ID: 1168911948

View in Genome Browser
Species Human (GRCh38)
Location 20:1455343-1455365
Sequence GACAGCCAAGGCTTCCTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168911948 Original CRISPR GACAGCCAAGGCTTCCTTTA AGG Intronic
901354352 1:8630798-8630820 GACTGGGAAGGCTTCATTTATGG - Intronic
907786552 1:57618443-57618465 GGCTGACAAGTCTTCCTTTAGGG + Intronic
911447064 1:98009815-98009837 GACAGTGAAGGATACCTTTAGGG - Intergenic
913100618 1:115560702-115560724 GACAGAAAAGGCTTGCTTTCAGG - Intergenic
915196605 1:154194364-154194386 GACATCCAAGGGTGACTTTAAGG - Intronic
917513167 1:175684969-175684991 GACATCCAACCCTTCCTTTCTGG + Intronic
923085161 1:230697615-230697637 GACAGACAGCGTTTCCTTTAGGG - Intergenic
1071964909 10:90842658-90842680 GACACCCATGGCTTTCTTTCTGG + Intronic
1072741459 10:97912462-97912484 GACAACCAAGGCTGCCCTTTGGG - Intronic
1075391162 10:122093277-122093299 TCCAGCCAGGGCTTCCTTAATGG - Intronic
1079630660 11:22670218-22670240 GACAGCAAAGATTACCTTTAGGG + Intronic
1080718165 11:34824041-34824063 GACAGCCACGGCTCCCTAGAAGG + Intergenic
1080870501 11:36232777-36232799 GACAGCCCAGTCTTCATTTGAGG - Intergenic
1083801342 11:65048031-65048053 CACAGCCAACGCTACCCTTAGGG - Exonic
1086140048 11:83487942-83487964 GGCAGCCAAGGTTTTTTTTAGGG + Intronic
1087795873 11:102454220-102454242 CACAGCTAATACTTCCTTTAAGG + Intronic
1088426237 11:109707158-109707180 GCAACCCAAGGCTTCCTCTAAGG - Intergenic
1089393103 11:118115361-118115383 GATATGCAAGGCTTCCTGTAGGG - Intronic
1092265377 12:6976745-6976767 GCCAGCCAAGTCTTCATTTGGGG - Exonic
1093823735 12:23655283-23655305 GACTGCTAAGGCATCATTTAAGG + Intronic
1095396952 12:41772377-41772399 GCCAGCAAAGATTTCCTTTAAGG + Intergenic
1096025823 12:48360183-48360205 GACAACCAAGGCTGGTTTTAGGG - Intergenic
1097694754 12:62765349-62765371 GACAGAGATGGCTTCTTTTAGGG - Intronic
1101609270 12:106275541-106275563 AAAGGCCCAGGCTTCCTTTAAGG + Intronic
1104141798 12:125994518-125994540 CACAGCCAAGGCTTCCCCAAGGG - Intergenic
1106511873 13:30419883-30419905 AACACCCAAGCCTTCCTTTGGGG - Intergenic
1106628843 13:31448399-31448421 GATGACCAAGGCTTCCTATAGGG + Intergenic
1108467470 13:50731126-50731148 GTCGGCCAAGTCTTCATTTATGG + Intronic
1108852249 13:54745663-54745685 GGCAGGTAATGCTTCCTTTAAGG - Intergenic
1110332094 13:74284554-74284576 GGCAGTCCAGTCTTCCTTTATGG + Intergenic
1115014594 14:28594579-28594601 GACAGGCAAGTCTTCATTTTAGG - Intergenic
1118681162 14:68242984-68243006 GACAGCAAGTGCTTCCTTGAAGG + Intronic
1123936759 15:25197794-25197816 GGCAGCCCAGGCTCCCTTTGTGG + Intergenic
1123942515 15:25223466-25223488 GGCAGCCCAGGCTCCCTTTGTGG + Intergenic
1125738189 15:41943090-41943112 GACAGCCCCGGCATCCTTTCTGG - Exonic
1126495551 15:49286060-49286082 GTCAGGGAAGGCTTCCTTGAGGG - Intronic
1126671970 15:51124645-51124667 GACAGCCAGGGTTTCCTTCCAGG - Intergenic
1129262486 15:74376408-74376430 GGCAGGCAAGGCTGCCTATAAGG - Intergenic
1131628170 15:94146889-94146911 GACAGCGAATGCTTCGTATATGG + Intergenic
1135776181 16:25258625-25258647 GACAGACAAGAGTTCCTTTGGGG - Intergenic
1137085449 16:36115919-36115941 GATAGGCAATGCTTCCTATAAGG + Intergenic
1140561070 16:75982475-75982497 TACAACCAAGACTTGCTTTAAGG - Intergenic
1148687883 17:49510706-49510728 CACAGCAAAGTCTTCCTTGAGGG - Intronic
1149385797 17:56142226-56142248 GCCAGCTAGGGCTTACTTTATGG + Intronic
1150129383 17:62658860-62658882 GCCTGCCCAAGCTTCCTTTAAGG - Intronic
1150998065 17:70341820-70341842 GACAGCCAGTCCTTCCTTCAAGG - Intergenic
1153123919 18:1766240-1766262 GATAGCTAAGGCTTCATTTGTGG + Intergenic
1153153385 18:2121589-2121611 GACTGCCAAGGCTTGCTTGTGGG - Intergenic
1153459862 18:5321762-5321784 GAGAGCCAAGCATTCTTTTAAGG + Intergenic
1156272304 18:35547024-35547046 GACAAGCACTGCTTCCTTTAGGG + Intergenic
1157833509 18:50878819-50878841 GCCAGCCCCGGCTTCCTTCATGG + Intergenic
1158810233 18:61024481-61024503 GATAGCACAGACTTCCTTTAAGG + Intergenic
1160707934 19:538457-538479 CAAAGACAAGGCTTTCTTTACGG + Intronic
1160976574 19:1795872-1795894 CACAGCCAAGGCCTCCTCTGTGG + Exonic
1168403521 19:56099230-56099252 GCCAGGCAAGGCTTCGTTCACGG - Intronic
925383623 2:3446490-3446512 GACAGGCAAGGCTGACTATATGG - Intronic
925924091 2:8658241-8658263 GGCGGCCAAGGCTTCCTCTGAGG - Intergenic
929107779 2:38380903-38380925 CACAGGCGAGGCTTCCTTTGGGG + Intergenic
931579801 2:63760254-63760276 CTCAGGCAAGGCTTCCTTCATGG - Intronic
935850571 2:107214516-107214538 GGAAGCCAAGGCTGCATTTATGG + Intergenic
936500838 2:113065072-113065094 GACAGACAAGGCTGCCTCTATGG + Intronic
940708019 2:157127603-157127625 GACAGCCAAGGCTTTATGCAGGG - Intergenic
942230297 2:173854823-173854845 GACATCCATTGCTTCCTTCAAGG - Intergenic
1168911948 20:1455343-1455365 GACAGCCAAGGCTTCCTTTAAGG + Intronic
1172190098 20:33056720-33056742 CAAAGCCAAGTCTTCCTGTAGGG - Intronic
1174084613 20:47997992-47998014 GAAACCTAATGCTTCCTTTAAGG + Intergenic
1176370140 21:6057468-6057490 GACACCCAAAGCATCCTTGATGG + Intergenic
1178314048 21:31554505-31554527 TACACCCAAGTCTTCCTTTAAGG + Intronic
1179753379 21:43481073-43481095 GACACCCAAAGCATCCTTGATGG - Intergenic
1179843388 21:44092558-44092580 GAGATCAAAGGCTTCCTTAATGG + Intronic
1179944018 21:44658443-44658465 GGCAGCCAAGACTTCCTTGAGGG - Intronic
1180693015 22:17733399-17733421 GATACTCAAGGCTTCCTTAAAGG - Intergenic
1181944227 22:26503242-26503264 CACCGCAAGGGCTTCCTTTATGG + Intronic
1182096965 22:27632540-27632562 TACTTCCAATGCTTCCTTTACGG - Intergenic
1182833883 22:33325867-33325889 GACAGGCAAGGCTGCCCTTAGGG + Intronic
1183190479 22:36319226-36319248 CACAGGCAAGGCTCCCATTAAGG + Intronic
1184253519 22:43274428-43274450 GTCCGCCATGGCTTCCTTTAGGG - Intronic
949197773 3:1334023-1334045 AACAGCCAAGACTTCAATTATGG - Intronic
951030409 3:17875375-17875397 TACAGCCAAGCCTCCCTTAATGG - Intronic
951537244 3:23751202-23751224 GCTAGCCAAGGCTTTCTATAAGG - Intergenic
952980719 3:38733203-38733225 GAAAGCCAAGGTTTGTTTTAAGG - Intronic
955590141 3:60526324-60526346 GACAGCCATGTCTCCCTTTTAGG + Intronic
955938153 3:64122338-64122360 AACAGCCAAGGCTCACTTCAGGG + Intronic
956722323 3:72129082-72129104 GACACTCAAGCATTCCTTTAGGG - Intergenic
967875619 3:194266577-194266599 GAGAGCAAACTCTTCCTTTAAGG + Intergenic
968536496 4:1133864-1133886 AGCACCCAAGGCCTCCTTTAAGG - Intergenic
969342122 4:6548845-6548867 GACAGCAAAGTCTTTCTTGAAGG + Intronic
970657046 4:18242716-18242738 AACAGGCAAGGCTTCCTTCTTGG - Intergenic
970725308 4:19036873-19036895 GACAGCCAAGTTGGCCTTTAAGG + Intergenic
986281953 5:6330604-6330626 AGCACCCAAGGCTTCTTTTATGG - Intergenic
986649840 5:9952361-9952383 GACAGCAAAGACTTGCTCTAGGG - Intergenic
986707022 5:10460721-10460743 GACACCCAGGGCTTCCTTGTAGG + Intronic
990033126 5:51285911-51285933 GCCAGCCATGGCTTCCTCTATGG + Intergenic
990568408 5:57053412-57053434 GACAGCCAAACCTCCCCTTATGG + Intergenic
992124080 5:73624103-73624125 GATAGTCACGGCTTCTTTTAAGG + Intergenic
993935049 5:93988813-93988835 GACTGCCAAGGGTTCCTGGAAGG - Intronic
998003404 5:138641769-138641791 GACAGCCTAGGCGTCCTCTCAGG + Intronic
1001778848 5:174350428-174350450 GACAACCAAGAATTCCTTCAGGG + Intergenic
1003089349 6:3088529-3088551 GACAGCCCTGGCTTCCTGTTGGG + Intronic
1004149561 6:13102883-13102905 GACCCCCATTGCTTCCTTTATGG + Intronic
1008699938 6:54086852-54086874 GACAGAGAAGGCTTCCTTGGAGG - Intronic
1010717768 6:79249344-79249366 GACAACAAAGGCTTGCTTTCAGG - Intergenic
1012811487 6:103965386-103965408 GACAGCAAAGACTTTCTTCATGG + Intergenic
1014775856 6:125509146-125509168 GACACTCAAGGCTTTCTTTATGG - Intergenic
1022126712 7:27364688-27364710 GACTGCCAAGCCTTGCTTCAGGG - Intergenic
1025971764 7:66333275-66333297 GACAGCCAAAGCCTCTTGTATGG + Intronic
1032294316 7:130622059-130622081 GACAGCAAAGGCTTGCATAAAGG + Intronic
1034012256 7:147542398-147542420 GAAATCCAAGACTTCATTTACGG + Intronic
1034056564 7:148041320-148041342 GACAGTCAATCCTTCCATTAAGG - Intronic
1035317601 7:158006608-158006630 GACGGCAATGGCTTCCTTAAGGG + Intronic
1036707562 8:11056556-11056578 GACAGCCAGAGGTGCCTTTATGG - Intronic
1040941024 8:52833824-52833846 TGCAGCCAAGGCTTCCTTAGTGG - Intergenic
1043744187 8:83852871-83852893 GACAGCCAAGTTTTTCTATAAGG - Intergenic
1048307166 8:133292513-133292535 GACAGCCAAGGAGGCCTTTCTGG + Intronic
1051961796 9:22774362-22774384 GACTGCCAATGTTTACTTTAAGG - Intergenic
1055223284 9:73964660-73964682 GACAGGCACGGCTGCCTTTGTGG + Intergenic
1056263765 9:84875640-84875662 CACAGCCAAGGTATCCTTGATGG - Intronic
1062182382 9:135197486-135197508 GACAGCCCAGGCTGCCTTCCTGG - Intergenic
1194184210 X:90752591-90752613 GAAAACAAAGGCTTCATTTATGG + Intergenic
1197394285 X:125907295-125907317 CACAACTGAGGCTTCCTTTATGG - Intergenic
1199900521 X:152167872-152167894 AACAGCCAAGGCTTCCACTATGG + Exonic
1200091251 X:153637158-153637180 GACAGCCAAGGCTCCTTGTGTGG - Intergenic
1200530800 Y:4334514-4334536 GAAAACAAAGGCTTCATTTATGG + Intergenic