ID: 1168931391

View in Genome Browser
Species Human (GRCh38)
Location 20:1627167-1627189
Sequence CTCCATGGGAACCAGTGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168931386_1168931391 -9 Left 1168931386 20:1627153-1627175 CCTGAAGCCAAAACCTCCATGGG No data
Right 1168931391 20:1627167-1627189 CTCCATGGGAACCAGTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168931391 Original CRISPR CTCCATGGGAACCAGTGCCA GGG Intergenic
No off target data available for this crispr