ID: 1168939449

View in Genome Browser
Species Human (GRCh38)
Location 20:1696354-1696376
Sequence GAGAGTATCTAATGCCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168939445_1168939449 5 Left 1168939445 20:1696326-1696348 CCTACTACGAACCAGACTCTTCT No data
Right 1168939449 20:1696354-1696376 GAGAGTATCTAATGCCAGGATGG No data
1168939447_1168939449 -6 Left 1168939447 20:1696337-1696359 CCAGACTCTTCTATGGAGAGAGT No data
Right 1168939449 20:1696354-1696376 GAGAGTATCTAATGCCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168939449 Original CRISPR GAGAGTATCTAATGCCAGGA TGG Intergenic
No off target data available for this crispr