ID: 1168920989

View in Genome Browser
Species Human (GRCh38)
Location 20:1536165-1536187
Sequence CTGGTTGTTACAGCCTTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168920989_1168920992 -8 Left 1168920989 20:1536165-1536187 CCCTAAAAGGCTGTAACAACCAG 0: 1
1: 0
2: 1
3: 5
4: 119
Right 1168920992 20:1536180-1536202 ACAACCAGAGCTCACATAGGTGG 0: 1
1: 0
2: 0
3: 8
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168920989 Original CRISPR CTGGTTGTTACAGCCTTTTA GGG (reversed) Intronic
905828830 1:41048008-41048030 CTGGTTATTACAACCTGCTAGGG + Intronic
906307086 1:44726261-44726283 CCGGTTGTTACAGACATTAAAGG + Intergenic
907984494 1:59517197-59517219 CAGGTTGTTATTGCCTTTCAGGG - Intronic
909293711 1:73916558-73916580 CTGATTTTGTCAGCCTTTTAAGG - Intergenic
910102627 1:83594679-83594701 CTGGTTGTAACATCATATTAAGG - Intergenic
913383371 1:118233337-118233359 GTGAGTGTTACAGCCTTTAAAGG - Intergenic
915739461 1:158107505-158107527 ATTGTTGTTAAAGCCTTCTATGG - Intergenic
1063234493 10:4098656-4098678 CTTGTTGTTACAGCCTAACAAGG - Intergenic
1064956089 10:20911881-20911903 CTGCTTTTTAGAGCCTTTGACGG - Intronic
1066616630 10:37301555-37301577 CTGGGTGGTCCAGCCTTTCATGG + Intronic
1067335244 10:45356420-45356442 TTGGTTTTGACAGCTTTTTAGGG - Intergenic
1071072291 10:81708823-81708845 CAGGTTTTTTCAGCCTTTTTCGG + Intergenic
1071930919 10:90468944-90468966 TTGGTTGTTAAATCCTTTTTAGG - Intergenic
1072191907 10:93082776-93082798 CAGGTAGTCACAGACTTTTAGGG + Intergenic
1074461716 10:113644240-113644262 CTGGGTGGTAGAGACTTTTAGGG - Intronic
1075130574 10:119735148-119735170 CTGGTTGTTGGAGACTCTTAAGG + Intronic
1075249470 10:120852822-120852844 CTAGTTGTTAGATCATTTTAAGG + Intronic
1078458639 11:11495850-11495872 CTCTTGGTCACAGCCTTTTATGG - Intronic
1079547636 11:21653497-21653519 ATTGTTGTAACAACCTTTTAAGG + Intergenic
1081052050 11:38353829-38353851 CTGGTTCTAACAGGTTTTTAGGG + Intergenic
1081088735 11:38834692-38834714 CTGGTTTTTATGGACTTTTATGG + Intergenic
1084208057 11:67607353-67607375 CTCCTTGTCACAGCCTTGTAGGG + Intronic
1087594590 11:100236825-100236847 CTGGAATGTACAGCCTTTTAGGG + Intronic
1090259204 11:125306478-125306500 CTGGTAGTACCAGCCTTTGATGG - Intronic
1090284347 11:125486335-125486357 CTGGAGGTCACAGCCTCTTAGGG - Intronic
1091156907 11:133382679-133382701 CTGTTTGTTGCAGTCTTTAAGGG + Intronic
1092134864 12:6139913-6139935 CCAGTTGTTACAGCCTATAAAGG + Intergenic
1097293623 12:57941371-57941393 CGGGTTGTTACAGCCTTTGAGGG + Intergenic
1102200868 12:111056836-111056858 CTGGTTGTGACAGGCTGTAAAGG + Intronic
1105717503 13:23081929-23081951 CTGTTTGTTGCAGGCTTTTCTGG + Intergenic
1107168646 13:37314013-37314035 TTGCCTGTTATAGCCTTTTATGG + Intergenic
1115920125 14:38363446-38363468 TTGGGTGTTACTGCCTTTCATGG + Intergenic
1119739654 14:77006080-77006102 CTGAATTTTACAGCCTTTTCTGG + Intergenic
1120335402 14:83148485-83148507 GTGAGTGTTACAGCCTTTAAAGG + Intergenic
1120701626 14:87704871-87704893 CTGCTTCTTCCAGCCTTCTAGGG + Intergenic
1123724294 15:23086754-23086776 CTGGGAGTTACACACTTTTATGG + Intergenic
1126969196 15:54090724-54090746 GTAGTTGTTACAGCATTTAATGG + Intronic
1134568430 16:15271027-15271049 TTGGTTTTTACTGCCTTTTCTGG - Intergenic
1134733999 16:16485333-16485355 TTGGTTTTTACTGCCTTTTCTGG + Intergenic
1134933499 16:18226948-18226970 TTGGTTTTTACTGCCTTTTCTGG - Intergenic
1144429831 17:15181121-15181143 CTGGTTGTTTCAGGCTCTTTAGG + Intergenic
1147908637 17:43840841-43840863 CTGGTTTGTACAGCCTTTTGGGG + Intergenic
1150939437 17:69674539-69674561 ATGGTTTTTACAGTCTTTAATGG - Intergenic
1155683727 18:28521059-28521081 GTGACTGTGACAGCCTTTTAGGG - Intergenic
1156880427 18:42071055-42071077 TTGGTTGTTACAGGCTCTTTTGG + Intronic
1157837686 18:50922435-50922457 ATGGTAGTTACAGCCTCTTTGGG - Intronic
1159264268 18:66059374-66059396 CTGGTTCTAATAGCTTTTTAGGG - Intergenic
929224152 2:39495728-39495750 CTGATTATTACAGTCTTTTTAGG + Intergenic
933566924 2:83961823-83961845 CAGGTTGTTCTAGTCTTTTAGGG - Intergenic
934121670 2:88846141-88846163 CTGGTTATTACAGAGTTTCATGG - Intergenic
935936767 2:108194006-108194028 CTGATTGTCTCAGCTTTTTAGGG + Intergenic
937537448 2:122907864-122907886 CTGATTATTACAGGCTTTTATGG - Intergenic
940159681 2:150697849-150697871 CTTGCTGATACAGCCTTCTACGG + Intergenic
941425328 2:165337751-165337773 CTGGTGGTAACAGCTTTTTTAGG - Intronic
1168920989 20:1536165-1536187 CTGGTTGTTACAGCCTTTTAGGG - Intronic
1168999864 20:2160910-2160932 TTGGTTGTTACATTCCTTTAGGG - Intronic
1173667154 20:44771228-44771250 CTGGTTCTTGCAGTCTTTTGTGG - Intronic
1174317845 20:49716426-49716448 CTGGATGTTACAGAATGTTATGG - Intergenic
1177003945 21:15647905-15647927 CTGTTTGTAACAGCATTTTGGGG - Intergenic
1180235376 21:46456251-46456273 CTGGGTGGTACAGCTTGTTATGG + Intergenic
954464782 3:50648021-50648043 CTGGTTGTTGCAGCCCTGTGAGG - Exonic
956142631 3:66161036-66161058 CTGGCTGTCACAGCTTTTAATGG + Intronic
956487403 3:69737630-69737652 ATGGATGTTACAGACGTTTAAGG - Intergenic
958614016 3:96467354-96467376 CCAGTTGTTACATCCTTCTAAGG - Intergenic
958646891 3:96885841-96885863 CTTTTTGTTACAGGCATTTAGGG + Intronic
964425371 3:156547408-156547430 ATGTTTGTTACAGCTTTTAAAGG - Intronic
966873137 3:184305198-184305220 CTGGCTGTTATCCCCTTTTATGG - Intronic
973989101 4:56386364-56386386 ATGGTTGCTACAGACATTTAAGG + Intronic
975724370 4:77277769-77277791 CAGCATGTTACAGCATTTTATGG - Intronic
979419237 4:120483139-120483161 ATCCTTATTACAGCCTTTTAAGG - Intergenic
979898937 4:126193274-126193296 CTAGTGGTTACAGAATTTTAAGG - Intergenic
980804843 4:137798777-137798799 CTGTTGGTTCCAGCTTTTTAAGG - Intergenic
980867957 4:138575956-138575978 ATAGTTGTTATAGCCCTTTAAGG - Intergenic
981076578 4:140598429-140598451 TAGGTTGGTACAGCCTTTTGTGG + Intergenic
982875401 4:160641915-160641937 CTGATTGTGACAACCTTTTAAGG + Intergenic
984657365 4:182332898-182332920 TTAGTTGTTACAGTCTTTTTAGG - Intronic
987885846 5:23810597-23810619 CTTCTTGTTACATCCTTATATGG - Intergenic
989750102 5:44883410-44883432 GTGAGTGTTACAGCCCTTTAAGG + Intergenic
993619017 5:90146432-90146454 CTGGATGTTTCAACCTTATATGG - Intergenic
995638570 5:114224828-114224850 CTGGATGTCACAGCATTCTAAGG - Intergenic
995756002 5:115504819-115504841 CTGGTGGTTACAGCCTTAGTGGG - Intergenic
996477399 5:123937134-123937156 TTGGTTGCTACATTCTTTTAAGG - Intergenic
998898073 5:146821450-146821472 CTGGTTGTCACAGCACTTTGTGG + Intronic
999145820 5:149392872-149392894 GTGGTTGTTTCAGCCTTAGAGGG - Intronic
1003036868 6:2648019-2648041 CTGGTAGTTACTGTCCTTTAAGG - Intergenic
1003056711 6:2827358-2827380 CTAGATGTTACAGCTTCTTAGGG + Intergenic
1005267167 6:24124441-24124463 CTGATTCTTACAGACTTTCAAGG + Intergenic
1009703194 6:67210444-67210466 CTGGTTATTACAGCTATTTTAGG + Intergenic
1010621046 6:78075428-78075450 CTGGTTGCCACAGTATTTTATGG + Intergenic
1011097237 6:83679721-83679743 ATCGTTGTTACAGTGTTTTAAGG - Intronic
1011343116 6:86339681-86339703 CTGGTTTTTACATCATATTAAGG + Intergenic
1015325033 6:131915268-131915290 CTGGATGTTACAGCTGCTTAGGG + Intergenic
1018592015 6:165436745-165436767 ATGGTTTTTCCAGCCTTTTAAGG - Intronic
1019177613 6:170168197-170168219 CGGGTTGTTACTGCCTGTTCAGG + Intergenic
1019177747 6:170168992-170169014 CGGGTTGTTACTGCCTGTTCGGG + Intergenic
1019177848 6:170169548-170169570 GGGGTTGTTACAGCCTATTTGGG + Intergenic
1021544855 7:21801821-21801843 TTTGTTGTTACATCTTTTTATGG + Intronic
1024405017 7:48969282-48969304 CTGGATGCTACTGCCTTCTATGG - Intergenic
1026671885 7:72397963-72397985 CTGGATGATGCATCCTTTTAGGG + Intronic
1027859468 7:83557941-83557963 CTGGGTTTTACAGCCTTTCTTGG - Intronic
1028699165 7:93756814-93756836 ATGGTTATTACACCCTTTTCAGG + Intronic
1029571114 7:101370184-101370206 CTGGTTGATATGGCCTTTCAGGG + Intronic
1030428166 7:109406935-109406957 CTGCTTGTTGCAGTCTTTTGAGG - Intergenic
1030477677 7:110058369-110058391 ATGGTTGTTAAAGATTTTTATGG - Intergenic
1035725214 8:1820365-1820387 CTGGCTGTAAAAGTCTTTTAAGG + Intergenic
1035772860 8:2162983-2163005 CTTGTTCATACAGACTTTTATGG - Intronic
1035915652 8:3619008-3619030 GTGCTTGTCACAGCCTTTCATGG - Intronic
1039645244 8:39275144-39275166 ATGGGTGGTACAGCCTTTCAGGG + Intronic
1044815145 8:96104363-96104385 CTGATTTTTACAGCTTTTCAAGG + Intergenic
1045108992 8:98921574-98921596 CAAGTTGTTACAGCCTATGATGG + Intronic
1050050869 9:1600134-1600156 TTGGTTGTTACAAGCTTTTCAGG + Intergenic
1050580315 9:7047770-7047792 CTTGTTATTACTGCCTTATAGGG - Intronic
1051107779 9:13599755-13599777 CTGGTTGTTACAGGGGTTGAGGG - Intergenic
1056739359 9:89240460-89240482 CTGGTTGTTTCTTCCTGTTAAGG - Intergenic
1057466097 9:95316407-95316429 CTGTTTGTAACAACCTTTCAGGG + Intronic
1060831464 9:126720287-126720309 CTGGTTGTAATTGGCTTTTAGGG - Intergenic
1186974364 X:14884859-14884881 CTAGGTGTTATACCCTTTTACGG - Intronic
1187686357 X:21819506-21819528 CTGGCTGCTACTGACTTTTAAGG + Intergenic
1190382147 X:49849576-49849598 CTTGATGTTACAACTTTTTAAGG - Intergenic
1195763270 X:108270006-108270028 CTAGTTCATACAGCCTCTTATGG + Intronic
1199988675 X:152971102-152971124 CTGGTTGCTACTGCCTTCAAGGG - Intronic
1201543512 Y:15134787-15134809 CGGGTTGTTAAAGTCTTTTATGG - Intergenic
1201997632 Y:20111557-20111579 CTGAGTGTTACAGCATTTAAAGG + Intergenic
1201997885 Y:20114818-20114840 TTGAGTGTTACAGCATTTTAAGG + Intergenic
1201999624 Y:20138070-20138092 CTGAGTGTTACAGCATTTAAAGG + Intergenic
1202003821 Y:20194204-20194226 TTGAGTGTTACAGCATTTTAAGG + Intergenic