ID: 1168969437

View in Genome Browser
Species Human (GRCh38)
Location 20:1920895-1920917
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 800
Summary {0: 2, 1: 1, 2: 11, 3: 117, 4: 669}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168969429_1168969437 25 Left 1168969429 20:1920847-1920869 CCTCATTTAATCCTCGCTGCATC 0: 1
1: 1
2: 3
3: 32
4: 288
Right 1168969437 20:1920895-1920917 CATTTTACAGACAAGGAGCTGGG 0: 2
1: 1
2: 11
3: 117
4: 669
1168969433_1168969437 2 Left 1168969433 20:1920870-1920892 CCAGAAAGGAGAAATGCTGCTGT 0: 1
1: 0
2: 1
3: 24
4: 245
Right 1168969437 20:1920895-1920917 CATTTTACAGACAAGGAGCTGGG 0: 2
1: 1
2: 11
3: 117
4: 669
1168969431_1168969437 14 Left 1168969431 20:1920858-1920880 CCTCGCTGCATCCCAGAAAGGAG 0: 1
1: 0
2: 1
3: 10
4: 171
Right 1168969437 20:1920895-1920917 CATTTTACAGACAAGGAGCTGGG 0: 2
1: 1
2: 11
3: 117
4: 669
1168969432_1168969437 3 Left 1168969432 20:1920869-1920891 CCCAGAAAGGAGAAATGCTGCTG 0: 1
1: 0
2: 2
3: 27
4: 357
Right 1168969437 20:1920895-1920917 CATTTTACAGACAAGGAGCTGGG 0: 2
1: 1
2: 11
3: 117
4: 669

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900780292 1:4613587-4613609 CATTCTGCAGACAGGGAGCATGG - Intergenic
901690884 1:10972657-10972679 CATTTTGCAGAAAAGGAAATGGG - Intronic
902388706 1:16090455-16090477 CATTTTACAGATAAGGAGATTGG - Intergenic
902652364 1:17845022-17845044 CATTCCACATACAAAGAGCTGGG - Intergenic
902714946 1:18266214-18266236 CATTTTATAGAAAAGGAGAGAGG + Intronic
902996135 1:20226705-20226727 CATTTTACAGATAAGGAAATAGG - Intergenic
903375874 1:22865603-22865625 AATCATACAGACAAGGAGCAGGG - Intronic
903438606 1:23370497-23370519 CATTTTAGAGAAAAGGAAATGGG - Exonic
903515280 1:23906286-23906308 CATTTTACAGACAAGGACAGTGG - Intronic
903538087 1:24080608-24080630 CATTTTACAGACGAGGGGACAGG - Intronic
904002440 1:27346421-27346443 CATTTTACAGACGACGAGCATGG - Intronic
904129471 1:28265059-28265081 CATTTTACAGATGAGGAACAAGG - Intronic
904563958 1:31416119-31416141 CACTTTACAGACAAGGGGATGGG - Intronic
904568492 1:31442959-31442981 CCTTTTACAGACAAGGAAGCTGG - Intergenic
904591281 1:31616943-31616965 CATTTTACAGATAAGGACACTGG - Intergenic
904812212 1:33170814-33170836 CATTTTTCAGACAAGGCACTGGG - Intronic
905034953 1:34912061-34912083 CATTTTACAGATGAGGAGACAGG - Intronic
905791951 1:40794423-40794445 CATTTTGCAGACAAGAAACTGGG + Intronic
906265497 1:44425661-44425683 CATTTTATATATGAGGAGCTGGG - Intronic
906488395 1:46248502-46248524 CCCTTTACAGAGGAGGAGCTTGG + Exonic
907136647 1:52144823-52144845 CATTTTACAGACAATGACATTGG - Intronic
907202637 1:52740881-52740903 CATTTTACAGACAAAGAGGAAGG - Intronic
907230249 1:52991166-52991188 CATTTTATAGATAAGAAACTAGG - Intronic
907381669 1:54095791-54095813 CATTTTACAGATAAGGAAATAGG - Intronic
907549532 1:55292564-55292586 CATTTTACAGAGAAGGAAAGTGG - Intergenic
907550752 1:55302737-55302759 CATTTTACAGATGAGGAACTGGG - Intergenic
907759176 1:57341083-57341105 CATTTTACAGACGAGGACATTGG + Intronic
907912118 1:58835844-58835866 GATTTTACAGGCAAAGAGATTGG + Intergenic
908339048 1:63157721-63157743 CATTTTACAGATGAGGGACTAGG + Intergenic
908385580 1:63638256-63638278 CATTTTACAGAGAAGGAAACAGG - Intronic
909872520 1:80760770-80760792 CATTTTTCAGACTGTGAGCTTGG + Intergenic
910121012 1:83790433-83790455 CATTTTACAGGTAAGGAAATAGG + Intergenic
910389248 1:86721326-86721348 CATTTTAAAGACAAGGAAACAGG + Intronic
910643087 1:89485561-89485583 CATTTTACTGATAAAGAGCCTGG + Intergenic
910782349 1:90953340-90953362 CATTTAACAGACATGGAGAGGGG + Intronic
911028089 1:93456472-93456494 CAATTTATAGAAAAGGAGCCAGG + Intronic
911188100 1:94923891-94923913 CATTCTACAGAACAGAAGCTAGG + Intronic
911196910 1:95004095-95004117 CATTTTACAGATAAGAAACCTGG + Intronic
911339430 1:96618840-96618862 CATTTTACAGATGAGGAAATTGG - Intergenic
912125124 1:106526923-106526945 GATTTGACAGGCAGGGAGCTAGG - Intergenic
912535078 1:110361620-110361642 CATTTTACAGAGCAGGAAATTGG + Intergenic
912559808 1:110542431-110542453 CATTTTACAGATAAGGAATCTGG - Intergenic
912744481 1:112233947-112233969 CATTTCACAGTGAAGGAGATAGG + Intergenic
912816371 1:112831985-112832007 CATTTTCCAAACATGGACCTAGG - Intergenic
912926022 1:113913580-113913602 CATCTTACAGATGAGGAACTAGG - Exonic
913141298 1:115943840-115943862 CGTTTTACAGATAAGGAAGTCGG + Intergenic
914682348 1:149947600-149947622 CATTTTCCAGACACTGTGCTGGG - Intronic
915224448 1:154402268-154402290 CACTTTTTAGATAAGGAGCTAGG - Intergenic
915353620 1:155242092-155242114 CATTTTCCAGGCAAGGAAATGGG - Intronic
915612182 1:157003150-157003172 CATTTTACAGATAAGAAAATGGG + Intronic
916372146 1:164110073-164110095 CATTTTTTATAAAAGGAGCTAGG - Intergenic
916383150 1:164235872-164235894 CATTTTAGAGGCAAGGGCCTAGG + Intergenic
917581547 1:176383628-176383650 CATTTGAGTGACAATGAGCTTGG - Intergenic
917639355 1:176968123-176968145 CATTTTACAGATGAGGATATGGG - Intronic
917694059 1:177501438-177501460 CATTTTACAGAAGAGGACATTGG + Intergenic
918201845 1:182274989-182275011 CATTCTACAGATGAGGAACTGGG + Intergenic
918209955 1:182341687-182341709 CATTTTACAGAGGAGGAAATAGG - Intergenic
918561186 1:185869287-185869309 CATTTTACAGACAGGGAAACTGG - Intronic
918748495 1:188239357-188239379 CATTTTACTGAGAAGGAAGTAGG - Intergenic
918807874 1:189072881-189072903 TATTTTAAAGAAAAGGAGGTAGG + Intergenic
919864796 1:201772730-201772752 CATTATAAATACTAGGAGCTTGG + Intronic
919992533 1:202718477-202718499 CATTTTACAGATGAGGAAATTGG - Intergenic
920003643 1:202816566-202816588 CATTTTATAGATGAGGAACTGGG + Intergenic
920067164 1:203277160-203277182 CATTTTACAGACCAGGAAACTGG + Intergenic
920248608 1:204606968-204606990 CATTGAAAAGATAAGGAGCTAGG - Intergenic
920734515 1:208518648-208518670 CATTTTACAGAGAAACAGATGGG + Intergenic
920938185 1:210455651-210455673 CATTTTACAGATAGGAACCTGGG - Intronic
921350394 1:214228719-214228741 CATTTTACAGATGAGGGGATGGG - Intergenic
921697883 1:218232919-218232941 CATTTTAAAGACAAGGAAACAGG + Intergenic
921825682 1:219669532-219669554 TATTTTACAGACAAGGAAGCAGG - Intergenic
922591331 1:226779479-226779501 CATGTAATTGACAAGGAGCTGGG + Intergenic
922778199 1:228227254-228227276 CATTTTACAGACAGGGAAACAGG - Intronic
923102176 1:230825525-230825547 CATATTACAGATGAGGAACTTGG + Intergenic
923133415 1:231096792-231096814 CATTTTACAGACAAAGACCCTGG - Intergenic
923766083 1:236893489-236893511 CATTTTACAGACAAGAAATCAGG - Intronic
924119269 1:240779712-240779734 CATTTTACAGATGAGGAAATAGG - Intronic
1063309836 10:4941705-4941727 GATTTTCCAGAGAAGGAGGTTGG + Intronic
1063317453 10:5020397-5020419 GATTTTCCAGAGAAGGAGGTTGG - Intronic
1063705488 10:8426277-8426299 CATTTTCCAGCCAATGCGCTTGG - Intergenic
1064275231 10:13899470-13899492 TTTTCTACAGACAAGGAACTTGG + Intronic
1064310426 10:14207532-14207554 CATTTTACAGACAAAAAGACTGG - Intronic
1064736092 10:18383237-18383259 CATTATACAGGTAAGGAGCATGG + Intronic
1065127924 10:22592250-22592272 TATTTTACAGATGAGGAGATGGG + Intronic
1065290950 10:24228823-24228845 CATTGTACAGATAAAGTGCTAGG - Intronic
1065376738 10:25050668-25050690 TATTGTAATGACAAGGAGCTGGG + Intronic
1065611442 10:27475077-27475099 CATTTTACAGATGAGGAAATGGG + Intergenic
1065666463 10:28067940-28067962 TATTTCACAGAGAAGGAGATAGG - Intronic
1066224503 10:33369199-33369221 CATTTTATAGACAAAGAAATTGG + Intergenic
1066387552 10:34954006-34954028 TATTTTGCAGACAAGGAACTGGG - Intergenic
1067457825 10:46435281-46435303 CTTATAAGAGACAAGGAGCTGGG - Intergenic
1067629377 10:47949346-47949368 CTTATAAGAGACAAGGAGCTGGG + Intergenic
1068079533 10:52302725-52302747 AATTTTAAAGACAAAAAGCTAGG - Intergenic
1069548176 10:69343617-69343639 CATTTTACAGGCCAGGAACTAGG + Intronic
1069777962 10:70937807-70937829 CAGTTTACAGATAAGGAAATAGG - Intergenic
1069893034 10:71663786-71663808 CATTTTACAGGCAAAGAGACTGG - Intronic
1070046009 10:72837652-72837674 CATTTTACAGTTGAGGATCTGGG - Intronic
1070778349 10:79123348-79123370 CATTTTACAGATGAGGAAATGGG - Intronic
1071685643 10:87752513-87752535 CATTTTACAGATGAGAAACTGGG + Exonic
1071807820 10:89143331-89143353 CATTTTACAGACAAGAAAATTGG - Intergenic
1072066460 10:91876221-91876243 CATTTTACAGATGAGGAAATGGG - Intergenic
1072320699 10:94246769-94246791 CATTTTATAGAAAAGGGGATTGG - Intronic
1072576316 10:96703874-96703896 CATTTTACAGATGAAGAACTTGG + Intronic
1072794386 10:98343306-98343328 CATGTCACAGACAAGGAAATAGG + Intergenic
1072921029 10:99577444-99577466 CATTTTAAAGACGAGGGACTGGG + Intergenic
1073320758 10:102615010-102615032 CTTTTTACAGAGGAGGAACTGGG - Intronic
1073591858 10:104765422-104765444 CATTTTACAGATAAGGAGACAGG - Intronic
1073978256 10:109124716-109124738 CATTTTACAGCCAAGAAGACTGG - Intergenic
1074047437 10:109851518-109851540 CAATTTATAGCCAAGGAGCAGGG - Intergenic
1074126852 10:110535397-110535419 CATTTTAAAGAAAAGAAGCTGGG - Intergenic
1074289253 10:112126084-112126106 CATTTTACAGATAAGGAAACAGG + Intergenic
1074574207 10:114653163-114653185 CATTTTACAGAGAAGGAAACTGG - Intronic
1074611447 10:115025867-115025889 CATTTTACAGATAGGGAAATTGG + Intergenic
1074860639 10:117507464-117507486 TATTTTACAGAGAAGGAAATAGG - Intergenic
1075250904 10:120871647-120871669 CCAATTACAGACAAGGAGCCTGG - Intronic
1075517415 10:123119732-123119754 CATTTGACAGATGAGGAGGTGGG + Intergenic
1075557632 10:123444887-123444909 CATTTTACAGACAACGAAACAGG + Intergenic
1075630508 10:123998021-123998043 CATTTTACAGAAAAGGAAGCTGG - Intergenic
1076062904 10:127427536-127427558 CATTTTACAGTCAAGGAAACAGG + Intronic
1076141711 10:128084603-128084625 CATTGTACAGAGAAGGAGAGAGG - Exonic
1076470176 10:130713260-130713282 GGGTTTACAGCCAAGGAGCTAGG - Intergenic
1077279186 11:1734375-1734397 TATTTTACAGCTAAGGAGATGGG + Exonic
1078497220 11:11830319-11830341 AATTTTACAGACAAGGAAACAGG - Intergenic
1078506706 11:11955647-11955669 AATTTTATAGATGAGGAGCTAGG - Intronic
1078738496 11:14044058-14044080 CATTTTACAGAGGAGGAGACAGG + Intronic
1078782307 11:14450883-14450905 CATTTTACAGATAAGAACATAGG + Intronic
1080173562 11:29335335-29335357 CATTTTACAGATTAGGAGACTGG - Intergenic
1080400635 11:31932090-31932112 CATTTTGCAGATAAGGAAATTGG - Intronic
1080568294 11:33532523-33532545 CATTTTACAGATAAGGAAACTGG + Intergenic
1080716358 11:34805564-34805586 CATTTTACAGAAAAGGGTGTCGG + Intergenic
1080893633 11:36430753-36430775 CATTTTACATATGAGGAGCTTGG + Intronic
1081396185 11:42588967-42588989 TATTTTACAGAGAAGGAGAAAGG + Intergenic
1081496440 11:43615888-43615910 TATTTTATAGACAAAGAGCATGG + Intronic
1083729888 11:64647173-64647195 CATTTTACAGACATGGAATACGG - Intronic
1083969050 11:66061445-66061467 CATTTTACAGATGAGGAGGCAGG + Intronic
1084266804 11:68009183-68009205 CATTTTACAAACGAGGAAGTGGG - Intronic
1084287395 11:68141067-68141089 GATTTTGCAGACAAGGAGGCAGG + Intergenic
1084328017 11:68412906-68412928 CATTTTACAGATGAGGAGGCTGG + Intronic
1084445837 11:69202977-69202999 CAGCTTAGAGACCAGGAGCTGGG - Intergenic
1084640164 11:70420922-70420944 CACTTTATAGACAAGAAGCCTGG - Intronic
1084693786 11:70742026-70742048 CATTTTACAGATGAGGAGGTGGG - Intronic
1084869565 11:72088785-72088807 CATTTTCCAGACAAAGAAATGGG + Intronic
1084922674 11:72483754-72483776 CATGTTTCAGACAAGGCTCTGGG + Intergenic
1085006902 11:73100189-73100211 CATTTTGGTGACAAGGAGGTGGG - Intronic
1085058854 11:73426029-73426051 CATTTTACATACAACAAACTTGG - Intronic
1085187878 11:74591702-74591724 CATTTTATAGATAAGGAAATAGG + Intronic
1085332256 11:75663354-75663376 CATGTACCAGACAAGGAGCTGGG - Intronic
1085585142 11:77695688-77695710 CATTATCCAGTAAAGGAGCTAGG - Intronic
1086948883 11:92870944-92870966 CATTTTACAGATAAAGAAATAGG + Intronic
1087284954 11:96255375-96255397 CATTTTACAGAAGAGGAACTGGG + Intronic
1087522590 11:99260771-99260793 CATTTTACAGACAATCAAATTGG - Intronic
1087649494 11:100847837-100847859 CAGTTTATAGATAAGAAGCTTGG + Intronic
1087895152 11:103578370-103578392 CATTTTTCAAACATGGACCTAGG - Intergenic
1088632279 11:111785218-111785240 CATTTTACAGATAAGGAAACAGG - Intronic
1088682858 11:112259124-112259146 CATTTTACAGACAAGAACTGAGG - Intronic
1089148256 11:116346077-116346099 CATTTTATAGAGGAGGATCTAGG - Intergenic
1089217935 11:116847012-116847034 CACTTTACAGATGAGGATCTCGG + Intronic
1089345496 11:117788743-117788765 CATTTTACAGATAAGAAGACAGG + Intronic
1089892104 11:121891950-121891972 CATTTTAAAGATAAGGAAATGGG - Intergenic
1090168046 11:124572006-124572028 CATTTCACAGATATGGAACTTGG + Intergenic
1090274695 11:125411009-125411031 TACTTTACAGATAAGAAGCTGGG + Intronic
1090300004 11:125626739-125626761 CCTTTTACAGCCGAGGTGCTCGG + Exonic
1090584764 11:128199375-128199397 CATTTTACAGATAAGGACACTGG + Intergenic
1090905757 11:131073280-131073302 CATTTTACAGATCAGGAGTGGGG - Intergenic
1091349310 11:134880417-134880439 CATTTCACAGCCCAGGAGCCTGG + Intergenic
1091407263 12:216950-216972 CATTTTACAGACGGGAAACTGGG + Intergenic
1091436360 12:476163-476185 CATTTTACAGAGAAGAAACTGGG - Intronic
1091552610 12:1548170-1548192 CATCTTACAGTCAATGAACTTGG - Intronic
1091719007 12:2798913-2798935 CATTTTATGGACAAGAAGATAGG - Intronic
1091913362 12:4249995-4250017 CATATTACAGAGAAGGAAATGGG - Intergenic
1092109112 12:5946210-5946232 CACTTTATAGAGAAGGAGCCTGG + Intronic
1093667169 12:21828415-21828437 TATTTTACAGATGAGGAACTGGG + Intronic
1093775461 12:23068584-23068606 CACTTTGCAGAGAAGGAGATTGG + Intergenic
1094095561 12:26700465-26700487 CAGTTTACAGACAAGGCACTTGG + Intronic
1094597928 12:31882300-31882322 CATTTTACAGATAAGGAACCAGG + Intergenic
1095307670 12:40657398-40657420 CATTTTATAGACTAAGAGTTTGG + Intergenic
1095666187 12:44801607-44801629 TATCTTACAGACAAGGAAATGGG - Intronic
1095785433 12:46103927-46103949 GATTTAAGAGACAAGTAGCTGGG - Intergenic
1096010984 12:48214217-48214239 CATTTTACAGAGAAGCAGTGAGG - Intergenic
1096094590 12:48925790-48925812 CATTTTACAGATAAGGCACAGGG + Exonic
1096182106 12:49556738-49556760 TTTTTTACAGACAGGAAGCTGGG - Intronic
1096234091 12:49914041-49914063 CATTTTATAGACAGGAAACTGGG + Intergenic
1096329635 12:50699397-50699419 CATTTTAAAGATAAGGAAATTGG - Intronic
1097589994 12:61562810-61562832 CATTTTACAGATGAGGGACTTGG - Intergenic
1097849655 12:64399257-64399279 CATTTTATAGACAAGGAAACTGG - Intergenic
1097975485 12:65682033-65682055 CATTTTACAGACCAGGAAATAGG - Intergenic
1098496059 12:71136809-71136831 TATTTTACAGATAAGGATATTGG - Intronic
1098958967 12:76718518-76718540 CATTTTACAGATAAGAAACTGGG + Intergenic
1099481162 12:83168389-83168411 CATTTTATAGACATAGAGCTTGG + Intergenic
1099810956 12:87581688-87581710 CATTTTACAGACAAGGTGACTGG - Intergenic
1099826870 12:87787167-87787189 TATTTGCCAGACAAGCAGCTAGG + Intergenic
1100234957 12:92651602-92651624 CATTGTACAGACAAGGAATCTGG - Intergenic
1101363388 12:104048871-104048893 CATTTTACAGATGAGGAACTAGG + Intronic
1101849960 12:108393976-108393998 CATTTTACAGAAAGGGAAGTGGG - Intergenic
1102212928 12:111139961-111139983 CATTTCACAGACCAGGTGATGGG - Intronic
1102785997 12:115605334-115605356 CATTTTGCAGAAGAGGAGATTGG + Intergenic
1102973921 12:117192486-117192508 CATTTTACAGATAAAAAACTGGG - Intergenic
1103600326 12:122050650-122050672 CATTTTACAAACAAGGAAGTAGG - Intronic
1103811977 12:123622284-123622306 CATTTTACAGACAAGAAAACCGG + Intronic
1104465861 12:128989883-128989905 CATTTTACAAATGAGGATCTTGG - Intergenic
1106216887 13:27709933-27709955 CATTAAGCAAACAAGGAGCTGGG - Intergenic
1106638296 13:31555050-31555072 CATTTCACAGACAAGAACATGGG - Intergenic
1107274021 13:38656606-38656628 CATTTTAAAGAGGAGGAGTTGGG - Intergenic
1107448691 13:40489648-40489670 CATTTTACAGATGAGGAGGGAGG + Intergenic
1107527855 13:41251064-41251086 CATTTTACAGATGAGGATCTAGG - Intronic
1107706397 13:43110849-43110871 CTTTTTACAGATAAGGAGTTGGG - Exonic
1107963241 13:45577136-45577158 CATTGCACAGATAAGGAGCTGGG - Intronic
1107990127 13:45812312-45812334 CATTTTATAGACAAGGAGACAGG + Intronic
1108497705 13:51041676-51041698 CATTTTTCAAACAAGAAGTTGGG - Intergenic
1108593738 13:51933305-51933327 CATTTTACAGGCAAGGAAACAGG - Exonic
1109856898 13:68142151-68142173 CATTTTTCAGAAAAGTAACTGGG - Intergenic
1109984141 13:69954053-69954075 CATTTTACAGTTATGGATCTTGG - Intronic
1110401895 13:75101644-75101666 CATTTTACAGATGAGGATATTGG + Intergenic
1111099139 13:83558483-83558505 TATTTTACAGACAAAGGCCTTGG - Intergenic
1111971806 13:94924529-94924551 AAATTTACAGACAAGCAGATGGG + Intergenic
1112359970 13:98708567-98708589 CAGTTTACAGAGAAAGACCTTGG + Intronic
1112434920 13:99384981-99385003 CATTCTACAGACAAGGACACAGG - Intronic
1113052518 13:106229765-106229787 CATTTGATAGACGAGGAACTTGG - Intergenic
1113090176 13:106609846-106609868 CAGTTCACACACAGGGAGCTTGG - Intergenic
1113119665 13:106912708-106912730 CATTTTACAAAAAAAGAGGTAGG + Intergenic
1113963825 13:114140501-114140523 CATTTTACAGACGAAGAAATTGG - Intergenic
1115137686 14:30130685-30130707 CATTTTACAGAGGAGGAAATAGG - Intronic
1115343241 14:32314772-32314794 CATTTTACAGACAAGGAACAGGG - Intergenic
1115736038 14:36331019-36331041 CATTTTACAGATAAGGAAACAGG - Intergenic
1117025897 14:51620041-51620063 CATTTTACAAACTAGGCACTTGG - Intronic
1117354266 14:54908519-54908541 CATTTTACAGAGGAGGAACCAGG - Intergenic
1117736238 14:58771698-58771720 CATTTTACAGATGAGGAAATTGG - Intergenic
1117816192 14:59600383-59600405 CAATTTACAGATAAGGAAATAGG + Intronic
1118021137 14:61715591-61715613 CATGTTACAGATAAGGACCCTGG - Intronic
1118519134 14:66561526-66561548 CATTTTACATATAAGGAAATTGG + Intronic
1118665092 14:68060121-68060143 CATTTTAAAGACAAGGAAAAAGG - Intronic
1118989071 14:70781727-70781749 CATTTTACAGAGGAGGAAATGGG + Intronic
1119321232 14:73732059-73732081 TATTTTATAGATGAGGAGCTAGG - Intronic
1119574492 14:75706535-75706557 CATTTTACAGAGAAAATGCTAGG + Intronic
1119636651 14:76278789-76278811 TTTTTTACAGATAAGGAACTTGG + Intergenic
1119814603 14:77554629-77554651 CATTTTACTGACAAGGAAACTGG + Intronic
1119939474 14:78625139-78625161 CATTTTAAAGATAAGGAACAGGG - Intronic
1121044317 14:90776882-90776904 CATTTTACAGAAAAGAAACCTGG - Intronic
1121380743 14:93463755-93463777 CATTTTACAGATGAGGAAATTGG + Intronic
1121435119 14:93914089-93914111 CATTTTACAGACAAGGAAACTGG + Intergenic
1122199125 14:100111455-100111477 CATTTTAAAGACAAGGAAACTGG - Intronic
1123722573 15:23072541-23072563 CATTGTACACACAAGGAGACAGG + Intergenic
1124467450 15:29950883-29950905 CATTTTACAGATAAGGATATGGG - Intronic
1124834550 15:33182933-33182955 CTTTTTACAGACAGGAAACTGGG + Intronic
1125350042 15:38756752-38756774 CATTTTACAGACAATAAAATGGG - Intergenic
1126337547 15:47603542-47603564 TATTTTACAGATGAGGAACTTGG - Intronic
1126623474 15:50663668-50663690 CATTTAAAAGACAACTAGCTCGG + Intronic
1126891669 15:53211975-53211997 CATTTTACAGACAAGGAAACAGG + Intergenic
1127028164 15:54831376-54831398 CATTTTGCAGACAAGGAAAGAGG - Intergenic
1127595675 15:60479422-60479444 CATTTTACATATGAGGAGTTTGG - Intergenic
1127755447 15:62087523-62087545 CATTTTCCAGATAAGGGACTGGG + Intergenic
1127873127 15:63089701-63089723 CATGTAACAGTGAAGGAGCTGGG + Intergenic
1128804695 15:70522102-70522124 CATCTTACAGAGGAGAAGCTGGG + Intergenic
1129148542 15:73671727-73671749 CATTTTACAGACAAGAAAACAGG - Intergenic
1129243668 15:74267188-74267210 CATTTTGCAGACATGGGACTGGG + Intronic
1129453329 15:75662898-75662920 CATTTTACACACCAGGAAATGGG + Intergenic
1130012520 15:80162810-80162832 CATTTTACAGACAGGAAAATGGG + Intronic
1131040242 15:89257864-89257886 CATTCTCCACACAAGGAGCAAGG + Intronic
1131099887 15:89679532-89679554 CATTTAGCAAACAAGGAGGTAGG + Intronic
1131176593 15:90213189-90213211 CATTTTACAGATAAGGAAAACGG + Intronic
1131811681 15:96179976-96179998 CATTTTAAAGATGAGGGGCTGGG - Intergenic
1132042842 15:98539450-98539472 CATTTTAAATACATGGTGCTAGG + Intergenic
1132137087 15:99351869-99351891 GAATTTACAGCCAAGGAGCAAGG + Intronic
1132225816 15:100140673-100140695 CATTTTACAGATGAGGAAATGGG + Intronic
1132539499 16:501887-501909 CATTTTATAGGCAAGGAGTCTGG + Intronic
1132555620 16:570770-570792 TATTTTTCAAACAAGGCGCTGGG + Intronic
1133182612 16:4069365-4069387 CATTTTACAACCAAGGAACCGGG - Intronic
1133317302 16:4892685-4892707 AATTTTACAGAAGAGGATCTGGG - Intronic
1133448349 16:5882064-5882086 CATTTTACAGAATAGGAACTAGG + Intergenic
1134337570 16:13315249-13315271 CCTTTTAAAGACAGGGAGGTAGG - Intergenic
1134823506 16:17265929-17265951 CATTTTACAGATAAGAAAATTGG - Intronic
1134837717 16:17376039-17376061 CACTTTACAGAGAAGGAAGTGGG + Intronic
1134852747 16:17494835-17494857 CTTTTTACAGATAAGGACCTAGG + Intergenic
1134904684 16:17970185-17970207 CCTTTTTCAGAACAGGAGCTAGG + Intergenic
1135166159 16:20141011-20141033 TGTTTTACAGACTAGGAGATAGG + Intergenic
1135343872 16:21671253-21671275 CATTTTACAGACGAGAAAATTGG + Intergenic
1135936837 16:26787733-26787755 CATTTTACAGACAAAGAAGCAGG + Intergenic
1136240665 16:28941741-28941763 TATTTTACAGCTAAGGAGATTGG + Intergenic
1136267003 16:29127786-29127808 CATTTTACAGACCAGGAAAACGG + Intergenic
1136384003 16:29911489-29911511 CATTTTACAGATGAGGAGGTCGG - Intronic
1136555404 16:31004795-31004817 CATGTTACAGACAAGGAAACAGG + Intronic
1137289165 16:47039958-47039980 CATTTTACAGACAGGAAGCAAGG + Intergenic
1137311855 16:47270055-47270077 CAATTTACAAAAAAGGAACTCGG + Intronic
1137505135 16:49048150-49048172 CATTTTACAGATGAGGAGACTGG + Intergenic
1137817630 16:51413800-51413822 CATTTTACAGATGAGGAAATAGG + Intergenic
1138115006 16:54353461-54353483 TATTTTAAAGACAAGGAGGCCGG + Intergenic
1138149843 16:54646624-54646646 CATTTTACAGACAAGGAAACAGG + Intergenic
1138208911 16:55146538-55146560 CATTTTATAGACAAGGAAGCAGG + Intergenic
1138302426 16:55943859-55943881 CATCTTTCATACAAGGAGCCTGG + Intronic
1138409195 16:56824529-56824551 TATTTTAGAGACAGGGTGCTGGG + Intronic
1138549779 16:57741004-57741026 CACTTTCCAGACGAGGAGCCAGG + Intronic
1138962418 16:62043432-62043454 CATTTTACAGAAAAAAAGCTGGG + Intergenic
1139290496 16:65853986-65854008 CATTTGAAAGGCAAAGAGCTGGG + Intergenic
1139469728 16:67171701-67171723 CATTTTACAGATGAGGAGACAGG - Intronic
1139699308 16:68697873-68697895 CATTTTACAGACAAGGAAACAGG + Intronic
1140594106 16:76388772-76388794 TATTTTACATACAAGGAAATGGG + Intronic
1140700794 16:77579877-77579899 CACTTTACAGGCAAGCAGCTCGG - Intergenic
1141978296 16:87533010-87533032 CATTTTACAGATAAGGAAACTGG - Intergenic
1142014392 16:87736822-87736844 CATTTTACAGACAAGGAAATCGG + Intronic
1142070293 16:88088109-88088131 CATTTTACAGACCAGGAAAACGG + Intronic
1142642185 17:1290676-1290698 CATTTTACAGACGAAGAGATGGG - Intronic
1143039098 17:4019403-4019425 CATTTTACAGACACAGAAATTGG - Intronic
1143208298 17:5162482-5162504 CATTTTACAAACAAGGAGATAGG + Intronic
1143392378 17:6567304-6567326 CATTTTACAGATAAGGAAACAGG + Intergenic
1144773686 17:17773224-17773246 CATTTTACAGACAGAGAAATTGG - Intronic
1145264597 17:21373761-21373783 CATTTTACAGAGAGGGAAGTGGG + Intergenic
1145754266 17:27379579-27379601 CATTTTACAGATAAGGAAACTGG - Intergenic
1145925864 17:28646070-28646092 CATTTTACAGAGAAGGAAGCAGG - Intergenic
1146392346 17:32434251-32434273 CATTTTACAAATAAGGACCCTGG + Intergenic
1146404228 17:32523319-32523341 CCTTTTACAGACAAGAAACCAGG + Intronic
1146467400 17:33096996-33097018 CATTTTACAGACAGGGAAACAGG + Intronic
1146496884 17:33330517-33330539 CATTTTACAGACAAGGAAACTGG + Intronic
1146552080 17:33789409-33789431 CATTTTATAGACAAGGAAACAGG + Intronic
1146788932 17:35740823-35740845 CATTTTACAGATGAGGACATAGG - Intronic
1146834922 17:36103151-36103173 CATTTTACAGACAAGGCAATTGG - Intergenic
1146849530 17:36210386-36210408 CATTTTACAGATAAGGCAATTGG - Intronic
1147157220 17:38550138-38550160 CATTTTACAGAGAAGGACATAGG - Intronic
1147531959 17:41287680-41287702 GAATTTACAGCCAAGGAGCAGGG + Intergenic
1147612438 17:41809931-41809953 CATTTTCTGGACAAGCAGCTTGG - Intronic
1148038899 17:44690464-44690486 CATTTTAAAGATAAGGAGACAGG + Intergenic
1148106927 17:45123897-45123919 CTCTTTCCAGACAAAGAGCTGGG + Intronic
1148222072 17:45870046-45870068 CATTTTACAGACAGGGAAACGGG - Intergenic
1149419353 17:56493918-56493940 TATTTTACAGATGAGGAGATTGG - Intronic
1149426363 17:56558315-56558337 CCTTTTTCAGAACAGGAGCTTGG - Intergenic
1149871970 17:60191063-60191085 CATTTTACAGACAAGGAGCTAGG - Intronic
1149958618 17:61081799-61081821 CAGATGAGAGACAAGGAGCTGGG - Intronic
1150628666 17:66860273-66860295 CACTTTACAGATAAGGAGGTTGG - Intronic
1150880368 17:69018712-69018734 CATTTTAGAAACAAGGAAGTGGG - Intronic
1151123176 17:71815717-71815739 CATTTTACAGATGAGGAAATAGG - Intergenic
1151713919 17:75821954-75821976 TGTTTTACAGACAAGGACCCTGG - Intronic
1151823908 17:76512940-76512962 CATCTTACAGCCAAAGAGCTGGG - Intergenic
1151984390 17:77532673-77532695 CATTTTACAGATGAGGAGATGGG + Intergenic
1153050429 18:898221-898243 CATTTTACAGACAAGAAATCGGG - Intergenic
1153078580 18:1194012-1194034 CATTTTACAGAAGAGGAGACTGG + Intergenic
1154279398 18:12989483-12989505 CACTTTACAGACAAGGAAACCGG + Intergenic
1154311911 18:13273585-13273607 CATTTAAAACACAAGGGGCTGGG - Intronic
1155628469 18:27863403-27863425 CATTTGACAGCCAAGGAGAGAGG - Intergenic
1155639647 18:27998367-27998389 CATTTTACAGATGAGGAAATGGG + Intronic
1155691808 18:28633926-28633948 CATTTTACAGACAAGAAAACAGG + Intergenic
1156103536 18:33628162-33628184 CATTTTACAGATGAGGAAATTGG + Intronic
1156740134 18:40316008-40316030 CATTTTGCAGATGAGGAGCCTGG - Intergenic
1157578522 18:48759630-48759652 CATTTTACAGATGAGTAACTGGG - Intronic
1157791175 18:50532470-50532492 CATTTTAACGATAAGGAGCCTGG + Intergenic
1159140941 18:64393435-64393457 CAATTTACAGTCAAGGAGCAGGG - Intergenic
1159177880 18:64862472-64862494 CCTTTAACAGAAAAGGAGCAAGG + Intergenic
1159442763 18:68502855-68502877 CATTTTGCAGACAAGGAAACAGG + Intergenic
1160189285 18:76701742-76701764 TATTTCACAGACAGGAAGCTGGG - Intergenic
1162836197 19:13319847-13319869 CATTTTACAGCCAAGGAAACAGG + Intronic
1162847840 19:13407415-13407437 CATTTTACAGAGAAGGAAATAGG - Intronic
1162858010 19:13483949-13483971 CATTTTATAGGCAAGGAAATGGG + Intronic
1163736032 19:18981427-18981449 CATTTTACAGATGAGGAAATTGG + Intergenic
1164130329 19:22355912-22355934 CATTTTCCAAACATGGACCTAGG + Intergenic
1164826159 19:31286505-31286527 CATTTTGCAGACAAGGAAACAGG + Intronic
1165343461 19:35228310-35228332 CATATAACACACAAGGACCTGGG - Exonic
1166840607 19:45694795-45694817 CATTTTACAGATGAGGAAATGGG - Intronic
1166913974 19:46181677-46181699 CCTTTGACAGGCAGGGAGCTGGG - Intergenic
1167023361 19:46895751-46895773 CATTTCACAGACAAGGGCATTGG - Intergenic
1167061819 19:47153675-47153697 GATTTTACAGGCAAGAAACTTGG - Intronic
1167850944 19:52201464-52201486 CATTTTACAGACAGGGAAACAGG - Intronic
926359594 2:12073620-12073642 CATTTTACAGAGAAGGAAGCAGG + Intergenic
926393393 2:12417266-12417288 AAATTTACAGACAGGGATCTGGG + Intergenic
927460934 2:23297696-23297718 CATTTGAGATACAGGGAGCTGGG + Intergenic
927672366 2:25079445-25079467 CATTTTACAGATAAAGAGGCAGG - Intronic
927707696 2:25307027-25307049 CATTTTACCGATGAGGAACTGGG - Intronic
927899924 2:26811923-26811945 CATTTTACAGACAGGTAAGTGGG + Intergenic
928104001 2:28455873-28455895 CATTTTACAGATGAGGAAATTGG + Intergenic
928412861 2:31067790-31067812 CATTTTCCAGACAAGGATTAAGG + Intronic
928413617 2:31073163-31073185 CATTTTGCAGACGAGGACCCTGG - Intronic
928451134 2:31379573-31379595 CATTTTACAGATAAGGGAATTGG + Intronic
928923920 2:36556639-36556661 CATTTCACAGATGAAGAGCTTGG - Intronic
929254694 2:39797297-39797319 CATTTTACAGATCAGGAAATTGG + Intergenic
929582065 2:43087663-43087685 CATTTTCCAGATAAGGAAGTTGG + Intergenic
930024137 2:47020184-47020206 CATTTTGCAGATGAGGACCTTGG + Intronic
930608710 2:53518140-53518162 CATTTTGCATACAGGGAGCCGGG - Intergenic
931139949 2:59446366-59446388 CACTTTACAGACAAAGAGGGAGG - Intergenic
931588424 2:63854189-63854211 CATTTTACAGACGAGGAAACAGG - Intronic
932178646 2:69625534-69625556 CATTTTACACATAGGGAGCCTGG + Intronic
932527070 2:72481692-72481714 CATTTTACAGATAAAGAAATAGG - Intronic
932670036 2:73728975-73728997 CATTTTACACACAAGGCCCAGGG - Intergenic
932702120 2:73999319-73999341 CATTTTACAGACGAAGAATTGGG - Intronic
933295126 2:80481339-80481361 CATTTTACAAACGAGGAACTTGG - Intronic
933311263 2:80664417-80664439 CATTTTACAGACAATGAAGCCGG + Intergenic
933434223 2:82225216-82225238 AATTTTACAGATGAGGAACTAGG - Intergenic
934110163 2:88734791-88734813 CAATTTACTGACAAGGAACCTGG + Intronic
934150952 2:89147098-89147120 CAATTTACAGACAGGCAGCAAGG + Intergenic
934216321 2:90034927-90034949 CAATTTACAGACAGGCAGCAAGG - Intergenic
934523112 2:95032323-95032345 CATTCTCCAGAGAAGGGGCTGGG + Intronic
934939856 2:98492868-98492890 CATTTAATAGATAAGGAGCCTGG + Intronic
935206428 2:100900666-100900688 CATTTTACAGGGAAGAAGGTTGG - Intronic
935586247 2:104802410-104802432 CATTTTACACATAAAGAGATGGG - Intergenic
935656772 2:105429968-105429990 CATTTTACAGACGTGGTTCTGGG + Intronic
935736301 2:106109115-106109137 GAATTTACAGCCAAGGAGCAGGG - Intronic
936515028 2:113175955-113175977 TATTTTACAGAAAAGGAACCAGG + Intronic
936815120 2:116451081-116451103 CAATTTATAGACCAGGAGTTTGG - Intergenic
937591297 2:123615729-123615751 CATCTTAAAGAAAAGGATCTTGG + Intergenic
937765578 2:125656946-125656968 CATTTAACAAACTAGGGGCTGGG + Intergenic
937905718 2:127051893-127051915 CCTTTTACAGATGAGGAGATGGG - Intronic
938090284 2:128426717-128426739 CATTTTACAGATAAGGCTGTCGG + Intergenic
938156147 2:128941911-128941933 CATTTTACAGCCCAGGAGGGGGG + Intergenic
938160981 2:128984195-128984217 CATTTTACAGATGAGGACGTTGG - Intergenic
938161135 2:128985411-128985433 CATTTTACAAGTAAGGAACTGGG - Intergenic
938741161 2:134233751-134233773 CATTTTACAGATAAGGAAACTGG + Intronic
939047546 2:137267653-137267675 CATTTTACAGATAAGAAAATGGG - Intronic
939558345 2:143703928-143703950 CATTTTACAGATGAGGAAATTGG - Intronic
939577807 2:143917236-143917258 CATTTTACATAAAAGGAAATAGG - Intergenic
940225820 2:151400094-151400116 CATTTTACAGATAAGGAAACAGG + Intergenic
940704553 2:157087619-157087641 CATTTGACATACAAGCAGCCCGG + Intergenic
941153381 2:161942666-161942688 TATTTGACAGACAAGTAGTTAGG - Intronic
941379954 2:164780179-164780201 CATTTTACAGATGTGGATCTAGG - Intronic
941653212 2:168115973-168115995 CATGTCACAGACAAGGCACTGGG + Intronic
941839651 2:170067029-170067051 CATTTTCCAGACAAGGAAGCAGG + Intronic
942150416 2:173070981-173071003 CATTTTAAAGAAAAGTAGCATGG + Intergenic
942185517 2:173421304-173421326 CATTTTACAGACGAGGAAACTGG - Intergenic
942502348 2:176604915-176604937 CATTTTCCAGGTAGGGAGCTAGG - Intergenic
943874614 2:193048405-193048427 CATTTTACAGACAAAGGTCTTGG + Intergenic
944743269 2:202633107-202633129 CATTTTACAGATAAGGAGACTGG + Intergenic
944897607 2:204181041-204181063 CATTTTACACACAGGGAAATAGG + Intergenic
945567340 2:211417074-211417096 CATTTTACAGATATAGAGCACGG + Intronic
946522026 2:220476361-220476383 AAATTTACAGAGAAGGAACTTGG - Intergenic
946770812 2:223086464-223086486 CACTTTGCAGAGATGGAGCTGGG - Intronic
946914134 2:224498790-224498812 CATTTTCCAGGAAAGCAGCTAGG - Intronic
946935644 2:224717855-224717877 CATTTTACAGCAAAGGAAATGGG + Intergenic
947949231 2:234133635-234133657 GAATTTACAGCCAAGGAGCACGG + Intergenic
948541307 2:238693131-238693153 CATTTTATAGATGAGGAGATGGG + Intergenic
1168752965 20:296747-296769 CATTTTACAGATAAAGAGGCAGG - Intergenic
1168773051 20:428322-428344 CATTTTACAGAAGAGGATATTGG - Intronic
1168969437 20:1920895-1920917 CATTTTACAGACAAGGAGCTGGG + Intronic
1169147622 20:3263585-3263607 CATTTTACAGATAAGGTACCAGG - Intronic
1169369317 20:5016407-5016429 CATTTTACAGACCAGGGGCATGG + Intergenic
1169457376 20:5763806-5763828 CATTTTATAGACAAGGAAACTGG + Intronic
1169458673 20:5775745-5775767 CATTTTACAAATAAGGAGACAGG - Intronic
1170309518 20:14976781-14976803 CATTTTACACACGAGGAAATGGG - Intronic
1171183129 20:23105548-23105570 CAATTTACAGACAAGGAGACTGG + Intergenic
1171327090 20:24304308-24304330 GATTTTACAATAAAGGAGCTTGG + Intergenic
1171407162 20:24919088-24919110 CATTTTACAGACAAGGAAACGGG - Intergenic
1172008701 20:31834094-31834116 CAGTTCAAAGACGAGGAGCTGGG - Exonic
1172024088 20:31936135-31936157 CCTTTTACAGACAGAAAGCTGGG - Intronic
1172038530 20:32027726-32027748 CAATTTAGAGACAAGGAGGCAGG + Intronic
1172118972 20:32586461-32586483 CATTTTACAGACGAAGACCTGGG + Intronic
1172443683 20:34982142-34982164 CATTTTAGGAACAAGGAACTGGG - Intronic
1172564467 20:35918204-35918226 CAATTTACAGACAAGGGACAGGG - Intronic
1172584757 20:36075084-36075106 CATTTTATATACAAGGAAATAGG - Intergenic
1172650947 20:36500920-36500942 CATTTTACAGATGAGGAAATGGG - Intronic
1173224034 20:41151506-41151528 CATTTTACAAACAAGGATCTGGG - Intronic
1173296213 20:41760555-41760577 CATTTTACAGATAAGAAAATAGG - Intergenic
1173578021 20:44125784-44125806 CATTTTACAGATGAGGAGACTGG - Intronic
1173609651 20:44357267-44357289 CATTTTACAGATGAGGAAATAGG - Intronic
1173950866 20:46992451-46992473 CATTTTACAGACATGGAAGTTGG + Intronic
1174281288 20:49441382-49441404 CATTTTACAGATAAGGAAACAGG + Intronic
1174361751 20:50033266-50033288 CATATTACAGACAAGAGGCCTGG + Intergenic
1174571865 20:51507837-51507859 CATTTTACAGGCAAGGAAACTGG - Intronic
1175046959 20:56116087-56116109 CATATTACAGACACTGAGCCAGG + Intergenic
1175124393 20:56740640-56740662 CACTTTACAGGCAAGGAGACTGG + Intergenic
1175296574 20:57912871-57912893 CATTTTACTGACAAGGAAACTGG - Intergenic
1177583980 21:23065288-23065310 CTCTTTACAGAAAAGAAGCTGGG - Intergenic
1177696012 21:24572005-24572027 CATCTTACAGCCAAGGAGGGAGG + Intergenic
1178760654 21:35399138-35399160 CTTTTTACAGAAATGGAGCGAGG + Intronic
1178824991 21:36007309-36007331 CATTTTACAGATGAGGAGGTGGG + Intergenic
1180166058 21:46029955-46029977 CATTTTGCTGACAATGACCTGGG - Intergenic
1182089051 22:27581648-27581670 CATCTTACAGACAAGAACTTGGG + Intergenic
1182101056 22:27657734-27657756 CATTTTGCAGATGAGGAGATTGG - Intergenic
1182364752 22:29771027-29771049 CATTTTACAGATAAGGAAACCGG - Intergenic
1182392208 22:30007896-30007918 CATTTGACAGAGAAGAATCTAGG - Exonic
1182546081 22:31077431-31077453 CATTATACAGATAAGGAGACAGG - Intronic
1182753851 22:32662590-32662612 CATTTTACAGATGAGGAACTTGG - Intronic
1182780866 22:32866413-32866435 CATTTTGCAGACAAGGAAATTGG + Intronic
1182787094 22:32917153-32917175 CATTTTACAGTTAAGGAACCTGG + Intronic
1182932154 22:34184789-34184811 CATTTTCCAGAAAAGAAGATAGG + Intergenic
1183031125 22:35105733-35105755 CATTTTACAGACATGCAGATTGG + Intergenic
1183229869 22:36575090-36575112 CATTTTACAGAAAAGGAAATTGG - Intronic
1183419262 22:37701209-37701231 CAGTTTCCAGACAAGGACCAAGG - Intronic
1183445991 22:37855483-37855505 CATTTTACAGATGAGGACCCAGG - Intronic
1183529536 22:38345843-38345865 CATTTTACAGAGAAGGAAACTGG + Intronic
1183586647 22:38756486-38756508 CATTTTTCAGACAAGGAAACAGG + Intronic
1183589682 22:38772741-38772763 CATTTTACCCACAAGGAGAATGG + Intronic
1183691775 22:39393985-39394007 CATTTTACAGATGAGGAGCTGGG + Intergenic
1183740851 22:39667730-39667752 CATTTTACAGATGAGGAAATGGG + Intronic
1184415005 22:44347090-44347112 CATTTTACAGATGAGGAGGCTGG - Intergenic
1184491085 22:44809517-44809539 CATTTTACAGATGAGGACATAGG + Intronic
1184728347 22:46358776-46358798 CATTTTCCAGGCCAAGAGCTGGG + Intergenic
1185389432 22:50550734-50550756 CATTTTATAGACAAGGAGAAAGG - Exonic
950450486 3:13062395-13062417 CATTTTACAGAAAAGGAAATAGG + Intronic
950549288 3:13656452-13656474 CATTTTACAGATGGGGAGCCTGG - Intergenic
950639639 3:14340454-14340476 CATTTTACAGAGAAGGAAACAGG - Intergenic
950675064 3:14549767-14549789 CATTTTACAGACGAGGAAACTGG + Intergenic
950893731 3:16428694-16428716 CGTTGTACACACATGGAGCTAGG - Intronic
950924766 3:16729459-16729481 AAATTTACAGCCAAGGAGCAGGG + Intergenic
951395651 3:22163062-22163084 CACTTTTGAGGCAAGGAGCTGGG + Intronic
951702701 3:25512047-25512069 CATGTTACAGACAAGCAACTTGG - Intronic
951849146 3:27119183-27119205 CATTTTACAGGCAAGGAAACTGG + Intronic
951961522 3:28329246-28329268 CATTTTACACACGAGGAAATGGG + Intronic
952748692 3:36805971-36805993 CTTTTTCCAGGCAGGGAGCTGGG + Intergenic
952855012 3:37762969-37762991 CATTTTACAGATAAGAAAATGGG - Intronic
953657270 3:44863606-44863628 CATTTTACAGATAAAGAGCCAGG - Intronic
953677895 3:45017494-45017516 CACTTTACAGAAGAGGAGTTTGG + Intronic
954171391 3:48805574-48805596 CAATTTACAGACAAGGAAACTGG - Intronic
955020049 3:55111091-55111113 CATTTTACAGATGATGAACTGGG - Intergenic
955463761 3:59214481-59214503 CATTTTTCAGGCATGGATCTGGG + Intergenic
955661644 3:61305672-61305694 CATTTTACAGATAAGAGGATTGG + Intergenic
955707346 3:61742075-61742097 CATTTTTCATACAAAGAGCCCGG - Intronic
956100106 3:65759321-65759343 CATTTTATAGATAAGGAGACTGG - Intronic
956724403 3:72145342-72145364 CATTTTACAGATGAGGAGATGGG + Intergenic
956724553 3:72146277-72146299 CCTTTTACAGATAAAGAACTGGG - Intergenic
956788589 3:72662826-72662848 CATTTGACAGACAAGTTGGTTGG + Intergenic
957609137 3:82444682-82444704 AATTTTACAGACAAGAAGTTCGG - Intergenic
958433364 3:94068124-94068146 CATTTTACAGACGAGGACAATGG - Intronic
958796311 3:98710031-98710053 AATTTTACAGTTAAGGAGGTAGG + Intergenic
959350863 3:105261116-105261138 CATTTCACAGACAAGGTGGCTGG - Intergenic
959360797 3:105388972-105388994 CATTTTACAGACAAAGAAATTGG - Intronic
959575618 3:107929755-107929777 CATTTTACAAACAAGACACTAGG - Intergenic
959583078 3:108001788-108001810 CATTTTACAGACAAGGGAACTGG + Intergenic
960399058 3:117173595-117173617 CATTTTACAGATAAGAAAATAGG + Intergenic
960414515 3:117368209-117368231 CATTTTACACATGAGGAGCCTGG - Intergenic
960536315 3:118818251-118818273 CATTTCACAGACAAGGAGAGAGG + Intergenic
960851320 3:122058012-122058034 CATTTTACAGACAAGAAACTGGG - Intronic
962299269 3:134223548-134223570 CTTTTTATAAACAATGAGCTAGG - Intronic
962351908 3:134662581-134662603 CATTTTAGAGATGAGGAACTGGG + Intronic
963020706 3:140870386-140870408 CATTTTACAGATGAGAAACTGGG + Intergenic
963284920 3:143424864-143424886 TATTTTACAGACCAGGAAATTGG - Intronic
964409745 3:156385303-156385325 CATTTTAGAAACAAGGAGTGGGG - Intronic
964651437 3:159015811-159015833 CATTTTTCAGAAGAGGAGCCAGG + Intronic
964767783 3:160195440-160195462 CATTTTACAGATGAGGAAATGGG - Intergenic
965664617 3:171079786-171079808 CATTTTAATGACAAAGTGCTGGG - Intronic
966440903 3:179942977-179942999 CATTTTACAGATAAGGAAACAGG - Intronic
966900856 3:184483238-184483260 CATTTTACAGATAAGGAAAAAGG - Intronic
966939824 3:184738780-184738802 CATTTTACAGATGAGGATATTGG + Intergenic
967138692 3:186534337-186534359 CAGTTTACAGATGAGGAACTGGG - Intergenic
967345778 3:188453816-188453838 CATTCTACAGATAAGGAGATGGG + Intronic
967920017 3:194607626-194607648 CATTTTACAGATAAGGAAACTGG - Intronic
967950953 3:194840169-194840191 CATTTTACAGACAAGGAAAGTGG + Intergenic
969038479 4:4275208-4275230 CATTTTACAGATGAGGAAATAGG - Intronic
969241914 4:5904535-5904557 CATTTTACAGATAAGGAGCTGGG + Intronic
969447027 4:7251058-7251080 CATTTTACAGACAAGGATACTGG - Intronic
969476320 4:7424454-7424476 GATTTTATAGCCAAGGGGCTGGG - Intronic
969697596 4:8743909-8743931 CATTTTACAGATAAGGAAACTGG + Intergenic
969829863 4:9786659-9786681 CATTTTACAGATGAGGACATGGG + Intronic
969921368 4:10543438-10543460 CATTTGTGAGACAAGGAGGTTGG + Intronic
970200341 4:13598524-13598546 CATTTTACAAACGAGGAAATAGG - Intronic
970608121 4:17701401-17701423 CACTTCATAGACAAGGAACTTGG - Intronic
970852287 4:20616439-20616461 TATCTTAAAGACAAGGGGCTAGG - Intronic
970910787 4:21272475-21272497 CATTTTACGGATAAGGAAATTGG + Intronic
971215674 4:24660323-24660345 CCTTTAAGAGACAAGGAGCAAGG + Intergenic
972540228 4:40032596-40032618 TATTTTGTAGAGAAGGAGCTTGG + Intergenic
972583704 4:40417693-40417715 CATTTTACAGATAAAAAGCAAGG - Intergenic
972602556 4:40585981-40586003 TACTTTATAGAGAAGGAGCTTGG - Intronic
972720515 4:41692056-41692078 CATTTTACAGAGAAGGACACTGG - Intronic
973053586 4:45626906-45626928 CATTTTACAGATAAGGAAAGTGG - Intergenic
973655184 4:53039763-53039785 CATTTTACAAATAAGGAAGTTGG + Intronic
973876286 4:55222914-55222936 CATTTTACAGATGAGGACCCTGG - Intergenic
974017017 4:56656655-56656677 CATTTTACAGAGATGGAGATAGG + Intronic
974792095 4:66705285-66705307 CATTTGGCACAGAAGGAGCTGGG - Intergenic
974827133 4:67145649-67145671 TATTTTACAGACAAGGAAACAGG + Intergenic
975766866 4:77677666-77677688 CATTTTACAGACATGGAAACTGG - Intergenic
976218101 4:82733429-82733451 CATTTTACAGCCAATGAAATAGG - Intronic
976951507 4:90837473-90837495 CATTTTACAGATAAAGAAATAGG - Intronic
977766392 4:100803640-100803662 CATTTAGCAGACAGGAAGCTAGG - Intronic
978539364 4:109800171-109800193 CATTTTAGAGAGAAAGAACTGGG - Intronic
979186552 4:117802741-117802763 CATTCTACAGATAAGAAACTTGG + Intergenic
979446957 4:120825155-120825177 CATTTTACAGATGAGGAAATTGG - Intronic
980485204 4:133448844-133448866 TGTTTCACATACAAGGAGCTTGG - Intergenic
980885831 4:138761342-138761364 CATCTTACAGATGAAGAGCTGGG - Intergenic
981511188 4:145560635-145560657 CATTTTACAGATAAGGAAACAGG - Intergenic
981759756 4:148181382-148181404 CATTTTACAGATAAGGAATTTGG - Intronic
981765010 4:148239299-148239321 CATTTTACAGACTGGGACCCTGG - Intronic
982342152 4:154311533-154311555 CATTATACAAACAAGAATCTTGG - Intronic
982858605 4:160418138-160418160 CATTTAAAAAATAAGGAGCTGGG - Intergenic
984794857 4:183650162-183650184 CATTTGACAGATGAGGAACTGGG + Intronic
987099533 5:14580015-14580037 CATTTTACAGATAAGGAAACAGG + Intergenic
987658261 5:20837674-20837696 CATTTTACAGACAAGGGCCAGGG - Intergenic
987859552 5:23466920-23466942 AATTTGTCAGACAAGGGGCTAGG - Intergenic
988672421 5:33396237-33396259 GAATTTACAGCCAAGGAGCAGGG + Intergenic
988765422 5:34368268-34368290 CATTTTACAGACAAGGGCCAGGG + Intergenic
989155974 5:38345205-38345227 CATTTTACAGACAATGAGACTGG - Intronic
991047970 5:62242744-62242766 CCTTCTAGAGACAAGGAGATGGG + Intergenic
991234102 5:64374523-64374545 CATTTTATAGACAAGAAGATTGG + Intergenic
991458716 5:66833937-66833959 CATTTTACAGACGTGGACATGGG - Intronic
991513598 5:67408571-67408593 CATTTTACAGCCATTCAGCTTGG - Intergenic
991527728 5:67580530-67580552 CATTTTATAGTGAAGGAGATAGG + Intergenic
991971964 5:72150015-72150037 CATTTTCCAGAATAAGAGCTAGG + Intronic
992093726 5:73341236-73341258 CAATGTACAGACAAGGAAATTGG - Intergenic
992632949 5:78699619-78699641 CATCTTACAGATAAGGAGAGTGG + Intronic
993320661 5:86464975-86464997 CATTTTTCAGACAGGGACCCAGG - Intergenic
993516191 5:88837957-88837979 CATTTTACAGAAAAGAAGGCTGG + Intronic
993707474 5:91187408-91187430 CATTTTCCAGACAAAGAAATGGG + Intergenic
994001724 5:94789099-94789121 CATTTGATAGAAAAGGAGTTGGG + Intronic
994170421 5:96653516-96653538 TATTTTACAGAGAAGGAGATGGG - Intronic
995036917 5:107544455-107544477 CTTCTTACAGACCAGGAGCAAGG + Intronic
995087684 5:108133819-108133841 ATTTTTACAGACAAGGAAATGGG - Intronic
995274388 5:110261748-110261770 CATTTTACAGACTAGGAAACTGG - Intergenic
995409527 5:111839903-111839925 CATTTTACAGAGTAGGAGTGTGG + Intronic
996114047 5:119598967-119598989 AAATTTACTGACAAGGGGCTAGG - Intronic
996635099 5:125679597-125679619 CATGTTAAAGACAAGGAGTATGG + Intergenic
997447307 5:133951033-133951055 CATTTTACAGATAAGGAGCCAGG - Intergenic
997480624 5:134181704-134181726 CACTTTACAGACAAGGGGGCTGG - Intronic
997718956 5:136062857-136062879 CATCTTACAGAGAAGGAAATGGG - Intronic
997864550 5:137449553-137449575 CATTTTACAGATAAGGAAACTGG - Intronic
998415673 5:141944612-141944634 CATTTCACAGACACGGATATGGG - Exonic
998672598 5:144370536-144370558 CATTTTACAGATGAGAATCTTGG + Intronic
998708848 5:144797664-144797686 CACTTTACAGAAAAGAAACTGGG + Intergenic
999613096 5:153392260-153392282 GATTTTACAGATAAGGAAATTGG - Intergenic
1000051295 5:157565106-157565128 CATTTTACACATAAGCAGTTTGG + Intronic
1000303674 5:159976923-159976945 CAATTTACAGACAAAGTGGTTGG - Intergenic
1001085256 5:168695896-168695918 CATTTTCCAGACACTTAGCTAGG - Intronic
1001204724 5:169751805-169751827 CATGTTCCAGACATGGAACTGGG + Intronic
1001938760 5:175726641-175726663 CATATTACAGGCCAGGAGCTGGG - Intergenic
1001957202 5:175856169-175856191 CATTTTACAGAGAAGGAGAGAGG - Intronic
1001987985 5:176092030-176092052 CATTTAAAAGACCAAGAGCTTGG - Intronic
1001989183 5:176102058-176102080 CATTTAAAAGACCAAGAGCTTGG - Intronic
1002069289 5:176669869-176669891 CATTTTATGCATAAGGAGCTGGG + Intergenic
1002095057 5:176825728-176825750 CATTTTGCTGCCATGGAGCTGGG - Intronic
1002185527 5:177453096-177453118 CATTTGATAGACAGGGAGATAGG - Intronic
1002185669 5:177453783-177453805 TATTTTACAGACGAGGAGTTGGG - Intronic
1002227687 5:177736080-177736102 CATTTAAAAGACCAAGAGCTTGG + Intronic
1002228884 5:177746110-177746132 CATTTAAAAGACCAAGAGCTTGG + Intronic
1002266461 5:178037673-178037695 CATTTAAAAGACCAGGAGCTTGG - Intronic
1002649917 5:180683845-180683867 CATTTAAAAGACCAAGAGCTTGG - Intergenic
1002651928 5:180704177-180704199 AATTATACAGAAAAGTAGCTGGG - Intergenic
1002841573 6:911274-911296 CATTTTACAGATGAGGAAATAGG + Intergenic
1002959267 6:1898474-1898496 CATATTATAGAAAAGGAGGTTGG - Intronic
1003646601 6:7917758-7917780 CATCTAGCAGACAAAGAGCTGGG - Intronic
1003869267 6:10389154-10389176 CATTTTATAAACAAGCAGCAAGG + Intergenic
1004181121 6:13381346-13381368 CATTTTACAGACAAGGAAATGGG + Intronic
1004563553 6:16774248-16774270 CATTTTATAGACAGGAATCTGGG + Intergenic
1004670926 6:17796094-17796116 CATTTTACAAACGAGGAAATAGG + Intronic
1004926038 6:20416022-20416044 CATTTAACAGACGAGGAAATGGG - Intronic
1005010763 6:21333252-21333274 CATTTTACAGTTAAGGAACTTGG + Intergenic
1005099688 6:22157399-22157421 CATTTTGCAGATAAGGAGATTGG + Intergenic
1005460321 6:26063019-26063041 CATTTTACAGAGAAGGAACTTGG - Intergenic
1005708165 6:28477698-28477720 CATTTTACAGAAAAGAAAATTGG - Intergenic
1006257483 6:32843423-32843445 CACTTTACAGAAGAGGGGCTTGG + Intronic
1006454409 6:34123712-34123734 CATTTTACACACAAGGAAACGGG + Intronic
1006905451 6:37530240-37530262 CATTTTACAGGAGAGGAGATTGG - Intergenic
1007231971 6:40354504-40354526 CATTTTACAGACAAGGTCTCTGG - Intergenic
1007605862 6:43117567-43117589 CATTTTATAGACAAGGAAATCGG - Intronic
1007735725 6:43981197-43981219 CATTTAATAGACAAGGATATAGG + Intergenic
1008117640 6:47570740-47570762 CATTTTACAGGCAAAGAGATTGG + Intronic
1008123879 6:47647409-47647431 CATTTTCCAAACATGGACCTAGG - Intergenic
1008157230 6:48031335-48031357 TAATTTACAGTCAAGGAGCAGGG - Intronic
1008625749 6:53314790-53314812 CATTTTACTGGTCAGGAGCTAGG + Intronic
1009585308 6:65593928-65593950 CATTTCACAAACAAGGAACTTGG + Intronic
1009641232 6:66339740-66339762 CAAATTATAGCCAAGGAGCTGGG + Intergenic
1010347795 6:74833131-74833153 CATTTTACACTCAAGGGGATGGG - Intergenic
1010736226 6:79446447-79446469 AATTTTTCAGGGAAGGAGCTGGG + Intergenic
1011605200 6:89096791-89096813 CATTTTAAAAACTAGGGGCTGGG - Exonic
1011696765 6:89920186-89920208 CATTTTACAGATAAGGAAATAGG + Intergenic
1012955815 6:105568824-105568846 CATTTTATAAATAAAGAGCTGGG - Intergenic
1013098019 6:106963609-106963631 CATTTTACAGACAAGATTCCTGG + Intergenic
1013316930 6:108952044-108952066 CATTTTATAGACAAGAAACTAGG - Intronic
1013647788 6:112162531-112162553 CATTTTAGAGATAAGGAGAAAGG + Intronic
1014121336 6:117728648-117728670 CATTTTGCAGATAAGGAAATGGG + Intergenic
1014211819 6:118716446-118716468 CCTTTTAAAGAGAATGAGCTTGG - Intergenic
1015040206 6:128707438-128707460 CATTTTACATACAAGGAAACAGG - Intergenic
1015343840 6:132132281-132132303 CATTTTACAGACAAGGCAGATGG - Intergenic
1015545460 6:134356895-134356917 CTTTTCACAGACATGGAGCTGGG + Intergenic
1015617791 6:135096595-135096617 CATTTTACAGATAAGGAAGCTGG + Intronic
1015719509 6:136226811-136226833 CATTCTACAGATGAGGAGCTAGG - Intergenic
1016583926 6:145662599-145662621 GAATTTACAGTCAAGGAGCAAGG + Intronic
1016820023 6:148338529-148338551 CATTTTACAGATGAGGAAGTAGG - Intronic
1017199714 6:151739601-151739623 CATTTGACAGTCAAGGAGAAAGG - Intronic
1017298088 6:152822479-152822501 AATTTTAAAAATAAGGAGCTGGG + Intergenic
1017713934 6:157194817-157194839 CATTTTATAGACAAGAAAATAGG + Intronic
1018441353 6:163816391-163816413 CATTTTAGAGATGAGGACCTAGG - Intergenic
1018634107 6:165845937-165845959 CATTATACAGACAAGGCAGTGGG - Intronic
1018951705 6:168382566-168382588 AATTTTACAGACATGGAGACAGG + Intergenic
1019966791 7:4506055-4506077 CATTTTCCAAAGAAGGAACTGGG + Intergenic
1020406588 7:7842214-7842236 CATTTTACAGAGAAAGAACTGGG - Intronic
1020576476 7:9937197-9937219 CATTTTACTCACAAGGATATAGG + Intergenic
1021619914 7:22541305-22541327 CATTTTATAGACAAGGTGACTGG - Intronic
1021793275 7:24227755-24227777 CATTTTACAGAAATGGAGATGGG + Intergenic
1022501801 7:30886508-30886530 TCTTTTACAGACAGGGAGATGGG + Intronic
1023298542 7:38742506-38742528 CATTTTACAGACAAGGGAAATGG + Intronic
1023576768 7:41636215-41636237 CATTTTACACACAAGGAAACTGG + Intergenic
1023792966 7:43768502-43768524 CATTTTACAGACGAAGTGCCTGG - Intronic
1023836087 7:44068027-44068049 CATGTTACTGCCCAGGAGCTGGG - Intronic
1023993579 7:45145333-45145355 CATTTTACAGACCAGGAAACTGG + Intergenic
1024420250 7:49157643-49157665 CATTTTACAGAGAAGCTGATTGG - Intergenic
1024821251 7:53332588-53332610 CATTTCACAGCCATGCAGCTGGG + Intergenic
1025087556 7:56035373-56035395 TAGTTAACATACAAGGAGCTGGG - Intronic
1025899536 7:65732616-65732638 TAGTTAACATACAAGGAGCTGGG - Intergenic
1026659070 7:72283164-72283186 CATTTTACAGAAGAGGAGACAGG - Intronic
1027619276 7:80463349-80463371 AATTTTAAAAACTAGGAGCTAGG + Intronic
1027671554 7:81105670-81105692 GAATTTACAGCCAAGGAGCAGGG + Intergenic
1028256658 7:88607305-88607327 AACATTACTGACAAGGAGCTGGG + Intergenic
1028474246 7:91236342-91236364 CATTTTACAGATGAGGAAATTGG + Intergenic
1028738404 7:94244601-94244623 CATTTTATAGACAAGGAAACTGG + Intergenic
1029061043 7:97798190-97798212 CATTTTACAGAAAAGTGGTTAGG + Intergenic
1030068305 7:105677332-105677354 CATTTTACAGGTAAGGAGACTGG - Intronic
1030593513 7:111508984-111509006 AATTTAACAGACAAAGAGATGGG + Intronic
1030900402 7:115116371-115116393 CATTTTACAGATAAGGAATCTGG + Intergenic
1032010406 7:128343290-128343312 CATTTTACAGACAGGAATCCGGG - Intronic
1032236375 7:130127130-130127152 CCTTTTACCCACAAGGAGATAGG - Intronic
1032631874 7:133662062-133662084 CATTTTACAGATGAGGAGGCTGG + Intronic
1032656478 7:133936071-133936093 CACTTTTCAGACAAGCAGCCTGG + Intronic
1033265261 7:139880181-139880203 CATTTAAAAGACAATGAGATAGG - Intronic
1034387023 7:150748473-150748495 CATTTTACAGATGAGGAAATTGG + Intronic
1034507277 7:151503218-151503240 CATTTCACAGACAAAGAGACCGG + Intronic
1034525023 7:151653544-151653566 CATGTTACAGACTTGGGGCTGGG + Intronic
1034717516 7:153256999-153257021 CATTTTACAGAGAAGGAGAGTGG + Intergenic
1034732279 7:153398336-153398358 CTTTTTTCAGTCAAGGAGCCAGG + Intergenic
1034761024 7:153671892-153671914 CGTTTTATAGACATGGAGTTGGG - Intergenic
1035470449 7:159105786-159105808 CATTGTGCAGACAAGGAGACAGG + Intronic
1035948221 8:3989216-3989238 TATTTTACAGACAGTGATCTGGG + Intronic
1036196529 8:6721561-6721583 CATTTTACAGGCAAAGAAATAGG + Intronic
1036412020 8:8511114-8511136 TATTTTACAGATAAGGAGAAAGG + Intergenic
1036635263 8:10546192-10546214 CATTTTACAGGCAAGGGACCTGG - Intronic
1037080712 8:14782113-14782135 CATTTTATAGACAAGGAAATTGG - Intronic
1037457384 8:19077213-19077235 CATTTTATCTGCAAGGAGCTTGG - Intronic
1038230020 8:25691104-25691126 CATTTTACAGATGAGGACCCTGG + Intergenic
1038411278 8:27361637-27361659 AATTTTACAGAGAAGGTGCCTGG - Intronic
1038507158 8:28094393-28094415 AATTTTACAGACAAGGAAATGGG + Intronic
1039139738 8:34373162-34373184 CATTTTACAGATGAGGAAATTGG - Intergenic
1039224440 8:35372478-35372500 ACTTTTACAGAGAAGCAGCTGGG + Intronic
1039813893 8:41075021-41075043 AATTTCACAAACAAGAAGCTGGG - Intergenic
1040426491 8:47292624-47292646 CATTTTACAGATGAGGAAATTGG - Intronic
1040946966 8:52894231-52894253 CATTTTACAGATAGGAAACTTGG - Intergenic
1041121822 8:54593686-54593708 CCCTTTACAGCCAAGCAGCTTGG - Intergenic
1041850617 8:62387722-62387744 CATTTTAAAGATAAGGAACGTGG - Intronic
1041978099 8:63822520-63822542 CATTTTACAGATAAGGAAACTGG - Intergenic
1043438239 8:80254645-80254667 CATTTTACAGAGAGGCAGCAAGG + Intergenic
1043550650 8:81368435-81368457 CATTTTACAGATAAGAAAATTGG - Intergenic
1044707873 8:95025717-95025739 CATTTAACAGACAAGGAAACTGG + Intronic
1044892256 8:96849904-96849926 CATTTTATAAATGAGGAGCTTGG + Intronic
1044914893 8:97102617-97102639 CATTTTACTGACATGTAGATAGG - Intronic
1044963979 8:97557282-97557304 CATTTTACAGAGATGGCCCTTGG - Intergenic
1045571748 8:103374821-103374843 CATTTTACAGATAAGGAAACAGG + Intronic
1046497954 8:115038354-115038376 GATTTTAGAGACAAGGTGCCTGG + Intergenic
1046860602 8:119087003-119087025 CATTTTACAGAAAAGGAAATGGG - Intronic
1047059454 8:121207952-121207974 TATTTTAAAGACAAGGAGAGAGG - Intergenic
1047646731 8:126877852-126877874 CATTTTACAGATGAGAAACTTGG - Intergenic
1048036352 8:130681045-130681067 CATTTCCCAGTCAAGGAGTTTGG + Intergenic
1048269332 8:133016027-133016049 CATTTTTCAGGCACTGAGCTTGG + Intronic
1048290202 8:133175397-133175419 CATTTTCCAGCCATGGAACTTGG + Intergenic
1048510819 8:135060600-135060622 CATTTTACAGAAAAAAAGCCAGG - Intergenic
1048822269 8:138391287-138391309 CATTTTACAGAGGAGGATCCAGG + Intronic
1048993009 8:139772369-139772391 CATTTTACAGATGAGGAGATGGG + Intronic
1049032518 8:140048176-140048198 CATCTTCTAGACAAGGAGATAGG - Intronic
1049139925 8:140944503-140944525 CATTTTACAGATGAGAAACTGGG - Intronic
1049945044 9:586273-586295 CATTTTACAGTCAAGGGGATGGG + Intronic
1050265146 9:3882105-3882127 CATTTGGCAGACATGAAGCTAGG + Intronic
1050436481 9:5615909-5615931 CATTTTACAGATGAGGAAATTGG - Intergenic
1050726158 9:8651573-8651595 TATTTTACAGAGATGTAGCTGGG - Intronic
1051661596 9:19432036-19432058 CGTTTTACAGATAAGGAAATGGG + Intronic
1052361192 9:27561080-27561102 CATTTTACAGATGAGGAAATAGG + Intronic
1052767792 9:32659520-32659542 CATTTCACAGATAAGGAAATGGG + Intergenic
1054869905 9:70039610-70039632 CATTTTATAGACTAGGAGACAGG - Intergenic
1054872739 9:70063804-70063826 CATTTTACAGATAAGAAAATTGG + Intronic
1055336997 9:75242610-75242632 CATTTTATAGATAAGGAAATTGG - Intergenic
1056070971 9:82986240-82986262 CATTTTACAGAAGAGGAAATTGG - Intronic
1056071705 9:82993866-82993888 CATTTTACAGACAAGGAGACTGG - Intronic
1056097503 9:83270460-83270482 CATTTTACAGTCAAGGCACCAGG - Intronic
1056197636 9:84243931-84243953 CATTTTACAAAGAGGGAACTGGG - Intergenic
1056343682 9:85666992-85667014 AATTTTACAGACAGGAAACTGGG + Intronic
1056449542 9:86702851-86702873 CATTTTATAGAGAAGGAAATTGG + Intergenic
1056601882 9:88053100-88053122 GATTTTACAGCCAAGGAGCAGGG + Intergenic
1056941173 9:90958029-90958051 CACTTTACAGACAAGGAAACAGG + Intergenic
1057421400 9:94915880-94915902 CTTTTTCCAGACAAGGAACATGG + Intronic
1057799670 9:98182695-98182717 CTTTTTACAGATAAGGAGGCAGG - Intronic
1057840094 9:98479367-98479389 CATTTTACAGATGAGAAACTGGG + Intronic
1058157964 9:101535999-101536021 CATTTTACAGACAAGAAAACAGG - Intronic
1058815227 9:108676625-108676647 CATTTTATAAAAGAGGAGCTGGG + Intergenic
1059283559 9:113154295-113154317 CATCTTACAGACGAGGAGACTGG + Intronic
1059338322 9:113583071-113583093 CATTTTACAGAAAAGGAAACAGG - Intronic
1059727020 9:117018874-117018896 CATTGTACAGACAAGGAAATTGG + Intronic
1059974646 9:119702453-119702475 CATTTTACAGACTAGGAAGCTGG + Intergenic
1060214396 9:121729982-121730004 CATTCTGCAGATAAGGAGCCTGG + Intronic
1060437840 9:123610362-123610384 CATTTTACAGAGAAGGGACTAGG + Intronic
1060489582 9:124072768-124072790 CATTTTACAGACAGGGAAACTGG - Intergenic
1060590006 9:124810677-124810699 CATTTAACAGACGAGGAGACAGG + Exonic
1060933912 9:127505179-127505201 CATTTTACAGAGAAGGAAACAGG - Intergenic
1061033364 9:128100135-128100157 CATTTTACAGAGAAGGAAACAGG - Intronic
1061098475 9:128473797-128473819 CTTTTTACAGACAAGGAGAAAGG - Intronic
1061710717 9:132485868-132485890 CATTTTACAGACAAGGAATCGGG + Intronic
1062198686 9:135289000-135289022 CATTTTACAGACAGAAAACTGGG - Intergenic
1186215062 X:7290775-7290797 CATTTTACAGAGAAAGAAGTGGG - Intronic
1187262095 X:17694915-17694937 CATTTTACAGATAAAGAGACTGG - Intronic
1188443835 X:30236454-30236476 CATTTTGCTGACAAGGACATAGG - Exonic
1189298406 X:39935303-39935325 CATTTTCCAGACCAGGAGACTGG + Intergenic
1190031665 X:46978835-46978857 CATTTTACAGATGAGGAAATTGG - Intronic
1190103066 X:47537646-47537668 CATTTCACAGATAAGGAGACAGG - Intergenic
1190728857 X:53211277-53211299 CATTTTAAAGATAAGGAAATGGG + Intronic
1190759422 X:53427296-53427318 CATTTTACAGAAGAGGAGCCTGG - Intronic
1191239295 X:58168766-58168788 CATTTTACAAAAAAGTGGCTGGG - Intergenic
1192192123 X:68997308-68997330 CACTTTACAGACAAGGAAACTGG - Intergenic
1192206718 X:69101211-69101233 CATTTTACAGATGAGGACATTGG - Intergenic
1193170896 X:78334163-78334185 CATTTTACAGACAAGGAATCTGG - Intergenic
1195035668 X:100969834-100969856 CATTTTACAGATAAGAAATTTGG + Intronic
1195652331 X:107298349-107298371 AATTTTATAGCCAAGGAGCAGGG + Intergenic
1195755583 X:108195797-108195819 TATTTTCAAGACAAGGAGCGGGG + Intronic
1195904648 X:109831500-109831522 CATTTTACAGATAAGGAAACGGG + Intergenic
1196938388 X:120751942-120751964 CATTTTACAGACAAGGAAACAGG - Intergenic
1196993448 X:121354098-121354120 CATTTTACAGAAGAGTAACTTGG - Intergenic
1197014815 X:121611001-121611023 CATTTTACAGATAAGAAACTGGG + Intergenic
1197162522 X:123339966-123339988 CATTTTACAGTGAAGAAACTGGG + Intronic
1197778515 X:130136962-130136984 CATTTTACAGGCCAGGTGATAGG + Intronic
1198123386 X:133617917-133617939 CATTTTAAAAACTAGGGGCTGGG - Intronic
1198395434 X:136214555-136214577 CATTTGACAGACAAGGAACAGGG + Intronic
1198435183 X:136610062-136610084 TATAATACAGACATGGAGCTCGG - Intergenic
1198511035 X:137352041-137352063 CACCTTATAGACCAGGAGCTGGG + Intergenic
1198805382 X:140489140-140489162 CATTTTACAGATAAGGAAATTGG + Intergenic
1199285545 X:146050438-146050460 CATTTTACAGACGAAGAAATGGG + Intergenic
1199654595 X:149981755-149981777 CATTTTACAGAGGAAGAGGTGGG - Intergenic