGATTTTTATGTTATGG - Intronic
946628289 2:221638725-221638747 TGTTGTGTGTGTTTATTTCAAGG - Intergenic
947488728 2:230575760-230575782 GGATTCTGGTGTTTAGCTCAGGG - Intergenic
948681655 2:239639297-239639319 GTTTAATGTTGTTTATCTCAAGG - Intergenic
948720406 2:239896006-239896028 GGTTGTTGGTGTTATTCACAAGG + Intronic
948730850 2:239962942-239962964 GGTGGGTGGTGTTTAGGTCATGG - Intronic
1168910644 20:1444097-1444119 GGTTGTTGGTGTTTATCTCAAGG - Intronic
1169243984 20:4010396-4010418 GTATTTTTGTGTTTATCTCATGG - Intronic
1170312861 20:15011778-15011800 GGGTCATGGTGTTTAGCTCAGGG + Intronic
1173690163 20:44954557-44954579 AGTTATTGGCTTTTATCTCATGG - Intronic
1174788193 20:53452822-53452844 TGTTGTTTGTGTTTTTCTCAAGG + Intronic
1175214998 20:57387533-57387555 TCGTGTTGGTGTTTATATCAAGG - Intergenic
1175700300 20:61131963-61131985 GGCTGCTGGTCTTTATCTCCAGG + Intergenic
1176963232 21:15183279-15183301 GCTTTCTGGTGTTTTTCTCAAGG - Intergenic
1177953843 21:27571854-27571876 GTTTGTTGATGTTTATATCCAGG - Intergenic
952489656 3:33855843-33855865 TGTTGTTTTTGTTTAGCTCATGG - Intronic
952528405 3:34238051-34238073 GGTTGGAGTTGTTTTTCTCAAGG - Intergenic
952600756 3:35079378-35079400 CACTGTTGGTGTTTAACTCATGG + Intergenic
952818826 3:37468370-37468392 GGTTCTAGGTGTTGAGCTCAGGG + Intronic
953757048 3:45655716-45655738 AGTTTTTGGTGTTTATCCCTCGG + Intronic
955333930 3:58069642-58069664 GGTTCTTGGTGTTGCTCTGAGGG - Intronic
955512335 3:59694050-59694072 GGTTGATATTGTTTATTTCAAGG + Intergenic
955807996 3:62756932-62756954 GGTTGTTGGTCTTCATTTTAAGG + Intronic
956575102 3:70743946-70743968 GCTGATTTGTGTTTATCTCATGG + Intergenic
957957600 3:87208705-87208727 GGTTGTTGGTGATTCTCACAAGG - Intergenic
959617848 3:108368257-108368279 TGTTGTTGGTCTTTATATTATGG - Intronic
960737812 3:120799697-120799719 GGTTCTTGGAGTTTCCCTCAAGG - Intergenic
961947200 3:130703951-130703973 GGTTGTTGGTTATTATAACAGGG - Intronic
963968849 3:151406497-151406519 GGATGTTTGTGATTTTCTCAGGG + Intronic
963977720 3:151500799-151500821 GGTTGTTGTTGTCAAACTCAAGG + Intergenic
967945562 3:194801340-194801362 GGTTGTTGGGGTTTAAATCCTGG - Intergenic
970175808 4:13338350-13338372 GGTGGTTGGGGTTGATCTCCAGG - Intergenic
972767158 4:42161787-42161809 GGTTATTGGTGTTTAAGTCAAGG + Intergenic
972967358 4:44527329-44527351 TGTTGTTGTTGTTTAGCTAAAGG + Intergenic
975571676 4:75824225-75824247 GGTGGTTTTGGTTTATCTCAGGG - Intergenic
978126349 4:105140399-105140421 TGTTGTTGTTGTTATTCTCATGG - Intergenic
981989848 4:150904726-150904748 GGTTGTAGCTTTTTATCTCCAGG - Intronic
983539661 4:168895678-168895700 GGTTGGTCTTGCTTATCTCAGGG + Intronic
986744908 5:10735279-10735301 GGTTGTTGGTATTTGTAACATGG - Intronic
986788745 5:11140134-11140156 GGTTTTTGGTGATTAGCACAGGG + Intronic
987942063 5:24551917-24551939 GGTTCTTGGTCTTTATGACATGG + Intronic
992092482 5:73329977-73329999 AGTTGTTGGGGTTTGTCTTACGG + Intergenic
992512454 5:77451658-77451680 GGGTGATGGTGATTATCTTAAGG - Intronic
995315430 5:110766224-110766246 TTTTCTTGGTGTTTATCTCAAGG - Intergenic
997914102 5:137906937-137906959 GGTCTTTGGTGTTTCTTTCAGGG - Intronic
998044422 5:138974955-138974977 GCTTGTTGCTGTATATCTCTGGG - Intronic
998278743 5:140783988-140784010 AGTTGTGGGTGTTTGTGTCATGG + Intergenic
998920824 5:147065877-147065899 GCTTGTTGGCATTTAGCTCACGG - Intronic
999599166 5:153241654-153241676 TATTGTTGGTGGTTCTCTCAAGG + Intergenic
1000048223 5:157539194-157539216 TGTTGATGGTGATTATCTCAGGG + Intronic
1001133721 5:169084981-169085003 GGTTGTTGTTGTTGATAGCAGGG - Intronic
1001776620 5:174333649-174333671 ACTTCTTGGTGTTTATCTAAAGG - Intergenic
1002151308 5:177233724-177233746 AGTAGTTGGTGCTTATTTCAGGG + Intronic
1002597117 5:180331278-180331300 GGGCATTAGTGTTTATCTCAAGG - Intronic
1002629664 5:180562874-180562896 GGTTGTAACTGCTTATCTCACGG + Intronic
1003488564 6:6600740-6600762 GGATTTTGGTGTTTATCTGATGG - Intronic
1005192760 6:23244582-23244604 GGTTGTTGTTGGTTATTTAAGGG - Intergenic
1008048827 6:46879364-46879386 GGTGGTAGGTGATTTTCTCATGG + Intronic
1009796509 6:68475936-68475958 GGTTGTCTGTGTTTTTCCCAAGG - Intergenic
1010148897 6:72706989-72707011 GTTTCTTGGTTTTTATATCAGGG + Intronic
1010250280 6:73700051-73700073 GGTGTTTGGTGTTTATGTGATGG - Intronic
1012591686 6:100989299-100989321 GGTTGTTCCTGTTTATCTTACGG + Intergenic
1012952505 6:105533790-105533812 GGTGGTTCTTGTTTATCACAAGG + Intergenic
1013653976 6:112226098-112226120 GGATCTTGGTGTTTCTCTCTCGG + Intronic
1013688771 6:112615896-112615918 GGTTCTTGGTTTTTCTTTCAAGG + Intergenic
1014192629 6:118515493-118515515 GTTTGTTGGTGCTTGTTTCATGG - Intronic
1016566436 6:145460322-145460344 GTTTGTTGGTGACAATCTCAGGG - Intergenic
1017693234 6:156988395-156988417 TGTTTTTTGTGCTTATCTCAGGG + Intronic
1020634030 7:10674495-10674517 GGTTGATGGTTTTTATGTCTGGG - Intergenic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1020986617 7:15143012-15143034 GATTGTTGGGGTTTATATCCTGG - Intergenic
1023562038 7:41485509-41485531 GCTTGTTGCTGTTTATCTACTGG + Intergenic
1024387571 7:48770605-48770627 TGTTATTGGAGTTCATCTCATGG + Intergenic
1024443425 7:49448494-49448516 AGTTGTTGCTGCTTGTCTCATGG - Intergenic
1025223501 7:57136420-57136442 TGTTGTTGTTGTTTGTTTCAGGG - Intronic
1025634304 7:63308044-63308066 TGTTGTTGTTGTTTGTTTCAGGG - Intergenic
1025648394 7:63440122-63440144 TGTTGTTGTTGTTTGTTTCAGGG + Intergenic
1026765279 7:73155827-73155849 ATTAGTGGGTGTTTATCTCAAGG + Intergenic
1027041753 7:74965583-74965605 ATTAGTGGGTGTTTATCTCAAGG + Intronic
1027081889 7:75236786-75236808 ATTAGTGGGTGTTTATCTCAAGG - Intergenic
1029390476 7:100271330-100271352 ATTAGTGGGTGTTTATCTCAAGG - Intronic
1030434129 7:109493640-109493662 TGTTGTTGTTGTTTTTATCAGGG + Intergenic
1033034706 7:137863402-137863424 AGATGGTGGTGTTTGTCTCAGGG + Intergenic
1040597599 8:48854681-48854703 TGTTGTTGTTGTTTAGATCAGGG - Intergenic
1042141160 8:65680146-65680168 CTTTGTTGGTTTTTTTCTCAGGG + Intronic
1042851005 8:73216192-73216214 GGTGGTTGGGGTTGATCTCCAGG + Intergenic
1045136121 8:99220419-99220441 GTTTGTTTGTGTTGATGTCATGG + Intronic
1046753460 8:117948873-117948895 GGTTGTTGGTTTTTAATTCTTGG + Intronic
1046822973 8:118654757-118654779 GTTTGTTGGGGTTCAGCTCAGGG + Intergenic
1046907627 8:119590926-119590948 TGTTGTTGTTGTTTAAATCATGG - Intronic
1046922714 8:119750010-119750032 CTTTGGTGGTGTTTGTCTCAAGG - Intronic
1047799282 8:128292140-128292162 TGTTGTTGTTGTTTTTATCAAGG - Intergenic
1048866284 8:138764138-138764160 GGTTCTTGGTTTTCAGCTCATGG + Intronic
1049037576 8:140088390-140088412 GTTTGTTCTTGTTTATCTCTAGG - Intronic
1050212831 9:3282779-3282801 TGTTGTTATTGTTTATCTCTTGG - Intronic
1050537574 9:6644375-6644397 GGTTCTTGGTCTTTATCCTAGGG - Intronic
1050706652 9:8407194-8407216 ATTTGTTGGTCTTCATCTCATGG - Intronic
1052084592 9:24248661-24248683 GGTTGTTGATTTTTAGCCCATGG - Intergenic
1053510091 9:38680369-38680391 GGTTATCGGTCTTTGTCTCAAGG + Intergenic
1055270838 9:74556655-74556677 TGTTGTTGCCATTTATCTCATGG - Intronic
1056514916 9:87341151-87341173 GGTTGTTTGTGCCTATCTAAAGG + Intergenic
1056959187 9:91106493-91106515 GGTTTTTGGTGTTGCTCTCTAGG + Intergenic
1059238848 9:112785740-112785762 GGTTGTTGGTCTTGAACTCCTGG + Intronic
1185627755 X:1494308-1494330 GGCTGCTGGTGTCTGTCTCAAGG - Intronic
1186554454 X:10543074-10543096 GGGTGTTGAGATTTATCTCATGG - Intronic
1190251033 X:48725820-48725842 CTTTGTTGGTGTATGTCTCAGGG - Intergenic
1190539646 X:51463972-51463994 GGTGGATGGTGTTTAGATCATGG - Intergenic
1195407063 X:104526393-104526415 GGTTGTTTGTGCTTCTCTTATGG + Intergenic
1196466430 X:115976309-115976331 CGTTTTTTGTGTTTATTTCATGG - Intergenic
1196937392 X:120743344-120743366 GGTGGTTTGTGTTCTTCTCAGGG - Intergenic
1197383356 X:125773090-125773112 GCTTGTTGCTGTTTCTCCCATGG + Intergenic
1199118680 X:144024473-144024495 GGTTGTGTGTGTTTATTTCTGGG - Intergenic
1200917306 Y:8582642-8582664 GGTTGTGGGTCATTGTCTCATGG + Intergenic