ID: 1168944289

View in Genome Browser
Species Human (GRCh38)
Location 20:1738735-1738757
Sequence CCCTCCCTGCAGAGGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168944281_1168944289 -4 Left 1168944281 20:1738716-1738738 CCTCATGAATAGATTAATACCCT 0: 5
1: 91
2: 287
3: 599
4: 1333
Right 1168944289 20:1738735-1738757 CCCTCCCTGCAGAGGGTGGGGGG No data
1168944280_1168944289 -3 Left 1168944280 20:1738715-1738737 CCCTCATGAATAGATTAATACCC 0: 5
1: 80
2: 308
3: 666
4: 1414
Right 1168944289 20:1738735-1738757 CCCTCCCTGCAGAGGGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168944289 Original CRISPR CCCTCCCTGCAGAGGGTGGG GGG Intergenic
No off target data available for this crispr