ID: 1168938711

View in Genome Browser
Species Human (GRCh38)
Location 20:1690759-1690781
Sequence GAGGGTAAGCAGAAGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3016
Summary {0: 7, 1: 218, 2: 640, 3: 931, 4: 1220}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168938699_1168938711 23 Left 1168938699 20:1690713-1690735 CCAGCTCATCTCACTGGGACGGG No data
Right 1168938711 20:1690759-1690781 GAGGGTAAGCAGAAGCAGGGTGG 0: 7
1: 218
2: 640
3: 931
4: 1220
1168938697_1168938711 24 Left 1168938697 20:1690712-1690734 CCCAGCTCATCTCACTGGGACGG No data
Right 1168938711 20:1690759-1690781 GAGGGTAAGCAGAAGCAGGGTGG 0: 7
1: 218
2: 640
3: 931
4: 1220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168938711 Original CRISPR GAGGGTAAGCAGAAGCAGGG TGG Intergenic
Too many off-targets to display for this crispr