ID: 1168957781

View in Genome Browser
Species Human (GRCh38)
Location 20:1846586-1846608
Sequence GGCCACAGTGAGGTGCCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168957774_1168957781 25 Left 1168957774 20:1846538-1846560 CCAAGTGGGGAAGCTTGCATCTG No data
Right 1168957781 20:1846586-1846608 GGCCACAGTGAGGTGCCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168957781 Original CRISPR GGCCACAGTGAGGTGCCATG GGG Intergenic
No off target data available for this crispr