ID: 1168937731

View in Genome Browser
Species Human (GRCh38)
Location 20:1681410-1681432
Sequence ACCACACACACACATAGATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168937731_1168937741 11 Left 1168937731 20:1681410-1681432 CCTTATCTATGTGTGTGTGTGGT No data
Right 1168937741 20:1681444-1681466 GGTGATAAGAATCTCTACCTTGG No data
1168937731_1168937740 -10 Left 1168937731 20:1681410-1681432 CCTTATCTATGTGTGTGTGTGGT No data
Right 1168937740 20:1681423-1681445 TGTGTGTGGTGGGGGGCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168937731 Original CRISPR ACCACACACACACATAGATA AGG (reversed) Intergenic
No off target data available for this crispr