ID: 1168924204

View in Genome Browser
Species Human (GRCh38)
Location 20:1566196-1566218
Sequence CAACCACCAGTAGCAGCTTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168924200_1168924204 3 Left 1168924200 20:1566170-1566192 CCAGCAGATGTAGATGGCAGAGA 0: 1
1: 0
2: 25
3: 23
4: 582
Right 1168924204 20:1566196-1566218 CAACCACCAGTAGCAGCTTGGGG 0: 1
1: 0
2: 3
3: 12
4: 131
1168924198_1168924204 13 Left 1168924198 20:1566160-1566182 CCTTCTGTTTCCAGCAGATGTAG 0: 1
1: 0
2: 1
3: 26
4: 187
Right 1168924204 20:1566196-1566218 CAACCACCAGTAGCAGCTTGGGG 0: 1
1: 0
2: 3
3: 12
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168924204 Original CRISPR CAACCACCAGTAGCAGCTTG GGG Exonic
901070071 1:6512570-6512592 CAACCACCAGCTGCAGCCTCGGG + Intronic
907045085 1:51295885-51295907 CCACCAGCAGCAGCAGCATGGGG + Intronic
912639723 1:111333298-111333320 CAACCACCAGTGGAAGCTTGTGG + Intergenic
913549962 1:119907619-119907641 CAACCAGCAGCAGCAGCTGTGGG + Intergenic
915805767 1:158847874-158847896 CACACACCAGTTTCAGCTTGCGG - Exonic
917450990 1:175147103-175147125 CCACCAGCTGTGGCAGCTTGGGG + Exonic
917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG + Intronic
921708765 1:218352592-218352614 CAACCATCAAAAGCAGCTTGTGG - Intronic
923758192 1:236813217-236813239 CAACCACTATTACCAGTTTGGGG + Intronic
1069486446 10:68827127-68827149 CAACCACGAGGAACAGCCTGAGG - Intergenic
1071196156 10:83162646-83162668 TATCCAGCAGTAGCAGGTTGAGG + Intergenic
1071603715 10:86971090-86971112 CAGCCTCCAGTCGCAGCTGGCGG - Intronic
1073007375 10:100335013-100335035 CAAGTGCCAGTAGGAGCTTGGGG - Intergenic
1075155481 10:119973078-119973100 CCTCCACCAGTAACAGCTTGAGG - Intergenic
1076067350 10:127459221-127459243 GAACCAGCAGTGGCAGCTGGGGG - Intergenic
1076302313 10:129437517-129437539 CCTCCACCAGTCACAGCTTGAGG + Intergenic
1077268176 11:1662322-1662344 CAACCACAAGAAGGAGCTGGGGG + Intergenic
1077272707 11:1689296-1689318 CAACCACCAGAAGGAGCTGGGGG - Intergenic
1080124872 11:28721095-28721117 CAACCATCAGTGGCTGCTGGAGG - Intergenic
1081874292 11:46398009-46398031 CAGCCACCGGTAGCAGCTGGGGG + Intronic
1082013230 11:47465126-47465148 CAAAAACAAGTGGCAGCTTGGGG - Intergenic
1082781767 11:57293639-57293661 CAAACACCAGTTGCAGCTCCTGG + Intergenic
1084071611 11:66740146-66740168 CATCCACCAGTAGCAGGTGCTGG - Intergenic
1085945475 11:81265885-81265907 CATCCACCAGTATTAGTTTGAGG - Intergenic
1090077753 11:123590275-123590297 AAAGCAGCAGTAGCAGCCTGGGG - Intronic
1090445587 11:126762058-126762080 CTACCACCAGTTGCATGTTGAGG + Intronic
1092940838 12:13405630-13405652 CAAAAACCAGTAGGAGCTGGAGG - Intergenic
1096677742 12:53234579-53234601 CAAACAGCAGCAGCAGATTGGGG + Intergenic
1097386528 12:58956444-58956466 CCACCACCAGTAGCACTTTAGGG - Intergenic
1097955540 12:65481916-65481938 CAAGGACCAGTAGGATCTTGGGG - Intronic
1101584158 12:106070107-106070129 CACCCCACAGTGGCAGCTTGGGG - Intronic
1101612482 12:106303616-106303638 CCACCTACAGTAGCAGCTTTGGG - Intronic
1104063702 12:125288897-125288919 CAACTACCATCAGCAGCCTGGGG - Intronic
1108055796 13:46483769-46483791 CAGACACCAGTAGCAGGTTCAGG - Intergenic
1113483260 13:110637009-110637031 CACCCTCCAGGAGCAGCCTGAGG - Intronic
1113485783 13:110651505-110651527 CAACCCCCAGGAGAAGCTTGCGG + Intronic
1114152546 14:20060455-20060477 CAAACCCCTTTAGCAGCTTGTGG - Exonic
1115042890 14:28953209-28953231 CATGCACCACTAGCAGCTGGAGG - Intergenic
1115552249 14:34514961-34514983 TAAAAACCAGTGGCAGCTTGAGG - Intergenic
1121048736 14:90806099-90806121 CAACCACCAGTAACAGTGTCTGG - Intronic
1122075753 14:99233573-99233595 AAACCAGCAGAAGCAGCTCGAGG + Intronic
1122155241 14:99746731-99746753 CATCCACCAGCAGCAGAATGGGG - Intronic
1122235689 14:100329668-100329690 CACCCACCAGCAGCTGCTGGAGG + Exonic
1122451817 14:101814992-101815014 CAGCCACCAGCAGCAGCTTCGGG - Intronic
1125721620 15:41847788-41847810 CAACAACCAGGAGCAGCTGCTGG + Exonic
1127379060 15:58413351-58413373 CAACCCCCAGTACCAGTGTGTGG + Intronic
1128705225 15:69833369-69833391 CAACCTCCACTAACAGCATGTGG - Intergenic
1128776384 15:70323517-70323539 CAGCCACCAGCAGCAGGTAGGGG + Intergenic
1133312898 16:4861951-4861973 CAACCACCATTACCACCTTTAGG + Intronic
1136734420 16:32451283-32451305 CAAAGAGCAGAAGCAGCTTGGGG + Intergenic
1139482403 16:67237723-67237745 CAAACACCAACAGCAGCTTCAGG + Exonic
1140485916 16:75293080-75293102 CACACACCAGAAGCAGGTTGTGG + Intergenic
1203018660 16_KI270728v1_random:378319-378341 CAAAGAGCAGAAGCAGCTTGGGG - Intergenic
1203036995 16_KI270728v1_random:651477-651499 CAAAGAGCAGAAGCAGCTTGGGG - Intergenic
1143371848 17:6445161-6445183 CCAGCACCAGGAGCAGCTGGAGG + Exonic
1143763319 17:9120667-9120689 CTACCACCAGCAGCCTCTTGGGG - Intronic
1145975561 17:28981872-28981894 CAACCACCACCCGCTGCTTGAGG - Exonic
1148339881 17:46867060-46867082 GAAACACCAGTAGCTGCTTAGGG - Intronic
1156605462 18:38661139-38661161 CTACTACCAATAGGAGCTTGTGG + Intergenic
1163355525 19:16808037-16808059 CAGCCACAAGGAGCAGCTGGTGG + Exonic
1166484088 19:43198160-43198182 CATCCACCACTGGTAGCTTGCGG + Exonic
1167301668 19:48681239-48681261 TAAACACCAGTAGCAGCTGGTGG + Intergenic
1168318999 19:55497884-55497906 CAGCCACCAGGCGCAGCTGGGGG - Exonic
1168654185 19:58115175-58115197 CAACCACTGGGAGCAGCTAGAGG - Intronic
925811279 2:7703235-7703257 GAACCACAGGTAGCAGCCTGTGG + Intergenic
926777267 2:16434916-16434938 CAAGCCCCAGTTGCAGGTTGGGG - Intergenic
930174410 2:48286973-48286995 CAACCACCAGTGAAAGCTGGAGG + Intergenic
932226764 2:70047583-70047605 CAACTACCAGAGGCAGCTGGGGG + Intergenic
932502049 2:72191469-72191491 CAACCAGCTGTGGCATCTTGGGG - Intronic
933299951 2:80530319-80530341 CAGCCCTCAGTAGCAGTTTGTGG + Intronic
933318447 2:80742734-80742756 TAACCACCAGTGACAGCTTCTGG - Intergenic
933871888 2:86574446-86574468 CAACCACCAGAAGCTGGATGAGG + Intronic
935762246 2:106332120-106332142 CAACCCCCGGTAGCAGTCTGTGG + Intergenic
937308468 2:120886751-120886773 CACCCACCAGGTGCGGCTTGGGG - Intronic
937781921 2:125848481-125848503 CAACCCCCAGTACCAGCCTGGGG - Intergenic
939613755 2:144339625-144339647 TAAACACCAGTGACAGCTTGGGG + Intergenic
944711248 2:202336655-202336677 CCAGCACCAGGAGCAGCTGGAGG - Intergenic
945987041 2:216363243-216363265 CACTTACCAGTATCAGCTTGGGG - Intronic
947169362 2:227295729-227295751 CAACCCCCAGATCCAGCTTGCGG + Intronic
1168924204 20:1566196-1566218 CAACCACCAGTAGCAGCTTGGGG + Exonic
1168928025 20:1598865-1598887 CAACCACCAGCAGCACCTTGGGG + Intronic
1173037289 20:39424608-39424630 ACACCAGCAGTAGCAGCCTGTGG + Intergenic
1175244375 20:57572801-57572823 AAACAACCAGCAGCAGGTTGGGG - Intergenic
1175341478 20:58233503-58233525 TAACCACCAGTGGCAGCGGGGGG + Intergenic
1176197162 20:63842654-63842676 CATCCTCCGGAAGCAGCTTGTGG - Intergenic
1178107185 21:29333058-29333080 CAAACTCCAGTTGCAGCGTGAGG + Intronic
1178306809 21:31497974-31497996 GAACCAGCAATATCAGCTTGGGG - Intronic
1179479298 21:41667404-41667426 CCCCCACCAGAAGCAGCCTGGGG + Intergenic
1179608767 21:42535479-42535501 CAACTATCAGCAGCTGCTTGGGG + Exonic
1179774857 21:43655182-43655204 CATACACCAGTAGCAGCGTATGG - Intronic
1180655738 22:17419107-17419129 CCATCACCAGCAGCGGCTTGTGG + Intronic
1182231070 22:28837928-28837950 CAACCACCAGTAGCATGATGAGG + Intergenic
1182319341 22:29468214-29468236 CAATCAGCAGTAACTGCTTGGGG - Intergenic
1182435091 22:30325472-30325494 CAATCACCAGTAGGAGCTCCTGG - Intronic
1182437306 22:30338950-30338972 CACCCTCCAGGAGCAGATTGAGG - Exonic
1184572166 22:45332229-45332251 CACCCCCCAGCAGCAGCCTGTGG - Intronic
1184875818 22:47274759-47274781 CTCCCACCAGTATCTGCTTGAGG + Intergenic
1185369744 22:50455558-50455580 CAGACACCTGCAGCAGCTTGTGG + Exonic
950835628 3:15916179-15916201 CAACCACCAGTAGCAATGTGTGG + Intergenic
951993960 3:28706258-28706280 CATCCAACAATAACAGCTTGTGG - Intergenic
952403757 3:32987136-32987158 CTCCCACCAGTGGCAGCCTGCGG + Intergenic
952689791 3:36191760-36191782 CAACCCCCAGTACCAGCCTGGGG - Intergenic
952928072 3:38336429-38336451 CAACCACCAGAAGCAGGAAGAGG - Intergenic
952968564 3:38636623-38636645 CGCCCACCAGGAGCAGCCTGGGG - Intronic
953100492 3:39820960-39820982 CCACCATCAGCAGCAGCCTGAGG - Intronic
954191045 3:48961247-48961269 CAACCTCCTACAGCAGCTTGAGG + Intronic
959430247 3:106245665-106245687 CTCTCACCAGGAGCAGCTTGGGG - Intergenic
960361407 3:116716355-116716377 AAACCATCAGTGGCAGTTTGGGG + Intronic
962756551 3:138469345-138469367 CAACCCCCAGGAGCATCTGGGGG - Intronic
966984692 3:185168403-185168425 AAACCCACAGTATCAGCTTGGGG + Intergenic
969317067 4:6388717-6388739 CAGCCACCACTAGAAGCTGGTGG + Intronic
969493704 4:7514102-7514124 CAGCCACCCCTTGCAGCTTGTGG - Intronic
978761479 4:112358961-112358983 CCACCACAAGCAGCAGTTTGAGG + Intronic
980831240 4:138131373-138131395 AAACCACCAGTTACAGCTGGTGG - Intergenic
988427377 5:31079150-31079172 CAACAACCAGAAGCAGATGGAGG - Intergenic
989252471 5:39333486-39333508 CACCCAGCTGTTGCAGCTTGAGG + Intronic
996542662 5:124646801-124646823 CAATCACCAGCAGCAGCTTCAGG - Exonic
998674229 5:144389226-144389248 CACGGACCAGTAGCAGTTTGTGG + Intronic
998805252 5:145912261-145912283 CAATCAGCAGTTACAGCTTGTGG + Intergenic
1000757847 5:165183785-165183807 CAATCCCCAGTACCAGCCTGGGG - Intergenic
1000779713 5:165465368-165465390 CAACCCCCAGTACCAGCTTGGGG + Intergenic
1018327730 6:162691843-162691865 GAAGCAGCAGTAGCAGCCTGGGG + Intronic
1021774263 7:24036593-24036615 CAACCAACAGCAGAAGCTGGGGG + Intergenic
1022666760 7:32418246-32418268 GAGACATCAGTAGCAGCTTGAGG - Intergenic
1023684547 7:42721088-42721110 AAACCACCAGCAGCTGATTGTGG - Intergenic
1025647573 7:63433273-63433295 CAACCACCAGCCACACCTTGTGG + Intergenic
1025740711 7:64193211-64193233 CAACCACCAGCCCCACCTTGTGG - Intronic
1026941573 7:74290350-74290372 CAGCCACCAGCGCCAGCTTGGGG - Intronic
1027195888 7:76029955-76029977 CAACCCCCAGTACCAGTCTGTGG - Intronic
1028894484 7:96025820-96025842 CAACAAACAGTACAAGCTTGCGG + Intronic
1029458498 7:100682768-100682790 CTGCCATCTGTAGCAGCTTGGGG - Exonic
1029540832 7:101180973-101180995 CAGCCACCAGGATCAGCGTGGGG - Intergenic
1031145502 7:117993380-117993402 CCACCCCCAGCAGCAGCTTTTGG - Intergenic
1034429812 7:151035643-151035665 CCACCATCAGCAGCAGCGTGAGG - Exonic
1038419621 8:27424288-27424310 CCACCACCAGTAATAGTTTGGGG - Intronic
1041617608 8:59926423-59926445 CAAACACCAGCAGCACTTTGAGG - Intergenic
1045567408 8:103335105-103335127 CAACCACCACTTCCATCTTGTGG + Intergenic
1053337146 9:37285906-37285928 TAACCACAAGTAGAAACTTGGGG + Intronic
1060999544 9:127895433-127895455 CAACCACCTGCAGCACCTGGAGG + Intronic
1062013213 9:134277882-134277904 CAACCAGCAGGGGCAGGTTGCGG + Intergenic
1187119358 X:16388497-16388519 GAAACACCAGTAGCAGAGTGGGG - Intergenic
1187537619 X:20157617-20157639 CAAACACCAGGTGCAGCTGGAGG + Intronic
1189207307 X:39253015-39253037 CAACCACCAGAAGCTTCTGGAGG - Intergenic
1190775449 X:53548996-53549018 CAGACAACAGGAGCAGCTTGGGG + Exonic
1191011830 X:55768181-55768203 TAACTATAAGTAGCAGCTTGTGG - Intergenic
1193853149 X:86564573-86564595 CCAGCACCAGAGGCAGCTTGTGG - Intronic
1197635053 X:128905074-128905096 CAGGCAGCAGTAGCAACTTGAGG + Intergenic