ID: 1168947549

View in Genome Browser
Species Human (GRCh38)
Location 20:1774041-1774063
Sequence GAGGCTGGGTCATGGAGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168947542_1168947549 16 Left 1168947542 20:1774002-1774024 CCCTCAGTCTTTGAAAATGGAAG No data
Right 1168947549 20:1774041-1774063 GAGGCTGGGTCATGGAGAAGAGG No data
1168947543_1168947549 15 Left 1168947543 20:1774003-1774025 CCTCAGTCTTTGAAAATGGAAGA No data
Right 1168947549 20:1774041-1774063 GAGGCTGGGTCATGGAGAAGAGG No data
1168947539_1168947549 21 Left 1168947539 20:1773997-1774019 CCCTACCCTCAGTCTTTGAAAAT No data
Right 1168947549 20:1774041-1774063 GAGGCTGGGTCATGGAGAAGAGG No data
1168947540_1168947549 20 Left 1168947540 20:1773998-1774020 CCTACCCTCAGTCTTTGAAAATG No data
Right 1168947549 20:1774041-1774063 GAGGCTGGGTCATGGAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168947549 Original CRISPR GAGGCTGGGTCATGGAGAAG AGG Intergenic
No off target data available for this crispr