ID: 1168911359

View in Genome Browser
Species Human (GRCh38)
Location 20:1449808-1449830
Sequence ATTTTTGTGGAGAAGATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 544
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 505}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168911359_1168911362 -8 Left 1168911359 20:1449808-1449830 CCAGCCATCTTCTCCACAAAAAT 0: 1
1: 0
2: 4
3: 34
4: 505
Right 1168911362 20:1449823-1449845 ACAAAAATAACCACTACAGAAGG 0: 1
1: 0
2: 2
3: 39
4: 410
1168911359_1168911363 -3 Left 1168911359 20:1449808-1449830 CCAGCCATCTTCTCCACAAAAAT 0: 1
1: 0
2: 4
3: 34
4: 505
Right 1168911363 20:1449828-1449850 AATAACCACTACAGAAGGCACGG 0: 1
1: 0
2: 0
3: 12
4: 204
1168911359_1168911364 -2 Left 1168911359 20:1449808-1449830 CCAGCCATCTTCTCCACAAAAAT 0: 1
1: 0
2: 4
3: 34
4: 505
Right 1168911364 20:1449829-1449851 ATAACCACTACAGAAGGCACGGG 0: 1
1: 0
2: 0
3: 7
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168911359 Original CRISPR ATTTTTGTGGAGAAGATGGC TGG (reversed) Intronic
900669489 1:3841922-3841944 GTCTTTGTGGAGAGGCTGGCAGG + Intronic
900790363 1:4675853-4675875 ATTTTAGGAGAGAAGATGGATGG + Intronic
900800992 1:4736994-4737016 ATTTTTCTCTAGATGATGGCTGG - Intronic
900909671 1:5586193-5586215 ATTTGTGGGGAGGAGCTGGCAGG + Intergenic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
904071129 1:27798339-27798361 ATTTTTGTAGAGATGTTGCCCGG - Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904217871 1:28938227-28938249 ATTTTTGTGGAAAAGGTAGTTGG + Intronic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
904746329 1:32713435-32713457 GTTTTTCTGGAGAAGATGGCTGG - Intergenic
904885944 1:33738502-33738524 AGTTTGGTGGAACAGATGGCTGG + Intronic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
906101400 1:43266006-43266028 TTTTTTGGGTAGCAGATGGCGGG - Intronic
906879674 1:49576460-49576482 AGTTATGTGCAGAAAATGGCAGG - Intronic
909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910297429 1:85664038-85664060 CTTCTTGTGGAGAATATTGCAGG + Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910588215 1:88901724-88901746 AATTATCTGCAGAAGATGGCAGG - Intergenic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912820835 1:112866413-112866435 ATGATTGTGGAGAACATGACTGG - Intergenic
913088986 1:115463422-115463444 ATTTTGGTGGAGCAGAGGGGTGG - Intergenic
914860939 1:151385649-151385671 TTTTTTGTAGAGATGGTGGCTGG + Intergenic
915452888 1:156019080-156019102 ATTTTTTTGGAGAAGCAGGCAGG - Intronic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
916757912 1:167790895-167790917 ATTTTTGAAGAAAAGAAGGCAGG - Exonic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
917540092 1:175903522-175903544 ACCTTTGTGGAGAAGATTTCTGG - Intergenic
918747479 1:188223537-188223559 AGTATTGTGGAGAGGATGGAGGG - Intergenic
918755717 1:188337811-188337833 AGTTATCTGGAGAAGATGGAAGG + Intergenic
918889732 1:190250971-190250993 ATTTGGGTGGTGAAGATGGGAGG + Intronic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
919873917 1:201847016-201847038 ATCTTGGAAGAGAAGATGGCTGG + Intronic
922057253 1:222053043-222053065 ATTTTTGTGGAGAGGAGTGATGG + Intergenic
923438751 1:233995329-233995351 TTTGTTGTGAAGGAGATGGCAGG + Intronic
923521223 1:234736341-234736363 ATTTGTCGGGTGAAGATGGCAGG - Intergenic
923706319 1:236347795-236347817 ATTTTGGCTAAGAAGATGGCAGG - Intergenic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1062870273 10:895997-896019 CTTTCTGTGGGAAAGATGGCAGG - Intronic
1063546108 10:6983576-6983598 CTTTTTGTAGAGACGTTGGCCGG - Intergenic
1064152338 10:12875214-12875236 ATTTTTCTGTAGAACTTGGCTGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1065094208 10:22264551-22264573 ATTTTTGTAGAGATGGTGGTCGG - Intergenic
1066565589 10:36718597-36718619 CTTTTTGTGGAGATGAGGTCTGG - Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067424155 10:46190274-46190296 ATTTTTGGGGAGAAGGGGACAGG - Intergenic
1067829997 10:49606126-49606148 ATTTCTGTGGAGAAGCAGGCTGG - Intergenic
1068135068 10:52944244-52944266 ATTTTTGTGGAGAAGAATCAAGG - Intergenic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069653491 10:70069591-70069613 ATGTTTGGAGAGAATATGGCTGG - Intronic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1070044947 10:72823880-72823902 ATTTTTGTGGAGATGAGGTTTGG - Intronic
1070860562 10:79655522-79655544 ATTTTTGGGGAGAAGGGGACAGG - Intergenic
1070876704 10:79820027-79820049 ATTTTTGGGGAGAAGGGGACAGG + Intergenic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073938520 10:108664728-108664750 ATTATTGTGAGGGAGATGGCAGG - Intergenic
1074031162 10:109689865-109689887 AGTTTTCTAGAGAAGATTGCAGG - Intergenic
1074229980 10:111524020-111524042 TTTTTTGGGGAGAAAATGGAAGG + Intergenic
1075139955 10:119823772-119823794 ATGTTTATGGAGAAATTGGCAGG + Intronic
1075158638 10:120003009-120003031 ATGGTTGTGGAGAAGATTCCTGG + Intergenic
1076175651 10:128366026-128366048 ATGGTTGTGTAGAAGCTGGCAGG + Intergenic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1078093461 11:8282237-8282259 ATATTTGAGAAGAAGGTGGCTGG + Intergenic
1078370398 11:10739905-10739927 TTTTTTGTGGAGAGGAAGGTGGG - Intergenic
1078488818 11:11750188-11750210 ATTTCAGTGGAGGAGATGGAAGG + Intergenic
1078502298 11:11892631-11892653 ATTTTTGTAGAGATGGTGTCTGG - Intronic
1078627660 11:12972279-12972301 CTTTTTATGGAAAAGTTGGCTGG + Intergenic
1080220502 11:29897261-29897283 ATTATTGAGGAGAAGATGTCTGG + Intergenic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081609059 11:44547850-44547872 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083054264 11:59804665-59804687 TAATCTGTGGAGAAGATGGCTGG + Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1083102732 11:60326769-60326791 AATTCTGTGCAGAAGAAGGCAGG - Intergenic
1084142351 11:67240958-67240980 ATTTTTGTGGGGAATAGGGAAGG - Intronic
1084478925 11:69405868-69405890 ATTTCTTTAAAGAAGATGGCCGG - Intergenic
1084657064 11:70525810-70525832 AGTTTTGTGGAGGTGATGGCGGG + Intronic
1085279256 11:75319611-75319633 ATTTTTGTGCAGTGAATGGCTGG - Intronic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1088671328 11:112144412-112144434 ATTTTTGTAGAGAAGGGGTCAGG + Intronic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1091051736 11:132378728-132378750 AATTATTTGTAGAAGATGGCAGG - Intergenic
1091279725 11:134374978-134375000 GTTTTTGAGGAGACGATGGCGGG + Exonic
1091904465 12:4172959-4172981 ATTTTTGTGGAAAACAGGGTAGG + Intergenic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093120515 12:15265965-15265987 AATGTTGTGGAGATGTTGGCAGG + Intronic
1093521664 12:20058197-20058219 ATTTTTGTGTTCAAAATGGCAGG + Intergenic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094013060 12:25829453-25829475 ATTCTTTTGGAGCAGATGGTTGG - Intergenic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094531404 12:31278741-31278763 CTTTTTGTGGAGAAAACTGCTGG - Intergenic
1095528885 12:43161300-43161322 ATTTTTGGGGAGGTGGTGGCTGG - Intergenic
1095818700 12:46453101-46453123 ATTTGTGTGGTACAGATGGCAGG + Intergenic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096014126 12:48252154-48252176 ATTTTAGTAAAGAAGATGGAAGG - Intergenic
1096127389 12:49129957-49129979 TTTTTTGTGGAGATGAGGTCTGG + Intronic
1096173055 12:49489448-49489470 ATTTATCTGGAAAAGATGACAGG - Exonic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1096683318 12:53271397-53271419 TTTTTTGTAGAGATGATGTCTGG + Intronic
1097021519 12:56024044-56024066 ATATTTGTGTAGAAGATTGTGGG + Intronic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099667586 12:85652210-85652232 ATTCTTGTGCAGAATATTGCAGG + Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099925257 12:89009152-89009174 ATTTTTGTGGAGAAGAGGGGAGG - Intergenic
1100054162 12:90489173-90489195 ATTTATGTTGAGCTGATGGCAGG - Intergenic
1100229199 12:92589987-92590009 GTTCTTGGGGAGAAAATGGCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101057016 12:100928135-100928157 ATTTCAGAGGAGCAGATGGCAGG + Intronic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1101862734 12:108496308-108496330 ATTTTTGTGAAGGAGATGGCAGG - Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1103434605 12:120915151-120915173 GCTTTTGTGGAGAAAATGGAGGG - Intergenic
1106523443 13:30518917-30518939 ATTTTTGTAGAGATGGGGGCTGG + Intronic
1106997647 13:35506244-35506266 ATTTTTGTAGAGAATAGGTCTGG + Intronic
1107336458 13:39361005-39361027 ATTCTTGTGTTGATGATGGCCGG - Intronic
1107455644 13:40552333-40552355 ATTTTTGTGGACCAGGTGACTGG + Intergenic
1108340868 13:49496800-49496822 CTTTTTGAGGAGAGGATGGCTGG + Intronic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1109315832 13:60748116-60748138 ATATTTGTGGAAGAGATGGAAGG - Intergenic
1109712683 13:66180849-66180871 AGTTTTCTACAGAAGATGGCAGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1111605389 13:90531942-90531964 ATATCTGTGGAGATGATGGGTGG + Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG + Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1114667307 14:24386855-24386877 AGTGTTGTGGAAAAGATCGCCGG - Intergenic
1115231610 14:31166671-31166693 TTTTTTGTGGAGATGAGGTCTGG - Intronic
1116055190 14:39855106-39855128 ATTTTCATAGAGAAGAGGGCTGG + Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118226325 14:63902871-63902893 TTTTTTGTTGAGATGAAGGCTGG + Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1119310236 14:73640194-73640216 TTTTTGGTGGAGAAGGTGGAAGG - Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1121015355 14:90545688-90545710 ATTTTTGTTTAGAAAGTGGCAGG + Intronic
1121041152 14:90749270-90749292 ATTTTTGAAGATAAAATGGCTGG - Intronic
1121618422 14:95329683-95329705 ATTCTTCTGGGGCAGATGGCAGG + Intergenic
1124809676 15:32922918-32922940 ATTTTAATGGGGAAAATGGCAGG + Intronic
1125182913 15:36897739-36897761 ATTTTTAGGGAGAAGCTAGCTGG - Intronic
1126283607 15:46986250-46986272 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1129480417 15:75820823-75820845 ATTTTTGTAGAGATGAGGTCTGG + Intergenic
1129542679 15:76363792-76363814 AGTTTTGTGGAGAGGAATGCAGG - Intronic
1131098728 15:89671914-89671936 ATTTTTGTGAAGAAGAATGATGG + Intronic
1131559039 15:93423624-93423646 AGTTTTGTAGAGCAGTTGGCTGG + Intergenic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1133855244 16:9543564-9543586 ATTATAGTGGAGGAGATGGGTGG - Intergenic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1138128583 16:54458840-54458862 ATTCTAGTTGAGGAGATGGCAGG + Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1139101919 16:63777829-63777851 ATTTTTATGGATAAAATGGTTGG - Intergenic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1143144818 17:4768005-4768027 TTTTTTGTGGAGATGAAGACAGG - Intergenic
1143346885 17:6256271-6256293 ATGTATGTGGAGAAGAGGGAGGG + Intergenic
1145024180 17:19455371-19455393 TTTTTTGTGGAGAAGTTTTCAGG - Intergenic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1147877558 17:43632361-43632383 ATCTCTGTGGAGCAGATGCCAGG - Intergenic
1148044440 17:44734071-44734093 ATTTCTGTGGAGAAGACAGAGGG - Exonic
1148987889 17:51639420-51639442 ATATTTGTGGAAAAGATTGGGGG + Intronic
1149295048 17:55254407-55254429 TTCTTTGTTAAGAAGATGGCAGG - Intergenic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1151099356 17:71538984-71539006 ATTTTTAAGGAGGAGATGGAGGG - Intergenic
1151929342 17:77221709-77221731 ATTTTTGTAGAGATGAGGTCTGG + Intergenic
1152732415 17:81978758-81978780 CTTTTTATGGAGAAGAGGGGCGG + Intronic
1203172795 17_GL000205v2_random:165829-165851 AATTTTGTGGAAAAGGGGGCAGG - Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153412801 18:4812482-4812504 ATTTTGGTTGAGAAGATGTAAGG - Intergenic
1153458777 18:5310558-5310580 ACCTTTGTGGAGTAAATGGCTGG - Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155947285 18:31869517-31869539 ATTTTTGTGGGGAAGATTCCAGG - Intronic
1156058220 18:33037354-33037376 GTTTTTGTGGAGAAAATTCCTGG - Intronic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1157341198 18:46779996-46780018 AGTTATCTGGAGAAGATGGCAGG - Intergenic
1157539262 18:48488072-48488094 ATTGTTGTGGAGGAGGTGGTGGG - Intergenic
1158457866 18:57623287-57623309 ATTTTTGTGGAGATGGGGGAGGG + Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1160175935 18:76594037-76594059 AGTTTTGGAGGGAAGATGGCAGG - Intergenic
1160414230 18:78696907-78696929 AGTTTTGTGGAGATGGCGGCAGG - Intergenic
1160534132 18:79583302-79583324 ACATTTGTGGAGAAGATGGGTGG - Intergenic
1160559074 18:79745182-79745204 ATTTTTGTGGGGAAGATGAGTGG + Intronic
1160605589 18:80047261-80047283 CTTTTTGGGGAGGAGGTGGCAGG - Intronic
1160705293 19:526797-526819 TTTTTTGTGGAGACGAGGTCTGG + Intergenic
1161529620 19:4780016-4780038 ATTTTGGTGGACAAGATGGGAGG - Intergenic
1162670211 19:12250927-12250949 TTTCTTTTGGAGAAGTTGGCTGG + Intronic
1164382711 19:27748721-27748743 ATTTTTGTGGGCAAGATTACTGG - Intergenic
1164485734 19:28654465-28654487 ATTTTTGTGAAGGAGATGAGTGG - Intergenic
1164824987 19:31278396-31278418 AGTTTTGGGGAGATGCTGGCAGG + Exonic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
925210433 2:2041078-2041100 ATTTTTCTGGATAAAATGTCAGG - Intronic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
927322647 2:21765466-21765488 ATTTTTGTGGAGAGGTTTTCTGG - Intergenic
929243319 2:39675173-39675195 ATTTTTGTATAGAAGATGTAGGG + Intronic
929328557 2:40649195-40649217 AATTTTGAGGAGAAGAAGGGAGG - Intergenic
929622454 2:43369270-43369292 ATTCATGTGGAGAAGTGGGCAGG - Intronic
931381966 2:61762049-61762071 ATATCTCTGGAGAGGATGGCAGG + Intergenic
932687743 2:73887479-73887501 ATTTTTGTGGAGGAGGCGGGAGG - Intergenic
932986943 2:76737661-76737683 CTTTCTGTGGAGAATAGGGCAGG + Intergenic
934525824 2:95050903-95050925 AATTGTGTGAAGAAGATGGAGGG - Intronic
935081919 2:99806747-99806769 ATCTTTGTTGGGAAGATGACTGG + Intronic
935414167 2:102797953-102797975 AGCTTTGTAGAGAAAATGGCTGG - Exonic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
935839098 2:107089451-107089473 AGTTTTCTGGAGAAGGTGGTGGG - Intergenic
936892100 2:117383610-117383632 TTTTTTGTGGAGATGAGGTCTGG + Intergenic
937531189 2:122829577-122829599 ATTTATCTGCAGAGGATGGCAGG - Intergenic
937800324 2:126074699-126074721 ACTTATCTGAAGAAGATGGCAGG - Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939858544 2:147390572-147390594 AGTTTTGTGGAGAAGATTCCAGG - Intergenic
940012479 2:149069545-149069567 ATTTATGTTGAGAAGCTGGTTGG + Intronic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
943006893 2:182395812-182395834 AGTTATCTGGAGAAGATGGCAGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
945491750 2:210464351-210464373 ATTTTTGTTGAAAAGATAGATGG + Intronic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
945846475 2:214950924-214950946 CTTTTTGTGGATAAGTTGGTAGG + Exonic
945903944 2:215569595-215569617 TATTTTGTGGAGAAGAAGTCAGG + Intergenic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947234903 2:227930546-227930568 TTTTTTGTAGAGATGAGGGCTGG + Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
947507435 2:230719594-230719616 ATTCTTGTAGAGAAGATGGGAGG + Intronic
947877635 2:233478195-233478217 GTTTTTGAGGAGTAGAAGGCTGG + Intronic
1168911359 20:1449808-1449830 ATTTTTGTGGAGAAGATGGCTGG - Intronic
1170020503 20:11832128-11832150 ATTTCTATAGAGAAGATGGATGG - Intergenic
1170404105 20:16018549-16018571 ATTTTGGTGGGGAAGATGGAAGG - Intronic
1171414584 20:24969025-24969047 CTGTTTGTGGAGAACATGCCTGG - Exonic
1172475038 20:35230317-35230339 ATTTTTGGGGAGAGGAAGGTTGG + Intronic
1174477948 20:50810529-50810551 ATTCTGGTGGGGAAGATGACAGG + Intronic
1175279769 20:57795194-57795216 ATTTTTGTGGGGGAAATGGAGGG + Intergenic
1175868876 20:62197900-62197922 GTTTCAGTGGAGAAGATGGAGGG + Exonic
1176328788 21:5527612-5527634 AATTTTGTGGAAAAGGGGGCAGG - Intergenic
1176398969 21:6293339-6293361 AATTTTGTGGAAAAGGGGGCAGG + Intergenic
1176438188 21:6695765-6695787 AATTTTGTGGAAAAGGGGGCAGG - Intergenic
1176462450 21:7022835-7022857 AATTTTGTGGAAAAGGGGGCAGG - Intergenic
1176486011 21:7404613-7404635 AATTTTGTGGAAAAGGGGGCAGG - Intergenic
1176659887 21:9624277-9624299 ATTCCTGTGGAGAAGGAGGCTGG + Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178979394 21:37249693-37249715 TTTTTTGAGGGGGAGATGGCGGG + Intronic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1179473698 21:41629861-41629883 ATTTTTGTAGAGATGAGGTCTGG - Intergenic
1180100610 21:45582277-45582299 ATTTTTCTGGAGAGTATGGCGGG + Intergenic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1183973512 22:41496366-41496388 ATTTGTGTGTAGAACATGGTGGG + Intronic
1184180372 22:42819336-42819358 ATTCTTCTGGAGAAGATGCATGG + Intronic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
1184932480 22:47691593-47691615 CTTTTTGCGGAGAAGATTCCTGG + Intergenic
1185268299 22:49916672-49916694 ATTTTTGTGGAGATGGGGTCTGG - Intronic
1185373016 22:50469597-50469619 GTTTGTGTGGAGGAGAAGGCAGG - Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
949735062 3:7162265-7162287 ACTTCAGTGGAGAAGATGCCTGG + Intronic
949994444 3:9605280-9605302 ATTTTTATGGATAATTTGGCAGG + Intergenic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
952657096 3:35800009-35800031 ATTTCTGTGGAAAAGATTGGAGG - Intergenic
953295315 3:41709970-41709992 ATTTTTGTGGAAGAGATCACAGG + Intronic
954054115 3:48007647-48007669 AGTTATCTGTAGAAGATGGCAGG - Intronic
954424108 3:50434356-50434378 AAGTTGGTGGAGAAGGTGGCAGG - Exonic
954673111 3:52301160-52301182 ATGTTTGTGGAGATGGTGGCAGG + Intergenic
955725179 3:61925429-61925451 ATTTTTAAGGAGAAGTTTGCTGG - Intronic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956324096 3:68031553-68031575 TCGTTTGTGGAGGAGATGGCCGG + Intronic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957962651 3:87278791-87278813 ATTTTTGAGGTGAACATGGATGG - Intergenic
958027570 3:88066606-88066628 AATTTTGTAGATAAAATGGCAGG + Intronic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
961458375 3:127035362-127035384 ATGGTTGTGGAGAAAGTGGCCGG + Exonic
961461189 3:127051385-127051407 TGTTTTGGGGAAAAGATGGCAGG - Intergenic
962356024 3:134694952-134694974 ATTGTGGTGTGGAAGATGGCTGG + Intronic
962463869 3:135639097-135639119 ATTTATGTGGAGAAGAGAGATGG - Intergenic
963954644 3:151240249-151240271 TTTTTTGTGGGAATGATGGCAGG + Intronic
964308986 3:155372124-155372146 ATTTTTGTCGAGAAGATGTTTGG + Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG + Intergenic
965814328 3:172621089-172621111 ATTTTTCTGGAGACAATGTCTGG - Intergenic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966449113 3:180037278-180037300 ATTCTAGCGGAGAGGATGGCCGG + Intergenic
967278243 3:187797528-187797550 ATATTTGCGGAGAGGATGGATGG - Intergenic
967631855 3:191753170-191753192 TTTTTTGGAGAGAATATGGCAGG - Intergenic
967723796 3:192842863-192842885 ATTCTTGTGGAAATTATGGCAGG + Intronic
967921816 3:194619609-194619631 GTTGCTGAGGAGAAGATGGCTGG - Intronic
968428366 4:537709-537731 ATTTTACTGGAGCACATGGCGGG + Intronic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
972021334 4:34318079-34318101 TTTTTTGAGGAGAAGAAGGGAGG + Intergenic
972201301 4:36717183-36717205 AGTTATCTGTAGAAGATGGCAGG + Intergenic
972265092 4:37452468-37452490 ATTTTTGTGGAGACTAGGGTGGG - Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
974034312 4:56804168-56804190 ATTTTTGTAGAGATGAGGCCTGG - Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975263429 4:72332739-72332761 ATTTTTATGGTTAAGATGGTAGG - Intronic
975327302 4:73073545-73073567 ATTTTTGTGAAGAACAAGACAGG + Exonic
975356438 4:73411204-73411226 ATTTTGGTGGTGTAGATGGTAGG - Intronic
975653203 4:76614956-76614978 TTTTTTCTGGAGAAGAGGGAAGG - Intronic
975664245 4:76719102-76719124 CTTTTTAGGGAGAAGATGTCTGG - Intronic
975694626 4:76999514-76999536 ATTTTTGTGGTAAATATGGGAGG + Intronic
976016999 4:80568040-80568062 AATTTTGAGGAAAAGATGACTGG + Intronic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977554134 4:98471496-98471518 ATGTTTGTAGAAAAGCTGGCAGG + Exonic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977722234 4:100252727-100252749 TACTTTGTGGAGAAGCTGGCTGG + Intergenic
977746431 4:100554199-100554221 ATTTTGGTGGAGAAAACGGCTGG - Intronic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978202294 4:106036242-106036264 AACTTGGTGGAGAAGATGACTGG + Intergenic
978460510 4:108946683-108946705 ATTATGGTGGAGAAGTTGGCGGG + Intronic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
978909356 4:114046735-114046757 TTTTTTGTGGTGAAGAAGGGCGG + Intergenic
978966848 4:114750914-114750936 AATTATCTGCAGAAGATGGCAGG - Intergenic
979396927 4:120199739-120199761 ATTTTTTTGTAGAACATGTCTGG - Intergenic
979503307 4:121464852-121464874 ATATTTGTGGAGGAGGTGGCGGG + Intergenic
979767017 4:124474565-124474587 AGTTATCTGTAGAAGATGGCAGG - Intergenic
980255385 4:130373426-130373448 ACTATAGTGGAGAAGATGACAGG - Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980629520 4:135414256-135414278 AGTTATATGCAGAAGATGGCAGG - Intergenic
982023367 4:151227659-151227681 ATTTTTGTAGCGAAGCTAGCAGG - Intronic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983367351 4:166810026-166810048 ATTTTTATGGAGAAGCGGGTAGG - Intronic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
984388412 4:179095392-179095414 ATTTCTTTGGAGAAGAAGTCAGG + Intergenic
985892825 5:2729199-2729221 AGTTGTGTGGAGAAAATTGCAGG - Intergenic
986087107 5:4462688-4462710 ATTTATCTGCAGAAGATAGCAGG - Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987578345 5:19758341-19758363 AATTATATGCAGAAGATGGCAGG + Intronic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988228766 5:28448097-28448119 ATTTATCTGCAGAAGATGGTAGG - Intergenic
988337814 5:29928804-29928826 ATCTTTTTGGAGAAGATTTCTGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
991018166 5:61953410-61953432 ATCATTGTGGAGAAAAAGGCAGG - Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992188507 5:74267209-74267231 ATTTTTGAGGAGAAAATTGCAGG + Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
992290424 5:75273773-75273795 ATTTTTCTGTAGGAGATGGTAGG + Intergenic
992880779 5:81107114-81107136 ATTTTGGAGGCGAAGATGGGAGG + Intronic
993231904 5:85247562-85247584 AGTTTTCTGCAAAAGATGGCAGG + Intergenic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995006223 5:107199053-107199075 GTTTTTGTGGAGAATGTGGTAGG + Intergenic
995269560 5:110205495-110205517 AGCTATGTGCAGAAGATGGCAGG + Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
996138562 5:119875689-119875711 ATTTTTATGAAGAAGATAGCTGG - Intergenic
996506654 5:124275577-124275599 TTTTTTGTGGAGATGGGGGCTGG - Intergenic
996825560 5:127677806-127677828 AATTATCTGCAGAAGATGGCAGG - Intergenic
998154637 5:139777704-139777726 ATTTTTGTAGAGATGAGGTCTGG - Intergenic
999024895 5:148217588-148217610 ACTTTTGTGTGGAAGAAGGCTGG - Intergenic
999368240 5:151036870-151036892 CTGTTGGTGGAGATGATGGCGGG + Exonic
999390090 5:151183363-151183385 GTTTTTCTGGAGAAGACAGCAGG - Exonic
1000271749 5:159691555-159691577 ATTTTTGTGAAGAATATTGTTGG - Intergenic
1000479230 5:161751077-161751099 ATCATTGTGGAGAAGAAGTCAGG + Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1002326342 5:178410337-178410359 ATTTTTGCAGAAAAGGTGGCTGG - Intronic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1004633376 6:17443071-17443093 ATTTTTGAGGAGAAAATGTTAGG - Intronic
1004871464 6:19908762-19908784 ATAATTGTGGAGAAGAAGGAAGG - Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1005227537 6:23659838-23659860 GTTTGTGTGGAGAAGTGGGCTGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006493721 6:34406164-34406186 ATTTTTAAGGGGACGATGGCGGG - Intronic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008279627 6:49580853-49580875 ACTCTTGTGGAGAAGATTTCTGG + Intergenic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008427724 6:51379014-51379036 ATATTACTGGAGAAAATGGCAGG - Intergenic
1009788379 6:68367413-68367435 ATTTATGTGGAGAAGGAGACGGG - Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010682240 6:78810326-78810348 ATTGTTGAGGGGATGATGGCAGG - Intergenic
1010987527 6:82442000-82442022 ACTTCTCTGGAGAAGATGGGGGG + Intergenic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012730458 6:102874291-102874313 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013406668 6:109849774-109849796 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1014092528 6:117420204-117420226 ATTTTGGTGGAGATTATGGAAGG - Intronic
1014373834 6:120646445-120646467 TTTTTTGTTTACAAGATGGCTGG - Intergenic
1014374354 6:120654137-120654159 ATTTTAGTGGAGATTATGGTGGG - Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014631638 6:123796773-123796795 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1014640323 6:123900950-123900972 ATTTTCTTTGAGAAGATGGAAGG + Intronic
1015040211 6:128707525-128707547 ATTTTTGAGGCGTATATGGCAGG - Intergenic
1015179309 6:130344936-130344958 ATTTTGGTAGAGGAGATGGAGGG - Intronic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1015933693 6:138387196-138387218 ATTTTTGTAGAGATGGTGGGGGG - Intergenic
1015991206 6:138945315-138945337 ATGTGTGTGGAGAAGTTGGTGGG + Exonic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016469247 6:144357941-144357963 ATGGTTGGGGACAAGATGGCGGG - Intronic
1016623346 6:146137681-146137703 ATTTTTGTGAAGAACATTGTTGG + Intronic
1017682212 6:156875594-156875616 TTTTGTGAGGAGAAGCTGGCAGG - Intronic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018090579 6:160344036-160344058 ATTTTTGTGCAGAGAATGGTGGG - Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1019028779 6:168992659-168992681 ACTCTAGTGGAGAAGATGGATGG + Intergenic
1019681625 7:2353766-2353788 ATTTTCGTAGAGATGAGGGCTGG + Intronic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1021458250 7:20855030-20855052 ATATCTGTGGAGAAGATAGGTGG + Intergenic
1021839443 7:24710511-24710533 AATTTTATGGGGAAGATGGATGG - Intronic
1021871681 7:25013332-25013354 ATGGTTGTGGAGAACATGTCCGG + Intergenic
1023717266 7:43057138-43057160 ATTTTGGGGGAGAACATTGCTGG - Intergenic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1024645500 7:51367419-51367441 TTTTTTGTGGTGTAGATGGCAGG - Intergenic
1026046492 7:66909127-66909149 AGTTATATGCAGAAGATGGCAGG + Intergenic
1028152068 7:87385219-87385241 ATTTTTGTGAAGAATATTGTTGG + Intronic
1028935010 7:96455034-96455056 AATTATCTGCAGAAGATGGCAGG - Intergenic
1030003817 7:105095518-105095540 ATTTATGTGGCCAAGATGGAAGG + Intronic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030309935 7:108058977-108058999 ATATTTGAGCAGAAGCTGGCAGG - Intronic
1030368750 7:108673998-108674020 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1030906545 7:115190735-115190757 ATTCTTGTGCAGAAGATAACAGG - Intergenic
1030981602 7:116191529-116191551 ATCTATGGGGAGAAGATGGAGGG - Intergenic
1031186875 7:118492928-118492950 ATCTTTGTGGAGAAGTTATCTGG + Intergenic
1031419762 7:121537425-121537447 AAATCTGTGGAGAAGATGGAAGG - Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1032628214 7:133616602-133616624 ATTTTTGTGACAATGATGGCAGG + Intronic
1037216950 8:16466320-16466342 ATTTTCATGGAGAAGATAGATGG - Intronic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1037800374 8:22031266-22031288 ATTTTTGAGGAGAAGAGGGCTGG + Intronic
1038514648 8:28176430-28176452 ATTTTCCTGGAGCAGCTGGCTGG - Intronic
1039790994 8:40875503-40875525 ATTTTTGTTGCCAAGATGGTAGG - Intronic
1040855908 8:51947811-51947833 ATTTTTGTGGACAATTTGGTGGG + Intergenic
1041543841 8:59018256-59018278 ATTTTTGTGGACAAGAACCCAGG + Intronic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1046417642 8:113937824-113937846 AGTTGTCTGAAGAAGATGGCAGG + Intergenic
1046528359 8:115411078-115411100 ATTTTGGTGGAGAAGAGGTTGGG - Exonic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1047322932 8:123805399-123805421 AGTTTGGTGGAAAACATGGCAGG + Intronic
1047354823 8:124110485-124110507 ACCTCTGTGGTGAAGATGGCTGG - Intronic
1048212270 8:132465172-132465194 TCTTTTGTGGAGAAAATGGCAGG - Intronic
1048710133 8:137200809-137200831 ATATATGGGGAGAAAATGGCAGG - Intergenic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050655900 9:7828737-7828759 TTTTTTCTGGAGCAGAGGGCAGG - Intronic
1051078280 9:13266041-13266063 ATTTTTGTAGAAAAGATTCCAGG - Intronic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1054764232 9:69029838-69029860 GTTTTTATGGATAAGTTGGCAGG + Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056033208 9:82575286-82575308 ATTTCTGATGAGAAGTTGGCTGG - Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1057673488 9:97117635-97117657 ATTTTTGTAGAGACGAGGTCTGG - Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058133326 9:101278304-101278326 ATATTTGTGAAGAAGAGGGATGG + Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1058290153 9:103230880-103230902 TTTGTTGTTGAGAAGGTGGCAGG - Intergenic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1203637450 Un_KI270750v1:126121-126143 ATTCCTGTGGAGAAGGAGGCTGG + Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186469770 X:9812139-9812161 AGTTGTCTGCAGAAGATGGCAGG + Intronic
1187151404 X:16685077-16685099 TTTTTTTTGGAGAAGAAGTCTGG - Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1187822489 X:23302885-23302907 ATTTTTCTGGATGGGATGGCCGG - Intergenic
1188437922 X:30183987-30184009 GTTTTTGTTGAGAAGTAGGCTGG + Intergenic
1188739532 X:33761180-33761202 ATTTTTGTGAAGAACATCGCTGG + Intergenic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1191636448 X:63382734-63382756 ATTTTAGTAGAGAAGATGATGGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193053487 X:77125736-77125758 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1193297777 X:79852642-79852664 AGTTATGTGCAGATGATGGCAGG - Intergenic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194768704 X:97873940-97873962 ATTTTTGTGCAGATGAAAGCAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1195496012 X:105534517-105534539 ATTTTTGTGGGGTACATGGTGGG - Intronic
1195782357 X:108479897-108479919 AGTTTTTTGCAGAGGATGGCAGG + Intronic
1195934281 X:110110205-110110227 ATTTGTGGGGAGGAGATGACAGG - Intronic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196300713 X:114047411-114047433 AATTTTGGGCAGAAGAGGGCAGG + Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG + Intergenic
1197409326 X:126096447-126096469 AGTTATATGCAGAAGATGGCAGG + Intergenic
1197995466 X:132367955-132367977 ATCTTTCTGGAGAAGATTTCTGG + Intergenic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1200337961 X:155372172-155372194 ATTCTTGTGGGGAGGATGGCTGG + Intergenic
1200348508 X:155468522-155468544 ATTCTTGTGGGGAGGATGGCTGG - Intergenic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1200790125 Y:7292303-7292325 TTTTTTGTGCAGATGATGTCTGG + Intergenic
1200973127 Y:9177742-9177764 ATTTATCTACAGAAGATGGCAGG + Intergenic
1201559619 Y:15302148-15302170 ATTTTTATGGACAATTTGGCAGG - Intergenic
1202137951 Y:21686771-21686793 ATTTGTCTACAGAAGATGGCAGG - Intergenic