ID: 1168965125

View in Genome Browser
Species Human (GRCh38)
Location 20:1894336-1894358
Sequence CTCCCCTCGCCTCCGGACTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 2, 1: 0, 2: 2, 3: 13, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168965125_1168965129 -3 Left 1168965125 20:1894336-1894358 CCGGAGTCCGGAGGCGAGGGGAG 0: 2
1: 0
2: 2
3: 13
4: 184
Right 1168965129 20:1894356-1894378 GAGGTCGGCCGCAACTTCCCCGG 0: 1
1: 0
2: 0
3: 4
4: 50
1168965125_1168965131 11 Left 1168965125 20:1894336-1894358 CCGGAGTCCGGAGGCGAGGGGAG 0: 2
1: 0
2: 2
3: 13
4: 184
Right 1168965131 20:1894370-1894392 CTTCCCCGGTCCACCTTAAGAGG 0: 1
1: 0
2: 1
3: 4
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168965125 Original CRISPR CTCCCCTCGCCTCCGGACTC CGG (reversed) Exonic
900647268 1:3714604-3714626 CTGGCCTCTCCTCCGGCCTCTGG - Intronic
900806208 1:4769792-4769814 CCCCCCTCGCCTCCTGAACCTGG + Intronic
900977764 1:6027830-6027852 GTCCCCTCGGCTCAGGCCTCAGG + Intronic
901772938 1:11539935-11539957 CTTCCCTCCCCGCCGGCCTCTGG + Intergenic
902539333 1:17141759-17141781 CTCCCCTCTCCTCCAGCCCCAGG - Intergenic
902781544 1:18708211-18708233 CTCCCCTCTGCTCCGGGCTGAGG + Intronic
903624621 1:24721711-24721733 CTCCCCACGCCGCAGGGCTCGGG + Intergenic
904466611 1:30711790-30711812 CTCCCCTCTCCTCCCCACACAGG - Exonic
905544543 1:38787190-38787212 CTTCCCCTGCCTCCTGACTCAGG - Intergenic
906961615 1:50422647-50422669 CTCCCCTCCCCTCCGGGTTTAGG + Intronic
907046509 1:51303185-51303207 CTCCCATCCCCTCAGGACTATGG - Exonic
907289923 1:53407179-53407201 CTCCCCTAGCCTCCTGAGTGGGG - Intergenic
912316016 1:108667937-108667959 CTCCACTCCCCACCAGACTCAGG - Intergenic
912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG + Intergenic
915470633 1:156123785-156123807 GTGCCCTGGCCTCCGGCCTCAGG + Intronic
917167837 1:172133278-172133300 ATCTCCTCTCCTCCAGACTCAGG + Intronic
918487665 1:185045989-185046011 GTCCCCTCGCCTCCGGGGGCGGG + Intronic
920418509 1:205813873-205813895 CTCCCCTCCTCTCCGACCTCAGG - Intergenic
920498415 1:206471272-206471294 CTCCCCTCCCCTCCCTCCTCAGG - Intronic
922877631 1:228952520-228952542 CTCCCCTCTACTCTGGCCTCCGG + Intergenic
923181982 1:231528622-231528644 CTCCCCTCCCCTCCGGACGCAGG + Intergenic
923191737 1:231626793-231626815 TTCCCCCCGCCTCTGGCCTCGGG + Exonic
1063383261 10:5600032-5600054 CACCCCTCTCCTCCGGGCCCTGG - Intergenic
1063671528 10:8103383-8103405 CCCCCCCCGCCTCCAGCCTCGGG - Intergenic
1065637017 10:27743584-27743606 CTCCCCTCGGCTCCGCAGCCCGG - Intronic
1067227655 10:44386145-44386167 CTCCCTTCGCCACCGGACTGGGG - Intronic
1069680807 10:70283935-70283957 CGCCCCTCGCCTCCCGACCAGGG + Intergenic
1070961888 10:80505250-80505272 CTCCCCTCTCCTCCTGAGGCTGG - Intronic
1074104196 10:110376465-110376487 CTCCACTCCCCTCCTGCCTCCGG + Intergenic
1074826002 10:117216247-117216269 ATCCCCTCCCCTCCTGAGTCTGG - Intergenic
1076616652 10:131759539-131759561 CTCCCGCAGCCTCCGGTCTCCGG - Intergenic
1077324244 11:1956909-1956931 CTCCCGACGCCTCTGGGCTCAGG - Intronic
1081975484 11:47231856-47231878 CTCCCCTCGCCCCCAGCCCCTGG - Intronic
1084375351 11:68773126-68773148 CTCCCCCCGACCCCGGTCTCCGG - Intronic
1085387204 11:76164080-76164102 CTCCCCCTGCCTCCCCACTCAGG - Intergenic
1086437978 11:86800457-86800479 CCCGCCCCGCCTCCGGCCTCGGG - Exonic
1089490999 11:118884054-118884076 GTCCCCTCTCCCTCGGACTCTGG - Intronic
1202807230 11_KI270721v1_random:12104-12126 CTCCCGACGCCTCTGGGCTCAGG - Intergenic
1092120473 12:6040141-6040163 TTACCCTTGCCGCCGGACTCAGG + Intronic
1093015143 12:14147889-14147911 CTCCCCTCTGCTCATGACTCGGG - Intergenic
1093892132 12:24534848-24534870 CTCGCATCCCCTCTGGACTCTGG - Intergenic
1096116939 12:49060369-49060391 CTCCCTTCCCCTCTGGCCTCGGG + Intergenic
1102819692 12:115897300-115897322 CCCACCTGGCCTCCAGACTCAGG - Intergenic
1102819701 12:115897336-115897358 CCCACCTGGCCTCCAGACTCAGG - Intergenic
1102819710 12:115897372-115897394 CCCACCTGGCCTCCAGACTCAGG - Intergenic
1103917593 12:124384030-124384052 CTCCCCCCGCCTCCCCTCTCTGG - Intronic
1104441026 12:128793084-128793106 CTCCCCTCAGTTCCCGACTCGGG + Intergenic
1105826454 13:24127437-24127459 CTCCCCTACCCTCTGGCCTCTGG - Intronic
1106558643 13:30830824-30830846 CTCCCTTCCCCTCTGGTCTCTGG - Intergenic
1116973954 14:51095338-51095360 GTCCCCTAGCCTCCGCACGCCGG - Exonic
1121318303 14:92975141-92975163 CTCCCATGGCCTTCGGAATCAGG + Intronic
1121794766 14:96725641-96725663 CTCCCCTCAACTCTGGACTCTGG + Intergenic
1122077646 14:99246256-99246278 CGCCCCTCGCCGCCCGGCTCAGG + Intronic
1122939248 14:104973879-104973901 CTCCCCTCCCCTCCGGCTGCGGG - Intronic
1125181838 15:36887521-36887543 CTCCCCTCGCCCCCCGCCGCTGG - Intergenic
1125503221 15:40252368-40252390 CGCCCTTCGCCTCCGGGCCCTGG - Exonic
1125506311 15:40269766-40269788 CTCCCCCAGCCTCCAGACGCAGG + Intronic
1127154358 15:56110445-56110467 CTCCCCTCGCCTCCCGGATGGGG - Intronic
1127262976 15:57339202-57339224 CTCCCTTCCCCTCCTGATTCTGG - Intergenic
1128545737 15:68566505-68566527 CTCCCCTTCCCTCCAGCCTCGGG + Intergenic
1128742068 15:70090602-70090624 CTCCCCTCCCCTCCCCGCTCTGG - Intronic
1130570600 15:85039921-85039943 CTCCCCTACCCTCCAGCCTCTGG - Intronic
1133036322 16:3036184-3036206 GCCCCCACCCCTCCGGACTCAGG + Intronic
1133305387 16:4805047-4805069 GTCCCCTCCCCACCGGCCTCAGG + Exonic
1136366699 16:29812306-29812328 CTCACCTCGACGCCGGCCTCCGG - Exonic
1136499166 16:30661147-30661169 CCTCCCTCACCTCTGGACTCTGG + Intronic
1142586644 17:978843-978865 CTCCCCTCCCCTCCCCACTGTGG + Intronic
1142737229 17:1908656-1908678 CTCCCAGCGCCTCCGGAATTAGG - Intergenic
1146187739 17:30736339-30736361 CGCCCCTCACCTCTGCACTCTGG + Intergenic
1146431517 17:32800532-32800554 CTCCCCTGGTCTCCAGCCTCTGG - Intronic
1146846430 17:36184104-36184126 CTCCCCACGCCCCAGGACCCCGG - Intronic
1147986009 17:44308336-44308358 CTCGCCTCGCCTCGAGTCTCTGG - Intergenic
1148215247 17:45830619-45830641 CTGCCCTCTCCTCCAGACTCAGG + Intronic
1149659959 17:58329028-58329050 CCCCACTCGCCTCTGTACTCCGG - Intergenic
1150179576 17:63102628-63102650 CTCCCCCCACCTCTGGACACAGG + Intronic
1151341591 17:73474705-73474727 CTCCCCTCGCCTCGGGAGAGAGG - Intronic
1151696564 17:75721173-75721195 CTCCCCACCCCTCCAGGCTCCGG - Intergenic
1152288254 17:79424648-79424670 CTCCTCTCCCCTCTGGCCTCAGG + Intronic
1152362750 17:79839978-79840000 CCCGCCTCGCCTCCAGGCTCCGG + Intergenic
1157794432 18:50560723-50560745 CTCCCCTCGCCACCCGACAGAGG + Intronic
1160880101 19:1315813-1315835 CCCCCCGCGGCTCCGGGCTCAGG + Intergenic
1160996561 19:1884877-1884899 CTCCGCTCGCGTCCGTTCTCCGG - Intronic
1161024054 19:2026965-2026987 CTAACCTGGACTCCGGACTCCGG - Intronic
1161767233 19:6214454-6214476 CTCCCCTGGCCGCCTGACCCTGG + Intronic
1162799853 19:13104433-13104455 CCCCCCTCGCCCCGGGCCTCAGG + Intergenic
1162819067 19:13211996-13212018 ATCCCCTCCCTGCCGGACTCAGG - Intronic
1163018660 19:14471565-14471587 CTTCCCTCCCCTGCAGACTCTGG + Exonic
1164731245 19:30506525-30506547 CTCCCCTCGCCTCAGCACAAAGG - Intronic
1165157794 19:33798197-33798219 CTCCCCTCGGCTCCGCACTCAGG - Intronic
1165578003 19:36838272-36838294 CTCCCCTCAGCCCCGGCCTCGGG + Intronic
1166391502 19:42411200-42411222 CTGCCCTGGCCTCCTGAATCCGG + Intronic
1167312846 19:48747115-48747137 CTCCCCTTGCCCCAGGACCCAGG + Intergenic
1168272715 19:55258707-55258729 CCCACCTCGCCTGCGGACCCCGG - Exonic
927095856 2:19747131-19747153 TTCCTCTCGCCTGGGGACTCGGG - Intergenic
927433333 2:23045722-23045744 CTCCCCTCTCCCCCAGCCTCTGG - Intergenic
927799711 2:26086954-26086976 CTCCCCTCCCCTCCAGTCCCTGG - Intronic
929180432 2:39032282-39032304 CTCCCCTACCCTCCAGCCTCTGG + Intronic
929557217 2:42932974-42932996 CTGCCCTCAGCTCAGGACTCCGG - Intergenic
930752687 2:54948275-54948297 CCGCCCTCGCCTCAGGACTCGGG - Intronic
932703266 2:74004815-74004837 CTCCCCTCGCCTCCCGCTGCTGG + Intronic
933206318 2:79512606-79512628 CTCCCCGGGCCTCGCGACTCCGG + Intronic
933388825 2:81645375-81645397 CTCCCCACCCCTCCAAACTCTGG - Intergenic
934696165 2:96402124-96402146 CTCCCCTTTCCTCCAGCCTCTGG - Intergenic
937376673 2:121341154-121341176 TTTCCCTCTCCTCTGGACTCTGG - Intronic
939797118 2:146659167-146659189 CTCCCCTACCCTCCAGACTTGGG - Intergenic
940919048 2:159287185-159287207 CTGCCCTCGCCTCCTCATTCGGG + Intergenic
942307898 2:174626918-174626940 CTCCCCTCACTCCCAGACTCTGG + Intronic
948242543 2:236449508-236449530 CAGCCCCCGCCTCCGGACTGTGG - Intronic
949076764 2:242064151-242064173 CTGCCCTGGCCTCTGGGCTCTGG - Intergenic
1168965125 20:1894336-1894358 CTCCCCTCGCCTCCGGACTCCGG - Exonic
1171460553 20:25295679-25295701 CTCCCCTAGCCTCTGGACCCAGG - Intronic
1174151189 20:48487690-48487712 CTCCTCCCTCCTCAGGACTCAGG - Intergenic
1174271774 20:49374599-49374621 CTCCACTGGCCTCCAGTCTCTGG - Exonic
1174405188 20:50298340-50298362 CTCCCATCGCCTGCCGACTGTGG + Intergenic
1175812781 20:61867703-61867725 CTCTGCTCGCCTCCTGCCTCAGG - Intronic
1175890496 20:62313802-62313824 CACCCCTCGCCTCTGCCCTCAGG - Exonic
1176385866 21:6138314-6138336 CTCTCCTCCCCTCCGGGGTCAGG + Intergenic
1178027908 21:28489199-28489221 CTCCCCTCGCATCCTCTCTCAGG + Intergenic
1178376394 21:32071022-32071044 CTGCCCTCACCTCCTGCCTCTGG + Intergenic
1179737607 21:43399938-43399960 CTCTCCTCCCCTCCGGGGTCAGG - Intergenic
1180096545 21:45557883-45557905 CTCCCCACGCCACTGGGCTCAGG - Intergenic
1180193911 21:46182419-46182441 CTCCCCTCCCCTTCGGTCGCTGG - Intronic
1180707301 22:17817622-17817644 CTCTCCCCGCCGTCGGACTCAGG - Exonic
1182469951 22:30542382-30542404 CTCCCCTCGCCTCCGGACTCCGG - Intronic
1183149753 22:36028435-36028457 CCCCCCTCGCCTCCGGGAGCCGG + Intergenic
1183149869 22:36028823-36028845 CTCCCCACGCCTCGGGAGCCCGG - Intergenic
1183408119 22:37640249-37640271 CTCCCCTCGCCCCAGGTCTGTGG - Intronic
1184341715 22:43889794-43889816 CTCACCTCCCCTCTGAACTCGGG + Exonic
1184681079 22:46072327-46072349 CTCTCCTTGCCTTCGGGCTCCGG - Intronic
1185413381 22:50697401-50697423 CTCCCCTCGCCGCCGACCCCCGG - Intergenic
952946185 3:38479106-38479128 AACCCCTCGCCCCCGGCCTCAGG + Exonic
955768940 3:62371167-62371189 CTCACCTCACCTCAGGACTCGGG - Intronic
960628303 3:119702896-119702918 CTCCACTCTCCTCCTGACCCTGG + Intergenic
961368968 3:126418227-126418249 CTTCCCACGCGGCCGGACTCTGG + Intronic
961681693 3:128604008-128604030 CCCCCCTCGCCCACGGGCTCCGG + Intergenic
962266051 3:133945062-133945084 CTCCTCTTGCCTCTGGACCCTGG + Intronic
964766257 3:160180967-160180989 CTCCCTTCCCATCCGGCCTCAGG + Intergenic
966651222 3:182303312-182303334 GTCCCATCTCCTCAGGACTCAGG + Intergenic
968640320 4:1711529-1711551 CTCACTTCTCCTCGGGACTCGGG + Intronic
969436386 4:7191877-7191899 CTCCCCACGCCTCCCCACACAGG + Intergenic
976980208 4:91217868-91217890 CTCCACTCCCCACCAGACTCAGG + Intronic
977716654 4:100190559-100190581 CGCCCCTCCCCTCCAGAGTCTGG + Intronic
980566284 4:134546625-134546647 CTCCCCACGCCTCCGGGCTGGGG - Intergenic
981722476 4:147815465-147815487 CTCCCCCCGCCCCCCGCCTCCGG - Intronic
982245346 4:153344949-153344971 GCCCCCGCGCCTCGGGACTCCGG - Intronic
984126934 4:175822821-175822843 CTCCCCTTGCCCCCAGCCTCTGG + Intronic
986337584 5:6766826-6766848 CTGCCCTGGCCTCCAGGCTCCGG - Intergenic
986492285 5:8305891-8305913 CTCCCCTAGCCTACTGCCTCTGG - Intergenic
991381930 5:66037381-66037403 CTACCCTCACCTCCTGACTTGGG + Intronic
993902850 5:93596103-93596125 CTCCCCTCCCCCTCGGAATCCGG - Intergenic
995383037 5:111556401-111556423 CTCCCCTCGCTTTCAGCCTCTGG + Intergenic
997412719 5:133702486-133702508 GTCCCCAAGCCCCCGGACTCCGG - Intergenic
998217196 5:140246211-140246233 CTCCCCTCACCTCCGAACCATGG + Intronic
1001562097 5:172676539-172676561 CTCCCATTGCCTCAGGAGTCAGG - Intronic
1002893399 6:1357221-1357243 TTCCCCCTGCCTCCGGCCTCTGG - Intergenic
1004098671 6:12585777-12585799 CTCCTGTTGCCTCTGGACTCGGG + Intergenic
1004479489 6:16005150-16005172 CTCCTATCGCCTCCTGAGTCAGG - Intergenic
1005048997 6:21666495-21666517 CTCCCCTCTCCCCCGGACGCCGG + Intergenic
1005669582 6:28091406-28091428 CTCCTCTCGCCTCCTGGCGCTGG + Intergenic
1006071256 6:31499206-31499228 CTCCCCTCGCCTCCGGCTCCGGG + Intronic
1006098178 6:31669249-31669271 CTAACCTCCCCTCAGGACTCAGG - Intronic
1006333728 6:33410219-33410241 CTAGCCCCGCCTCTGGACTCTGG - Intergenic
1007132110 6:39484930-39484952 CTGCCCTCTCCTCTGGATTCTGG + Intronic
1010012808 6:71068952-71068974 CTCCCCTTCCCTCCTGACTTTGG + Intergenic
1011517373 6:88167453-88167475 CTCCCCTCCCCTCCGCCCCCGGG + Intergenic
1017091614 6:150764002-150764024 CTCTCCTCTCCACCTGACTCAGG + Intronic
1018873884 6:167803573-167803595 CTCCCCTAGCCCCCAGGCTCTGG + Intergenic
1019533267 7:1514226-1514248 CTGCCTCCGCCTCCGGCCTCCGG - Intergenic
1022311015 7:29195391-29195413 CTCCCCTCTGCTCCGGATTTGGG - Intronic
1022972277 7:35529283-35529305 CTCCCCTTGACTTCTGACTCAGG + Intergenic
1022993336 7:35729638-35729660 CTCCCCTAGCCTCCAGAGTCTGG + Intergenic
1023152575 7:37215737-37215759 CTTCCCCTGCCTCCTGACTCAGG + Intronic
1025231560 7:57206217-57206239 CTCCTCCCTCCTCAGGACTCAGG + Intergenic
1025955936 7:66183043-66183065 ATACCCTCCCCTGCGGACTCTGG - Intergenic
1033219284 7:139517477-139517499 TTCCCCTCACCCCCGGCCTCTGG - Intergenic
1034251299 7:149692837-149692859 CCGCCCTCGCCTCCGCACCCTGG + Intergenic
1034335841 7:150323182-150323204 CTGCCCACGCCTGCGCACTCAGG + Intronic
1034417254 7:150971631-150971653 CTTCCCTCGCCTCAGCACCCCGG - Intronic
1034743800 7:153503909-153503931 CTCACCTTGTCTCCTGACTCTGG + Intergenic
1035362206 7:158321100-158321122 CACCCCTGGCGTCCCGACTCCGG - Intronic
1036399690 8:8396748-8396770 CTCACCTCTCCTCCAGCCTCTGG - Intergenic
1036792690 8:11732629-11732651 TTCCTCTAGCCTCCAGACTCGGG - Intronic
1037817722 8:22120682-22120704 CTCCCCTCCCCTCCCGGCCCTGG - Intronic
1039987755 8:42462157-42462179 CACCCCTCCCCTCCTGTCTCTGG - Intronic
1040688899 8:49910700-49910722 GCCCCCTCGCCTCCCTACTCCGG - Intronic
1041206297 8:55501459-55501481 CTCCCCTCACCTCCAGCCCCTGG + Intronic
1041740259 8:61150419-61150441 CTCCCCTAGCATCTGGTCTCAGG - Intronic
1044824224 8:96181037-96181059 CTACCCTGGCCTCTGGACACAGG - Intergenic
1049254217 8:141605283-141605305 CTCCCTGCGCCTCCGGGCTCTGG - Intergenic
1052951513 9:34217032-34217054 CTCCCCACCTCTCCGGCCTCTGG + Intronic
1057412359 9:94828038-94828060 CTTCCCTCGCCTTCTGCCTCTGG - Intronic
1057556807 9:96094699-96094721 CTCCCCCCGCCTCCAGACCTGGG - Intergenic
1059206090 9:112467391-112467413 CTCCCCCTGCCTCCAGACTCTGG - Intronic
1060811069 9:126611791-126611813 CGCTCCGCGCCTCGGGACTCTGG + Intergenic
1061517284 9:131097048-131097070 CGCCTCCCGCCTCCGGTCTCGGG + Intronic
1062688094 9:137826681-137826703 CTCCCCTCTCCTCTGGGCTGCGG - Intronic
1187143057 X:16613034-16613056 CTCCCCTCTGCTCGGGACTCTGG + Intronic
1196425097 X:115561693-115561715 CTTCCCTCCCGCCCGGACTCAGG + Intronic
1196504498 X:116425278-116425300 CTTCCCTCGGCTCCTGCCTCTGG - Intergenic
1197412883 X:126139927-126139949 CTCCCCTCGCCCCCAAACACAGG - Intergenic
1199699755 X:150366242-150366264 CTCCCCTCCCCTCCCATCTCTGG + Intronic