ID: 1168944289 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:1738735-1738757 |
Sequence | CCCTCCCTGCAGAGGGTGGG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1168944281_1168944289 | -4 | Left | 1168944281 | 20:1738716-1738738 | CCTCATGAATAGATTAATACCCT | 0: 5 1: 91 2: 287 3: 599 4: 1333 |
||
Right | 1168944289 | 20:1738735-1738757 | CCCTCCCTGCAGAGGGTGGGGGG | No data | ||||
1168944280_1168944289 | -3 | Left | 1168944280 | 20:1738715-1738737 | CCCTCATGAATAGATTAATACCC | 0: 5 1: 80 2: 308 3: 666 4: 1414 |
||
Right | 1168944289 | 20:1738735-1738757 | CCCTCCCTGCAGAGGGTGGGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1168944289 | Original CRISPR | CCCTCCCTGCAGAGGGTGGG GGG | Intergenic | ||
No off target data available for this crispr |